Starting /dee2/code/volunteer_pipeline.sh SRR7814854 current disk space = 1551389642752 free memory = 1323878360 SRR7814854 SRAfilesize 3ba276df337eecd6e30eb5c71f985d42 SRR7814854.sra SRR7814854.sra file validated SRR7814854 is paired end SRR7814854 is conventional basespace SRR7814854 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4295 37.0 37.0 37.0 37.0 37.0 2 36.353 37.0 37.0 37.0 37.0 37.0 3 36.5215 37.0 37.0 37.0 37.0 37.0 4 36.589 37.0 37.0 37.0 37.0 37.0 5 36.5565 37.0 37.0 37.0 37.0 37.0 6 36.4385 37.0 37.0 37.0 37.0 37.0 7 36.5155 37.0 37.0 37.0 37.0 37.0 8 36.4735 37.0 37.0 37.0 37.0 37.0 9 36.538 37.0 37.0 37.0 37.0 37.0 10-14 36.5791 37.0 37.0 37.0 37.0 37.0 15-19 36.5793 37.0 37.0 37.0 37.0 37.0 20-24 36.5643 37.0 37.0 37.0 37.0 37.0 25-29 36.442600000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.4413 37.0 37.0 37.0 37.0 37.0 35-39 36.40930000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.3726 37.0 37.0 37.0 37.0 37.0 45-49 36.3651 37.0 37.0 37.0 37.0 37.0 50-54 36.367 37.0 37.0 37.0 37.0 37.0 55-59 36.274899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.329 37.0 37.0 37.0 37.0 37.0 65-69 36.288799999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.332 37.0 37.0 37.0 37.0 37.0 75-79 36.2796 37.0 37.0 37.0 37.0 37.0 80-84 36.182100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2105 37.0 37.0 37.0 37.0 37.0 90-94 36.1836 37.0 37.0 37.0 37.0 37.0 95-99 36.1371 37.0 37.0 37.0 37.0 37.0 100-104 36.178599999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.1606 37.0 37.0 37.0 37.0 37.0 110-114 36.0991 37.0 37.0 37.0 37.0 37.0 115-119 36.0263 37.0 37.0 37.0 37.0 37.0 120-124 35.8547 37.0 37.0 37.0 37.0 37.0 125-129 35.9413 37.0 37.0 37.0 37.0 37.0 130-134 35.840700000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.8722 37.0 37.0 37.0 37.0 37.0 140-144 35.8253 37.0 37.0 37.0 37.0 37.0 145-149 35.8275 37.0 37.0 37.0 37.0 37.0 150-151 35.384 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 3.0 24 2.0 25 0.0 26 4.0 27 7.0 28 16.0 29 20.0 30 28.0 31 39.0 32 44.0 33 82.0 34 156.0 35 343.0 36 2785.0 37 470.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.899147014550934 11.766181635725037 4.390366281986954 26.94430506773708 2 26.1 13.175 29.475 31.25 3 22.625 19.1 23.775 34.5 4 29.75 23.65 19.975 26.625 5 28.299999999999997 27.675 21.9 22.125 6 23.674999999999997 31.0 22.525000000000002 22.8 7 19.025 22.625 37.35 21.0 8 19.950000000000003 24.15 29.575000000000003 26.325 9 21.2 20.974999999999998 31.7 26.125 10-14 24.52 25.71 24.645 25.124999999999996 15-19 24.34 24.95 24.915000000000003 25.795 20-24 24.585 24.654999999999998 24.545 26.215 25-29 24.505 25.009999999999998 24.07 26.415 30-34 23.849999999999998 24.884999999999998 24.990000000000002 26.275 35-39 23.990000000000002 24.545 25.05 26.415 40-44 25.19 24.04 24.695 26.075 45-49 24.85 24.725 24.13 26.295 50-54 24.85 24.82 24.33 26.0 55-59 24.759999999999998 24.66 24.05 26.529999999999998 60-64 24.755 24.5 24.025 26.72 65-69 24.349999999999998 24.42 24.66 26.57 70-74 24.585 23.71 24.395 27.310000000000002 75-79 24.66 24.455 24.099999999999998 26.784999999999997 80-84 25.230000000000004 24.15 24.55 26.07 85-89 24.63 24.585 24.165 26.619999999999997 90-94 25.885 24.240000000000002 23.05 26.825 95-99 25.185000000000002 24.16 24.135 26.52 100-104 25.8 24.235 23.605 26.36 