Starting /dee2/code/volunteer_pipeline.sh SRR7814853 current disk space = 1551383707648 free memory = 1604571060 SRR7814853 SRAfilesize e77d8749ebf98776ef656b2f9ee5c610 SRR7814853.sra SRR7814853.sra file validated SRR7814853 is paired end SRR7814853 is conventional basespace SRR7814853 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34025 37.0 37.0 37.0 37.0 37.0 2 36.3765 37.0 37.0 37.0 37.0 37.0 3 36.4925 37.0 37.0 37.0 37.0 37.0 4 36.5875 37.0 37.0 37.0 37.0 37.0 5 36.596 37.0 37.0 37.0 37.0 37.0 6 36.551 37.0 37.0 37.0 37.0 37.0 7 36.515 37.0 37.0 37.0 37.0 37.0 8 36.5155 37.0 37.0 37.0 37.0 37.0 9 36.54 37.0 37.0 37.0 37.0 37.0 10-14 36.5577 37.0 37.0 37.0 37.0 37.0 15-19 36.4947 37.0 37.0 37.0 37.0 37.0 20-24 36.471000000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4257 37.0 37.0 37.0 37.0 37.0 30-34 36.278200000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.2546 37.0 37.0 37.0 37.0 37.0 40-44 36.1631 37.0 37.0 37.0 37.0 37.0 45-49 36.2626 37.0 37.0 37.0 37.0 37.0 50-54 36.30369999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.2909 37.0 37.0 37.0 37.0 37.0 60-64 36.2295 37.0 37.0 37.0 37.0 37.0 65-69 36.1867 37.0 37.0 37.0 37.0 37.0 70-74 36.06420000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.0939 37.0 37.0 37.0 37.0 37.0 80-84 36.078199999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0946 37.0 37.0 37.0 37.0 37.0 90-94 35.9324 37.0 37.0 37.0 37.0 37.0 95-99 35.6374 37.0 37.0 37.0 37.0 37.0 100-104 35.4208 37.0 37.0 37.0 34.6 37.0 105-109 35.5441 37.0 37.0 37.0 37.0 37.0 110-114 35.6494 37.0 37.0 37.0 37.0 37.0 115-119 35.427 37.0 37.0 37.0 37.0 37.0 120-124 34.8352 37.0 37.0 37.0 25.0 37.0 125-129 34.5495 37.0 37.0 37.0 25.0 37.0 130-134 35.1633 37.0 37.0 37.0 27.4 37.0 135-139 34.90689999999999 37.0 37.0 37.0 25.0 37.0 140-144 35.0532 37.0 37.0 37.0 25.0 37.0 145-149 34.9024 37.0 37.0 37.0 25.0 37.0 150-151 34.14075 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 7.0 27 9.0 28 18.0 29 25.0 30 28.0 31 55.0 32 95.0 33 153.0 34 272.0 35 639.0 36 2519.0 37 175.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.60797592174567 10.659643842488087 5.367444193629295 35.36493604213695 2 25.25 13.850000000000001 30.7 30.2 3 22.3 17.5 22.425 37.775 4 26.700000000000003 25.775 21.099999999999998 26.424999999999997 5 26.724999999999998 28.449999999999996 22.3 22.525000000000002 6 22.825 30.325000000000003 23.45 23.400000000000002 7 18.925 22.900000000000002 38.550000000000004 19.625 8 20.625 21.7 28.4 29.275000000000002 9 19.85 20.724999999999998 33.25 26.174999999999997 10-14 23.595 25.94 24.095 26.369999999999997 15-19 23.565 24.575 25.485000000000003 26.375 20-24 23.82 24.759999999999998 24.759999999999998 26.66 25-29 23.66 24.275 24.905 27.16 30-34 23.98 24.59 25.255 26.174999999999997 35-39 23.580000000000002 24.785 24.815 26.82 40-44 23.77 24.41 24.895 26.924999999999997 45-49 23.78 23.715 25.264999999999997 27.24 50-54 24.07 24.615000000000002 24.23 27.084999999999997 55-59 24.445 24.54 24.48 26.534999999999997 60-64 24.560000000000002 24.035 24.745 26.66 65-69 24.104999999999997 24.21 24.375 27.310000000000002 70-74 24.6 24.265 24.22 26.915 75-79 24.755 24.85 23.98 26.415 80-84 24.895 24.025 23.945 27.134999999999998 85-89 25.069999999999997 24.265 24.224999999999998 26.44 90-94 24.975 23.805 24.325 26.895000000000003 95-99 24.66 24.29 24.115000000000002 26.935 100-104 25.745 24.07 23.635 26.55 105-109 25.605 24.16 23.674999999999997 26.56 110-114 24.81 23.86 24.485 26.845000000000002 115-119 25.330000000000002 23.32 24.415 26.935 120-124 25.295 24.11 23.695 26.900000000000002 125-129 24.75 24.565 23.845 26.840000000000003 130-134 24.795 23.815 24.05 27.339999999999996 135-139 25.195 24.205 24.085 26.515 140-144 25.545 24.335 23.61 26.51 145-149 25.619999999999997 23.9 23.419999999999998 27.060000000000002 150-151 25.912499999999998 23.5875 23.75 26.