Starting /dee2/code/volunteer_pipeline.sh SRR7814852 current disk space = 1551370199040 free memory = 1602194960 SRR7814852 SRAfilesize 9e0de62b7aa0b9d072532de93af043f8 SRR7814852.sra SRR7814852.sra file validated SRR7814852 is paired end SRR7814852 is conventional basespace SRR7814852 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814852_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.327 37.0 37.0 37.0 37.0 37.0 2 36.20025 37.0 37.0 37.0 37.0 37.0 3 36.5085 37.0 37.0 37.0 37.0 37.0 4 36.5655 37.0 37.0 37.0 37.0 37.0 5 36.4745 37.0 37.0 37.0 37.0 37.0 6 36.53 37.0 37.0 37.0 37.0 37.0 7 36.4185 37.0 37.0 37.0 37.0 37.0 8 36.5035 37.0 37.0 37.0 37.0 37.0 9 36.4305 37.0 37.0 37.0 37.0 37.0 10-14 36.537099999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.53580000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.4695 37.0 37.0 37.0 37.0 37.0 25-29 36.4486 37.0 37.0 37.0 37.0 37.0 30-34 36.3784 37.0 37.0 37.0 37.0 37.0 35-39 36.3818 37.0 37.0 37.0 37.0 37.0 40-44 36.398900000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.3476 37.0 37.0 37.0 37.0 37.0 50-54 36.3083 37.0 37.0 37.0 37.0 37.0 55-59 36.273 37.0 37.0 37.0 37.0 37.0 60-64 36.2568 37.0 37.0 37.0 37.0 37.0 65-69 36.1975 37.0 37.0 37.0 37.0 37.0 70-74 36.1308 37.0 37.0 37.0 37.0 37.0 75-79 36.1101 37.0 37.0 37.0 37.0 37.0 80-84 36.1576 37.0 37.0 37.0 37.0 37.0 85-89 36.031099999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.0036 37.0 37.0 37.0 37.0 37.0 95-99 35.868399999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.899800000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.8769 37.0 37.0 37.0 37.0 37.0 110-114 35.8237 37.0 37.0 37.0 37.0 37.0 115-119 35.6942 37.0 37.0 37.0 37.0 37.0 120-124 35.6658 37.0 37.0 37.0 37.0 37.0 125-129 35.5909 37.0 37.0 37.0 37.0 37.0 130-134 35.4815 37.0 37.0 37.0 37.0 37.0 135-139 35.351600000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.413799999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.036 37.0 37.0 37.0 27.4 37.0 150-151 34.43725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 9.0 26 5.0 27 14.0 28 18.0 29 27.0 30 45.0 31 49.0 32 60.0 33 105.0 34 169.0 35 410.0 36 2804.0 37 282.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.09418837675351 12.750501002004007 5.460921843687375 34.69438877755511 2 25.481852315394242 14.242803504380475 32.61576971214018 27.659574468085108 3 22.1 18.875 23.5 35.525 4 27.525 26.375 19.825 26.275 5 27.025 30.425 21.275 21.275 6 21.7 32.225 23.825 22.25 7 19.3 22.35 38.525 19.825 8 20.925 22.725 29.2 27.150000000000002 9 20.775 20.4 33.775 25.05 10-14 23.755000000000003 26.224999999999998 25.185000000000002 24.834999999999997 15-19 23.665 25.205 25.130000000000003 26.0 20-24 23.465 25.2 25.145 26.19 25-29 22.99 25.36 25.515 26.135 30-34 23.244999999999997 25.22 25.540000000000003 25.995 35-39 24.05 25.275 24.64 26.035000000000004 40-44 23.369999999999997 25.665 24.545 26.419999999999998 45-49 23.605 24.92 25.080000000000002 26.395000000000003 50-54 23.735 25.1 25.240000000000002 25.924999999999997 55-59 23.665 25.540000000000003 24.945 25.85 60-64 23.915 24.474999999999998 25.41 26.200000000000003 65-69 23.72 24.855 25.045 26.38 70-74 24.175 24.610000000000003 25.185000000000002 26.029999999999998 75-79 23.435 24.535 25.395 26.634999999999998 80-84 