105-109 25.045 23.91 24.104999999999997 26.939999999999998 110-114 25.480000000000004 23.36 24.25 26.91 115-119 24.959999999999997 23.810000000000002 23.974999999999998 27.255000000000003 120-124 25.509999999999998 23.845 23.685000000000002 26.96 125-129 25.430000000000003 24.224999999999998 24.060000000000002 26.284999999999997 130-134 25.740000000000002 24.195 23.265 26.8 135-139 25.605 24.265 23.275000000000002 26.855 140-144 25.705 24.165 23.549999999999997 26.58 145-149 25.624999999999996 23.580000000000002 23.735 27.060000000000002 150-151 26.3625 23.825 22.85 26.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 3.5 28 3.5 29 2.5 30 5.5 31 7.5 32 12.5 33 18.5 34 23.0 35 29.5 36 42.5 37 62.0 38 74.5 39 92.5 40 113.5 41 131.5 42 146.0 43 149.0 44 155.0 45 157.5 46 173.0 47 185.5 48 165.5 49 157.0 50 147.5 51 131.5 52 121.0 53 108.0 54 112.0 55 101.5 56 93.0 57 102.0 58 89.0 59 82.0 60 96.0 61 89.5 62 70.5 63 71.0 64 69.0 65 72.0 66 73.5 67 64.0 68 64.0 69 63.0 70 48.0 71 44.5 72 41.0 73 25.0 74 27.0 75 21.0 76 14.5 77 17.5 78 12.0 79 5.0 80 1.0 81 1.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.43141592920354 81.75 2 8.628318584070795 15.6 3 0.8296460176991152 2.25 4 0.11061946902654868 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.325 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.8 0.0 0.0 0.0 0.0 108-109 1.9249999999999998 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.9000000000000004 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.7 0.0 0.0 0.0 0.0 128-129 5.112500000000001 0.0 0.0 0.0 0.0 130-131 5.637499999999999 0.0 0.0 0.0 0.0 132-133 6.050000000000001 0.0 0.0 0.0 0.0 134-135 6.4375 0.0 0.0 0.0 0.0 136-137 6.9125 0.0 0.0 0.0 0.0 138-139 7.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGCCA 10 0.006830828 145.0 1 >>END_MODULE SRR7814854 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.134 37.0 37.0 37.0 37.0 37.0 2 35.993 37.0 37.0 37.0 37.0 37.0 3 35.9545 37.0 37.0 37.0 37.0 37.0 4 35.815 37.0 37.0 37.0 37.0 37.0 5 36.046 37.0 37.0 37.0 37.0 37.0 6 35.8765 37.0 37.0 37.0 37.0 37.0 7 35.8925 37.0 37.0 37.0 37.0 37.0 8 36.004 37.0 37.0 37.0 37.0 37.0 9 35.888 37.0 37.0 37.0 37.0 37.0 10-14 35.8773 37.0 37.0 37.0 37.0 37.0 15-19 35.8448 37.0 37.0 37.0 37.0 37.0 20-24 35.7377 37.0 37.0 37.0 37.0 37.0 25-29 35.726600000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.7118 37.0 37.0 37.0 37.0 37.0 35-39 35.6853 37.0 37.0 37.0 37.0 37.0 40-44 35.7197 37.0 37.0 37.0 37.0 37.0 45-49 35.6276 37.0 37.0 37.0 37.0 37.0 50-54 35.6202 37.0 37.0 37.0 37.0 37.0 55-59 35.540200000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.528200000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.494600000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.4227 37.0 37.0 37.0 37.0 37.0 75-79 35.478899999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.4387 37.0 37.0 37.0 37.0 37.0 85-89 35.332100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.347899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.3868 37.0 37.0 37.0 37.0 37.0 100-104 35.3804 37.0 37.0 37.0 37.0 37.0 105-109 35.302699999999994 37.0 37.0 37.0 34.6 37.0 110-114 35.256299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.140499999999996 37.0 37.0 37.0 29.8 37.0 120-124 35.0964 37.0 37.0 37.0 29.8 37.0 125-129 35.105199999999996 37.0 37.0 37.0 27.4 37.0 