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 4.0 28 3.0 29 2.5 30 9.5 31 12.0 32 14.5 33 22.0 34 27.5 35 34.0 36 39.0 37 48.5 38 63.0 39 84.5 40 104.0 41 119.5 42 138.0 43 154.5 44 159.5 45 157.0 46 166.0 47 167.5 48 160.5 49 162.0 50 157.5 51 139.0 52 126.5 53 136.5 54 132.0 55 126.5 56 121.5 57 114.0 58 111.0 59 90.0 60 74.0 61 77.5 62 81.0 63 72.5 64 64.0 65 63.5 66 71.5 67 66.0 68 49.0 69 34.0 70 35.0 71 38.0 72 34.5 73 33.5 74 27.0 75 21.5 76 17.5 77 10.5 78 8.5 79 6.5 80 1.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.3 #Duplication Level Percentage of deduplicated Percentage of total 1 90.4485049833887 81.675 2 8.610188261351052 15.55 3 0.7198228128460686 1.95 4 0.1937984496124031 0.7000000000000001 5 0.02768549280177187 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.5750000000000002 0.0 0.0 0.0 0.0 104-105 1.7625000000000002 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.7625 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.375 0.0 0.0 0.0 0.0 118-119 3.725 0.0 0.0 0.0 0.0 120-121 4.237500000000001 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.0875 0.0 0.0 0.0 0.0 126-127 5.6 0.0 0.0 0.0 0.0 128-129 6.1375 0.0 0.0 0.0 0.0 130-131 6.6 0.0 0.0 0.0 0.0 132-133 7.075 0.0 0.0 0.0 0.0 134-135 7.675 0.0 0.0 0.0 0.0 136-137 8.2125 0.0 0.0 0.0 0.0 138-139 8.787500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCGG 10 0.006832588 144.9875 9 >>END_MODULE SRR7814853 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814853_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.086 37.0 37.0 37.0 37.0 37.0 2 35.8615 37.0 37.0 37.0 37.0 37.0 3 35.7415 37.0 37.0 37.0 37.0 37.0 4 35.905 37.0 37.0 37.0 37.0 37.0 5 35.878 37.0 37.0 37.0 37.0 37.0 6 35.8185 37.0 37.0 37.0 37.0 37.0 7 35.6005 37.0 37.0 37.0 37.0 37.0 8 35.789 37.0 37.0 37.0 37.0 37.0 9 35.986 37.0 37.0 37.0 37.0 37.0 10-14 35.8565 37.0 37.0 37.0 37.0 37.0 15-19 35.4767 37.0 37.0 37.0 37.0 37.0 20-24 35.7111 37.0 37.0 37.0 37.0 37.0 25-29 35.60359999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.3035 37.0 37.0 37.0 34.6 37.0 35-39 35.4141 37.0 37.0 37.0 34.6 37.0 40-44 34.98950000000001 37.0 37.0 37.0 29.8 37.0 45-49 35.1121 37.0 37.0 37.0 29.8 37.0 50-54 34.408 37.0 37.0 37.0 25.0 37.0 55-59 34.328700000000005 37.0 37.0 37.0 25.0 37.0 60-64 34.6049 37.0 37.0 37.0 25.0 37.0 65-69 34.5911 37.0 37.0 37.0 25.0 37.0 70-74 34.2222 37.0 37.0 37.0 25.0 37.0 75-79 34.132400000000004 37.0 37.0 37.0 25.0 37.0 80-84 33.9736 37.0 37.0 37.0 22.2 37.0 85-89 34.348000000000006 37.0 37.0 37.0 25.0 37.0 90-94 33.8805 37.0 37.0 37.0 25.0 37.0 95-99 32.8682 37.0 37.0 37.0 11.0 37.0 100-104 33.3017 37.0 37.0 37.0 19.4 37.0 105-109 32.8665 37.0 37.0 37.0 13.8 37.0 110-114 33.3072 37.0 37.0 37.0 19.4 37.0 115-119 33.3948 37.0 37.0 37.0 19.4 37.0 120-124 32.6553 37.0 37.0 37.0 11.0 37.0 125-129 32.899899999999995 37.0 37.0 37.0 13.8 37.0 130-134 32.311899999999994 37.0 37.0 37.0 11.0 37.0 135-139 32.4572 37.0 37.0 37.0 11.0 37.0 140-144 32.5629 37.0 37.0 37.0 11.0 37.0 145-149 32.1451 37.0 32.2 37.0 11.0 37.0 150-151 31.658250000000002 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 3.0 17 3.0 18 3.0 19 5.0 20 9.0 21 7.0 22 16.0 23 25.0 24 41.0 25 59.0 26 77.0 27 88.0 28 121.0 29 111.0 30 133.0 31 149.0 32 151.0 33 226.0 34 310.0 35 676.0 36 1743.0 37 42.