24.065 24.455 24.615000000000002 26.865 85-89 23.794999999999998 25.264999999999997 25.305 25.635 90-94 24.27 24.884999999999998 24.905 25.94 95-99 23.549999999999997 24.645 25.19 26.615 100-104 24.169999999999998 24.44 24.825 26.565 105-109 24.395 24.205 25.1 26.3 110-114 24.04 25.025 24.595 26.340000000000003 115-119 24.46 24.79 24.545 26.205000000000002 120-124 24.240000000000002 24.745 24.59 26.424999999999997 125-129 24.095 25.224999999999998 24.279999999999998 26.400000000000002 130-134 24.675 24.529999999999998 24.625 26.169999999999998 135-139 23.98 24.560000000000002 24.785 26.674999999999997 140-144 24.92 24.5 24.13 26.450000000000003 145-149 24.95 24.709999999999997 23.84 26.5 150-151 25.362499999999997 24.8625 23.35 26.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.0 28 1.0 29 3.5 30 4.5 31 7.5 32 9.5 33 17.5 34 31.0 35 34.5 36 48.5 37 70.5 38 80.5 39 91.0 40 117.0 41 128.0 42 140.0 43 164.0 44 167.0 45 191.5 46 210.0 47 206.0 48 209.5 49 189.5 50 166.5 51 149.0 52 137.5 53 127.5 54 112.5 55 108.5 56 97.5 57 82.0 58 81.0 59 69.0 60 62.5 61 65.0 62 61.0 63 56.0 64 55.5 65 59.0 66 55.0 67 56.5 68 47.0 69 42.5 70 41.5 71 31.5 72 30.0 73 26.0 74 17.5 75 10.0 76 6.5 77 6.0 78 4.5 79 3.5 80 1.0 81 1.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91167940943845 90.0 2 4.745583970471922 9.0 3 0.3163722646981281 0.8999999999999999 4 0.02636435539151068 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.3375000000000004 0.0 0.0 0.0 0.0 112-113 2.6624999999999996 0.0 0.0 0.0 0.0 114-115 3.1625 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 4.075 0.0 0.0 0.0 0.0 120-121 4.487500000000001 0.0 0.0 0.0 0.0 122-123 4.824999999999999 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.55 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.325 0.0 0.0 0.0 0.0 132-133 6.85 0.0 0.0 0.0 0.0 134-135 7.375 0.0 0.0 0.025 0.0 136-137 8.0875 0.0 0.0 0.025 0.0 138-139 8.8125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814852 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814852_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4335 37.0 37.0 37.0 37.0 37.0 2 36.222 37.0 37.0 37.0 37.0 37.0 3 36.1515 37.0 37.0 37.0 37.0 37.0 4 36.3455 37.0 37.0 37.0 37.0 37.0 5 36.3465 37.0 37.0 37.0 37.0 37.0 6 36.195 37.0 37.0 37.0 37.0 37.0 7 36.2255 37.0 37.0 37.0 37.0 37.0 8 36.307 37.0 37.0 37.0 37.0 37.0 9 36.2515 37.0 37.0 37.0 37.0 37.0 10-14 36.3004 37.0 37.0 37.0 37.0 37.0 15-19 36.2209 37.0 37.0 37.0 37.0 37.0 20-24 36.1926 37.0 37.0 37.0 37.0 37.0 25-29 36.1426 37.0 37.0 37.0 37.0 37.0 30-34 36.0813 37.0 37.0 37.0 37.0 37.0 35-39 36.0775 37.0 37.0 37.0 37.0 37.0 40-44 35.963 37.0 37.0 37.0 37.0 37.0 45-49 36.00319999999999 37.0 37.0 37.0 37.0 37.0 50-54 35.9489 37.0 37.0 37.0 37.0 37.0 55-59 35.9406 37.0 37.0 37.0 37.0 37.0 60-64 35.8855 37.0 37.0 37.0 37.0 37.0 65-69 35.857299999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.7669 37.0 37.0 37.0 37.0 37.0 75-79 35.8009 37.0 37.0 37.0 37.0 37.0 80-84 35.652100000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.675599999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.6059 37.0 37.0 37.0 37.0 37.0 95-99 35.5545 37.0 37.0 37.0 37.0 37.0 100-104 35.4708 37.0 37.0 37.0 37.0 37.0 105-109 35.4718 37.0 37.0 37.0 37.0 37.0 110-114 35.3064 37.0 37.0 37.0 34.6 37.0 