130-134 34.9732 37.0 37.0 37.0 25.0 37.0 135-139 34.8209 37.0 37.0 37.0 25.0 37.0 140-144 34.639 37.0 37.0 37.0 25.0 37.0 145-149 34.622699999999995 37.0 37.0 37.0 25.0 37.0 150-151 33.9285 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 10.0 14 21.0 15 7.0 16 3.0 17 4.0 18 5.0 19 2.0 20 7.0 21 8.0 22 11.0 23 15.0 24 11.0 25 7.0 26 10.0 27 18.0 28 22.0 29 22.0 30 30.0 31 48.0 32 84.0 33 142.0 34 248.0 35 585.0 36 2472.0 37 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.8 19.0 6.35 24.85 2 31.775 21.525 24.9 21.8 3 25.674999999999997 24.525 26.174999999999997 23.625 4 28.65 29.225 18.475 23.65 5 29.25 31.874999999999996 17.25 21.625 6 25.05 34.025 17.5 23.425 7 24.9 17.549999999999997 32.4 25.15 8 25.1 22.325 21.325 31.25 9 24.775 22.85 24.65 27.725 10-14 28.005000000000003 23.985 21.07 26.939999999999998 15-19 27.195000000000004 24.205 22.49 26.11 20-24 27.200000000000003 24.04 22.695 26.064999999999998 25-29 27.27 24.335 22.085 26.31 30-34 26.905 25.34 22.355 25.4 35-39 26.63 24.75 22.185 26.435 40-44 26.97 24.92 22.195 25.915 45-49 27.265 24.099999999999998 22.345000000000002 26.290000000000003 50-54 26.775 24.945 22.575 25.705 55-59 26.85 24.285 22.335 26.529999999999998 60-64 26.939999999999998 24.154999999999998 23.11 25.795 65-69 26.545 24.395 23.115 25.945 70-74 27.015 24.154999999999998 22.66 26.169999999999998 75-79 26.805 23.810000000000002 23.375 26.009999999999998 80-84 26.555 24.959999999999997 22.634999999999998 25.85 85-89 27.005000000000003 24.175 22.775000000000002 26.045 90-94 27.639999999999997 24.11 22.8 25.45 95-99 27.060000000000002 23.895 22.96 26.085 100-104 27.134999999999998 24.37 22.720000000000002 25.775 105-109 26.97 24.79 22.355 25.885 110-114 26.99 24.555 22.805 25.650000000000002 115-119 27.345000000000002 24.725 22.82 25.11 120-124 27.439999999999998 25.014999999999997 22.395 25.15 125-129 28.015 25.215 21.925 24.845 130-134 28.095 24.705 22.825 24.375 135-139 27.685 24.51 23.115 24.69 140-144 28.74 24.58 22.775000000000002 23.905 145-149 28.685 24.48 23.23 23.605 150-151 29.6875 25.724999999999998 21.375 23.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.0 16 1.0 17 1.5 18 1.0 19 0.0 20 1.0 21 2.5 22 1.5 23 0.5 24 0.5 25 1.0 26 1.5 27 3.0 28 4.0 29 5.0 30 7.5 31 10.5 32 9.0 33 8.5 34 12.5 35 23.5 36 38.0 37 48.0 38 56.5 39 67.0 40 97.5 41 117.5 42 129.5 43 139.5 44 140.5 45 139.5 46 134.5 47 141.5 48 142.0 49 139.5 50 133.5 51 128.0 52 112.0 53 112.0 54 114.5 55 103.5 56 111.5 57 96.0 58 93.0 59 106.5 60 99.0 61 92.5 62 106.5 63 101.0 64 82.5 65 83.0 66 81.5 67 77.0 68 74.0 69 71.0 70 65.5 71 58.5 72 50.5 73 46.5 74 44.0 75 30.5 76 22.0 77 21.0 78 12.0 79 6.5 80 3.0 81 3.5 82 3.5 83 1.5 84 1.5 85 0.5 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 1.0 92 1.5 93 0.5 94 0.5 95 1.5 96 2.0 97 1.5 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.64999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 90.89906232763376 82.39999999999999 2 8.16326530612245 14.799999999999999 3 0.7997793712079426 2.175 4 0.11031439602868175 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.027578599007170437 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.2 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 1.9500000000000002 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.5 0.0 0.0 0.0 0.0 116-117 2.7125 