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.175 17.75 7.875 29.2 2 31.525 21.125 26.900000000000002 20.45 3 23.849999999999998 23.400000000000002 28.1 24.65 4 27.975 30.375000000000004 19.275000000000002 22.375 5 29.2 32.300000000000004 18.2 20.3 6 25.05 33.775 19.025 22.15 7 23.775 18.325 32.1 25.8 8 24.075 22.675 23.7 29.549999999999997 9 26.125 21.0 25.324999999999996 27.55 10-14 27.634999999999998 24.525 21.91 25.929999999999996 15-19 27.27 24.365000000000002 22.445 25.919999999999998 20-24 27.215 24.385 22.73 25.669999999999998 25-29 27.485 24.88 22.395 25.240000000000002 30-34 27.005000000000003 24.91 23.41 24.675 35-39 27.200000000000003 25.085 22.59 25.124999999999996 40-44 27.115000000000002 25.115 22.759999999999998 25.009999999999998 45-49 26.900000000000002 24.445 23.09 25.564999999999998 50-54 26.935 24.834999999999997 22.775000000000002 25.455 55-59 26.779999999999998 24.915000000000003 22.825 25.480000000000004 60-64 27.095000000000002 24.905 22.345000000000002 25.655 65-69 26.834999999999997 25.064999999999998 22.59 25.509999999999998 70-74 26.640000000000004 25.05 23.044999999999998 25.264999999999997 75-79 26.71 24.83 23.425 25.035 80-84 26.484999999999996 25.56 23.175 24.779999999999998 85-89 27.339999999999996 24.02 23.485 25.155 90-94 26.1 25.72 22.67 25.509999999999998 95-99 26.96 25.669999999999998 22.45 24.92 100-104 27.36 25.115 23.369999999999997 24.154999999999998 105-109 26.96 26.33 22.58 24.13 110-114 26.51 25.929999999999996 22.745 24.815 115-119 27.215 25.779999999999998 22.439999999999998 24.565 120-124 26.87 26.619999999999997 22.715 23.794999999999998 125-129 27.26 26.529999999999998 22.075 24.135 130-134 27.295 26.615 22.645 23.445 135-139 26.995 26.395000000000003 23.18 23.43 140-144 27.96 26.279999999999998 23.015 22.745 145-149 27.725 26.44 22.634999999999998 23.200000000000003 150-151 27.987499999999997 25.8125 23.0375 23.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 1.0 5 0.5 6 1.0 7 1.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 3.5 23 3.5 24 3.0 25 4.0 26 5.0 27 4.5 28 2.5 29 4.5 30 7.5 31 10.5 32 11.5 33 16.5 34 20.0 35 25.0 36 41.5 37 55.5 38 68.5 39 78.0 40 82.5 41 98.5 42 121.0 43 129.5 44 134.0 45 138.0 46 149.5 47 157.0 48 150.0 49 138.5 50 134.5 51 132.0 52 116.0 53 114.0 54 132.0 55 139.5 56 124.0 57 119.5 58 116.0 59 101.0 60 91.5 61 87.5 62 86.5 63 91.0 64 91.0 65 71.5 66 69.5 67 85.0 68 73.0 69 57.0 70 43.5 71 37.5 72 48.5 73 47.5 74 32.5 75 21.0 76 14.0 77 12.5 78 11.5 79 5.0 80 2.5 81 3.0 82 2.0 83 0.5 84 1.0 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 0.5 96 1.0 97 1.