115-119 35.2525 37.0 37.0 37.0 29.8 37.0 120-124 35.1529 37.0 37.0 37.0 27.4 37.0 125-129 35.0881 37.0 37.0 37.0 27.4 37.0 130-134 34.987899999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.825900000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.6606 37.0 37.0 37.0 25.0 37.0 145-149 34.674099999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.878 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 7.0 16 3.0 17 2.0 18 4.0 19 4.0 20 2.0 21 2.0 22 5.0 23 5.0 24 3.0 25 10.0 26 12.0 27 12.0 28 26.0 29 21.0 30 32.0 31 43.0 32 78.0 33 114.0 34 234.0 35 750.0 36 2506.0 37 121.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.25 18.35 7.9 30.5 2 29.599999999999998 23.175 27.675 19.55 3 23.200000000000003 24.85 27.35 24.6 4 28.15 30.125 19.075 22.650000000000002 5 28.7 33.050000000000004 18.75 19.5 6 23.674999999999997 35.05 19.6 21.675 7 24.075 18.275 33.625 24.025 8 24.099999999999998 21.925 24.05 29.925 9 24.2 22.325 27.1 26.375 10-14 26.619999999999997 25.135 22.775000000000002 25.47 15-19 25.665 24.88 23.68 25.775 20-24 25.545 25.180000000000003 24.035 25.240000000000002 25-29 26.1 25.025 23.64 25.235000000000003 30-34 26.52 24.735 23.985 24.759999999999998 35-39 25.83 24.975 23.799999999999997 25.395 40-44 26.51 25.455 23.655 24.38 45-49 26.035000000000004 24.85 24.095 25.019999999999996 50-54 26.655 25.080000000000002 23.674999999999997 24.59 55-59 26.68 25.41 23.285 24.625 60-64 26.75 24.865000000000002 23.855 24.529999999999998 65-69 25.7 25.790000000000003 23.785 24.725 70-74 25.94 24.95 24.779999999999998 24.33 75-79 25.955000000000002 24.975 24.285 24.785 80-84 26.605 25.31 23.635 24.45 85-89 26.419999999999998 25.245 24.135 24.2 90-94 26.255 25.365 24.01 24.37 95-99 27.01 25.28 23.7 24.01 100-104 26.955000000000002 26.119999999999997 23.615 23.31 105-109 25.95 25.835 23.974999999999998 24.240000000000002 110-114 26.77 25.53 23.94 23.76 115-119 27.095000000000002 25.840000000000003 23.3 23.765 120-124 27.735 25.705 23.765 22.795 125-129 27.450000000000003 26.105 22.935 23.51 130-134 27.834999999999997 25.180000000000003 23.39 23.595 135-139 28.17 25.965 23.36 22.505 140-144 28.26 25.72 23.71 22.31 145-149 28.904999999999998 24.845 23.525 22.725 150-151 29.125 25.2 23.875 21.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 1.5 26 3.0 27 3.5 28 4.5 29 5.5 30 6.0 31 6.0 32 6.0 33 14.0 34 20.0 35 28.5 36 43.0 37 54.5 38 74.0 39 88.0 40 105.0 41 136.0 42 146.5 43 154.5 44 175.0 45 186.5 46 174.0 47 158.5 48 166.0 49 168.0 50 155.0 51 143.5 52 137.5 53 124.0 54 108.5 55 101.5 56 91.5 57 87.5 58 98.5 59 96.0 60 86.0 61 87.0 62 81.0 63 67.5 64 59.0 65 68.5 66 81.0 67 69.0 68 45.5 69 47.5 70 44.5 71 33.5 72 29.0 73 27.0 74 27.0 75 19.0 76 12.5 77 5.5 78 4.5 79 5.5 80 6.0 81 5.0 82 2.5 83 1.5 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 95.06075013206551 89.97500000000001 2 4.516640253565769 8.55 3 0.3433703116745906 0.975 4 0.0 0.0 5 0.02641310089804543 0.125 6 0.0 0.0 7 0.02641310089804543 0.17500000000000002 8 0.02641310089804543 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTCATCATCCGTTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATT 8 0.2 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 7 0.17500000000000002 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0499999999999998 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.2375 0.0 0.0 0.0 0.0 112-113 2.6 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.4375 0.0 0.0 0.0 0.0 118-119 4.05 0.0 0.0 0.0 0.0 120-121 4.4625 0.0 0.0 0.0 0.0 122-123 4.8125 0.0 0.0 0.0 0.0 124-125 5.225 0.0 0.0 0.0 0.0 126-127 5.55 0.0 0.0 0.0 0.0 128-129 5.85 0.0 0.0 0.0 0.0 130-131 6.325 0.0 0.0 0.0 0.0 132-133 6.8625 0.0 0.0 0.0 0.0 134-135 7.4125 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111836 spots for SRR7814852.sra Written 2111836 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra Read 2111824 spots for SRR7814852.sra Written 2111824 spots for SRR7814852.sra SRR ids: ['SRR7814852.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_khelp9n8 SRR7814852.sra spots: 42236492 blocks: [[1, 2111824], [2111825, 4223648], [4223649, 6335472], [6335473, 8447296], [8447297, 10559120], [10559121, 12670944], [12670945, 14782768], [14782769, 16894592], [16894593, 19006416], [19006417, 21118240], [21118241, 23230064], [23230065, 25341888], [25341889, 27453712], [27453713, 29565536], [29565537, 31677360], [31677361, 33789184], [33789185, 35901008], [35901009, 38012832], [38012833, 40124656], [40124657, 42236492]] SRR7814852 file size 14290860 SRR7814852 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814852 SRR7814852_1.fastq SRR7814852_2.fastq Input file: SRR7814852_1.fastq Paired file: SRR7814852_2.fastq trimmed: SRR7814852-trimmed-pair1.fastq, SRR7814852-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:40:14 2024 >> started Fri Dec 6 12:41:04 2024 >> done (49.314s) 42236492 read pairs processed; of these: 222 ( 0.00%) short read pairs filtered out after trimming by size control 10430 ( 0.02%) empty read pairs filtered out after trimming by size control 42225840 (99.97%) read pairs available; of these: 5485253 (12.99%) trimmed read pairs available after processing 36740587 (87.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 26 0.00% 20 24 0.00% 21 23 0.00% 22 37 0.00% 23 30 0.00% 24 36 0.00% 25 39 0.00% 26 51 0.00% 27 60 0.00% 28 79 0.00% 29 69 0.00% 30 57 0.00% 31 56 0.00% 32 89 0.00% 33 71 0.00% 34 75 0.00% 35 98 0.00% 36 92 0.00% 37 85 0.00% 38 123 0.00% 39 108 0.00% 40 129 0.00% 41 127 0.00% 42 134 0.00% 43 140 0.00% 44 139 0.00% 45 158 0.00% 46 175 0.00% 47 190 0.00% 48 236 0.00% 49 248 0.00% 50 278 0.00% 51 333 0.00% 52 361 0.00% 53 338 0.00% 54 385 0.00% 55 457 0.00% 56 479 0.00% 57 556 0.00% 58 608 0.00% 59 723 0.00% 60 851 0.00% 61 959 0.00% 62 1021 0.00% 63 1107 0.00% 64 1143 0.00% 65 1339 0.00% 66 1487 0.00% 67 1533 0.00% 68 1945 0.00% 69 2170 0.01% 70 2521 0.01% 71 2942 0.01% 72 3301 0.01% 73 3758 0.01% 74 4115 0.01% 75 4531 0.01% 76 5061 0.01% 77 5669 0.01% 78 6371 0.02% 79 7202 0.02% 80 7882 0.02% 81 8956 0.02% 82 10274 0.02% 83 11407 0.03% 84 12708 0.03% 85 13761 0.03% 86 14897 0.04% 87 16350 0.04% 88 17646 0.04% 89 19276 0.05% 90 21107 0.05% 91 22677 0.05% 92 24954 0.06% 93 27046 0.06% 94 29258 0.07% 95 31402 0.07% 96 33400 0.08% 97 35217 0.08% 98 36562 0.09% 99 38242 0.09% 100 41178 0.10% 101 43599 0.10% 102 46315 0.11% 103 49253 0.12% 104 51549 0.12% 105 53348 0.13% 106 56137 0.13% 107 57702 0.14% 108 60172 0.14% 109 62266 0.15% 110 63972 0.15% 111 65983 0.16% 112 69464 0.16% 113 72363 0.17% 114 75503 0.18% 115 78299 0.19% 116 79906 0.19% 117 81616 