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.825 #Duplication Level Percentage of deduplicated Percentage of total 1 91.46710707404348 83.075 2 7.4593999449490775 13.55 3 0.7982383704927056 2.175 4 0.13762730525736308 0.5 5 0.08257638315441783 0.375 6 0.027525461051472612 0.15 7 0.027525461051472612 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 6 0.15 No Hit GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 5 0.125 No Hit GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 5 0.125 No Hit CCTTACCAGGGCTTGACATGCCGCGAATCCTCTTGAAAGAGAGGGGTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7250000000000001 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0625 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3875000000000002 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.05 0.0 0.0 0.0 0.0 118-119 3.35 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 5.074999999999999 0.0 0.0 0.0 0.0 128-129 5.5375 0.0 0.0 0.0 0.0 130-131 5.925 0.0 0.0 0.0 0.0 132-133 6.3375 0.0 0.0 0.0 0.0 134-135 6.9 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138-139 7.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGATC 10 0.006830828 145.0 2 GCACCAG 10 0.006830828 145.0 4 >>END_MODULE Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375890 spots for SRR7814853.sra Written 2375890 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra Read 2375882 spots for SRR7814853.sra Written 2375882 spots for SRR7814853.sra SRR ids: ['SRR7814853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l44_agpf SRR7814853.sra spots: 47517648 blocks: [[1, 2375882], [2375883, 4751764], [4751765, 7127646], [7127647, 9503528], [9503529, 11879410], [11879411, 14255292], [14255293, 16631174], [16631175, 19007056], [19007057, 21382938], [21382939, 23758820], [23758821, 26134702], [26134703, 28510584], [28510585, 30886466], [30886467, 33262348], [33262349, 35638230], [35638231, 38014112], [38014113, 40389994], [40389995, 42765876], [42765877, 45141758], [45141759, 47517648]] SRR7814853 file size 16080471 SRR7814853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814853 SRR7814853_1.fastq SRR7814853_2.fastq Input file: SRR7814853_1.fastq Paired file: SRR7814853_2.fastq trimmed: SRR7814853-trimmed-pair1.fastq, SRR7814853-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:42:43 2024 >> started Fri Dec 6 12:43:43 2024 >> done (59.839s) 47517648 read pairs processed; of these: 215 ( 0.00%) short read pairs filtered out after trimming by size control 10153 ( 0.02%) empty read pairs filtered out after trimming by size control 47507280 (99.98%) read pairs available; of these: 5625701 (11.84%) trimmed read pairs available after processing 41881579 (88.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 14 0.00% 20 16 0.00% 21 24 0.00% 22 30 0.00% 23 34 0.00% 24 30 0.00% 25 37 0.00% 26 35 0.00% 27 39 0.00% 28 51 0.00% 29 69 0.00% 30 44 0.00% 31 61 0.00% 32 77 0.00% 33 63 0.00% 34 76 0.00% 35 84 0.00% 36 85 0.00% 37 86 0.00% 38 112 0.00% 39 94 0.00% 40 122 0.00% 41 132 0.00% 42 149 0.00% 43 128 0.00% 44 158 0.00% 45 131 0.00% 46 167 0.00% 47 177 0.00% 48 227 0.00% 49 230 0.00% 50 258 0.00% 51 338 0.00% 52 338 0.00% 53 388 0.00% 54 377 0.00% 55 468 0.00% 56 490 0.00% 57 536 0.00% 58 623 0.00% 59 804 0.00% 60 872 0.00% 61 1061 0.00% 62 1177 0.00% 63 1254 0.00% 64 1304 0.00% 65 1453 0.00% 66 1671 0.00% 67 1846 0.00% 68 2088 0.00% 69 2479 0.01% 70 2922 0.01% 71 3324 0.01% 72 3870 0.01% 73 4162 0.01% 74 4573 0.01% 75 5132 0.01% 76 5673 0.01% 77 6322 0.01% 78 7169 0.02% 79 7917 0.02% 80 9047 0.02% 81 10267 0.02% 82 11444 0.02% 83 12581 0.03% 84 13700 0.03% 85 15350 0.03% 86 16696 0.04% 87 17646 0.04% 88 19555 0.04% 89 21044 0.04% 90 22595 0.05% 91 25165 0.05% 92 27035 0.06% 93 29369 0.06% 94 31416 0.07% 95 33680 0.07% 96 35160 0.07% 97 37958 0.08% 98 39331 0.08% 99 41087 0.09% 100 43943 0.09% 101 46183 0.10% 102 48691 0.10% 103 51343 0.11% 104 52961 0.11% 