0.19% 118 84180 0.20% 119 84545 0.20% 120 87012 0.21% 121 89476 0.21% 122 91398 0.22% 123 95143 0.23% 124 98893 0.23% 125 100213 0.24% 126 102522 0.24% 127 103398 0.24% 128 104578 0.25% 129 107306 0.25% 130 109250 0.26% 131 109631 0.26% 132 113029 0.27% 133 116581 0.28% 134 118965 0.28% 135 122295 0.29% 136 123789 0.29% 137 123185 0.29% 138 124658 0.30% 139 127592 0.30% 140 127900 0.30% 141 130532 0.31% 142 133341 0.32% 143 135686 0.32% 144 138841 0.33% 145 141956 0.34% 146 143992 0.34% 147 146748 0.35% 148 146406 0.35% 149 146301 0.35% 150 147701 0.35% 151 36740587 87.01% 42225840 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=28 prefix-density=0.38 prefix-fanout=2.1 sequence=GCAAGACATCTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=253.26 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=20.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.42 fanout-score-rank=29 prefix-density=0.80 prefix-fanout=2.3 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=878.87 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=23.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814852 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:41:53 Started mapping on | Dec 06 12:41:54 Finished on | Dec 06 12:50:44 Mapping speed, Million of reads per hour | 286.82 Number of input reads | 42225840 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 38939556 Uniquely mapped reads % | 92.22% Average mapped length | 294.03 Number of splices: Total | 37891248 Number of splices: Annotated (sjdb) | 35461642 Number of splices: GT/AG | 37339510 Number of splices: GC/AG | 435256 Number of splices: AT/AC | 25945 Number of splices: Non-canonical | 90537 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 3.15 Insertion rate per base | 0.03% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 595791 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 38056 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.79% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2690493 2690493 2690493 N_multimapping 595791 595791 595791 N_noFeature 1228789 37592370 1855655 N_ambiguous 826311 5258 105763 UnstrandedReadsAssigned:36884456 PositiveStrandReadsAssigned:1341928 NegativeStrandReadsAssigned:36978138 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814852 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814852-trimmed-pair1.fastq SRR7814852-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,225,840 reads, 37,416,662 reads pseudoaligned [quant] estimated average fragment length: 254.501 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,256 rounds 52973 SRR7814852.ke.tsv 35125 SRR7814852.se.tsv 88098 total ==> SRR7814852.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.12 0 0 PNS24247 1044 790.499 171.418 8.13419 PNS24249 1928 1674.5 323.62 7.24952 PNS24246 1044 790.499 171.418 8.13419 PNS24248 1044 790.499 171.418 8.13419 PNS24244 1471 1217.5 299.124 9.21598 PNS24243 293 98.0896 8 3.05932 KQK14069 1603 1349.5 29189 811.345 KQK14071 474 241.537 334.521 51.9515 ==> SRR7814852.se.tsv <== BRADI_1g14170v3 30647 BRADI_1g53295v3 1657 BRADI_1g59795v3 177 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1355 BRADI_1g74790v3 495 BRADI_1g09890v3 0 BRADI_1g77505v3 580 BRADI_1g48960v3 1 SRR7814852 completed mapping pipeline successfully