105 55146 0.12% 106 57782 0.12% 107 60426 0.13% 108 61697 0.13% 109 64708 0.14% 110 66488 0.14% 111 68689 0.14% 112 72188 0.15% 113 74622 0.16% 114 76738 0.16% 115 80144 0.17% 116 82499 0.17% 117 83773 0.18% 118 84652 0.18% 119 86224 0.18% 120 89535 0.19% 121 90984 0.19% 122 92170 0.19% 123 97602 0.21% 124 99211 0.21% 125 101889 0.21% 126 103892 0.22% 127 105861 0.22% 128 107266 0.23% 129 110095 0.23% 130 110120 0.23% 131 112388 0.24% 132 115702 0.24% 133 118058 0.25% 134 120203 0.25% 135 123016 0.26% 136 124979 0.26% 137 125651 0.26% 138 125821 0.26% 139 129929 0.27% 140 129808 0.27% 141 132614 0.28% 142 135624 0.29% 143 137018 0.29% 144 141139 0.30% 145 143623 0.30% 146 143994 0.30% 147 146212 0.31% 148 148171 0.31% 149 148788 0.31% 150 151629 0.32% 151 41881579 88.16% 47507280 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.53 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=36 fanout-score=57.83 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=4.1 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=22 prefix-density=0.82 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=83.89 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=4.6 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814853 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:44:32 Started mapping on | Dec 06 12:44:33 Finished on | Dec 06 12:51:26 Mapping speed, Million of reads per hour | 414.11 Number of input reads | 47507280 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 40559859 Uniquely mapped reads % | 85.38% Average mapped length | 294.32 Number of splices: Total | 37096509 Number of splices: Annotated (sjdb) | 35020059 Number of splices: GT/AG | 36544199 Number of splices: GC/AG | 444977 Number of splices: AT/AC | 14525 Number of splices: Non-canonical | 92808 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2155412 % of reads mapped to multiple loci | 4.54% Number of reads mapped to too many loci | 332328 % of reads mapped to too many loci | 0.70% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.06% % of reads unmapped: other | 4.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4792009 4792009 4792009 N_multimapping 2155412 2155412 2155412 N_noFeature 2864065 39229786 3243055 N_ambiguous 1144780 5650 195346 UnstrandedReadsAssigned:36551014 PositiveStrandReadsAssigned:1324423 NegativeStrandReadsAssigned:37121458 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814853 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814853-trimmed-pair1.fastq SRR7814853-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,507,280 reads, 38,229,178 reads pseudoaligned [quant] estimated average fragment length: 255.257 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR7814853.ke.tsv 35125 SRR7814853.se.tsv 88098 total ==> SRR7814853.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.149 0 0 PNS24247 1044 789.743 104.855 4.20929 PNS24249 1928 1673.74 199.35 3.77602 PNS24246 1044 789.743 104.855 4.20929 PNS24248 1044 789.743 104.855 4.20929 PNS24244 1471 1216.74 358.086 9.33033 PNS24243 293 97.6885 10 3.24537 KQK14069 1603 1348.74 18133 426.233 KQK14071 474 239.177 217.444 28.8228 ==> SRR7814853.se.tsv <== BRADI_1g14170v3 19071 BRADI_1g53295v3 2376 BRADI_1g59795v3 387 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 421 BRADI_1g74790v3 393 BRADI_1g09890v3 0 BRADI_1g77505v3 989 BRADI_1g48960v3 2 SRR7814853 completed mapping pipeline successfully