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.2125 0.0 0.0 0.0 0.0 126-127 4.7375 0.0 0.0 0.0 0.0 128-129 5.1875 0.0 0.0 0.0 0.0 130-131 5.737500000000001 0.0 0.0 0.0 0.0 132-133 6.1625 0.0 0.0 0.0 0.0 134-135 6.574999999999999 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAGG 10 0.006830828 145.0 2 TCAAATC 10 0.006830828 145.0 145 >>END_MODULE Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223353 spots for SRR7814854.sra Written 3223353 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra Read 3223338 spots for SRR7814854.sra Written 3223338 spots for SRR7814854.sra SRR ids: ['SRR7814854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ux9_2jl SRR7814854.sra spots: 64466775 blocks: [[1, 3223338], [3223339, 6446676], [6446677, 9670014], [9670015, 12893352], [12893353, 16116690], [16116691, 19340028], [19340029, 22563366], [22563367, 25786704], [25786705, 29010042], [29010043, 32233380], [32233381, 35456718], [35456719, 38680056], [38680057, 41903394], [41903395, 45126732], [45126733, 48350070], [48350071, 51573408], [51573409, 54796746], [54796747, 58020084], [58020085, 61243422], [61243423, 64466775]] SRR7814854 file size 21823974 SRR7814854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814854 SRR7814854_1.fastq SRR7814854_2.fastq Input file: SRR7814854_1.fastq Paired file: SRR7814854_2.fastq trimmed: SRR7814854-trimmed-pair1.fastq, SRR7814854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:48:03 2024 >> started Fri Dec 6 12:49:42 2024 >> done (99.295s) 64466775 read pairs processed; of these: 358 ( 0.00%) short read pairs filtered out after trimming by size control 26660 ( 0.04%) empty read pairs filtered out after trimming by size control 64439757 (99.96%) read pairs available; of these: 7288497 (11.31%) trimmed read pairs available after processing 57151260 (88.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 33 0.00% 20 28 0.00% 21 28 0.00% 22 37 0.00% 23 52 0.00% 24 54 0.00% 25 70 0.00% 26 58 0.00% 27 63 0.00% 28 67 0.00% 29 73 0.00% 30 85 0.00% 31 80 0.00% 32 91 0.00% 33 98 0.00% 34 81 0.00% 35 123 0.00% 36 98 0.00% 37 87 0.00% 38 139 0.00% 39 159 0.00% 40 135 0.00% 41 169 0.00% 42 186 0.00% 43 179 0.00% 44 159 0.00% 45 215 0.00% 46 216 0.00% 47 268 0.00% 48 355 0.00% 49 363 0.00% 50 422 0.00% 51 432 0.00% 52 493 0.00% 53 544 0.00% 54 569 0.00% 55 632 0.00% 56 640 0.00% 57 806 0.00% 58 907 0.00% 59 1080 0.00% 60 1314 0.00% 61 1364 0.00% 62 1571 0.00% 63 1740 0.00% 64 1906 0.00% 65 2101 0.00% 66 2310 0.00% 67 2575 0.00% 68 2956 0.00% 69 3415 0.01% 70 4006 0.01% 71 4446 0.01% 72 5088 0.01% 73 5646 0.01% 74 6247 0.01% 75 7013 0.01% 76 7759 0.01% 77 8515 0.01% 78 9209 0.01% 79 10832 0.02% 80 11632 0.02% 81 13467 0.02% 82 15061 0.02% 83 16765 0.03% 84 18371 0.03% 85 19956 0.03% 86 21385 0.03% 87 23273 0.04% 88 24984 0.04% 89 27074 0.04% 90 29605 0.05% 91 32082 0.05% 92 35383 0.05% 93 38098 0.06% 94 40663 0.06% 95 43978 0.07% 96 46235 0.07% 97 49034 0.08% 98 50852 0.08% 99 53773 0.08% 100 57000 0.09% 101 59935 0.09% 102 63295 0.10% 103 66650 0.10% 104 70236 0.11% 105 72616 0.11% 106 75625 0.12% 107 77551 0.12% 108 80940 0.13% 109 83531 0.13% 110 86016 0.13% 111 90187 0.14% 112 92696 0.14% 113 97774 0.15% 114 101193 0.16% 115 104425 0.16% 116 105746 0.16% 117 108924 0.17% 118 110001 0.17% 119 111709 0.17% 120 114260 0.18% 121 117478 0.18% 122 120979 0.19% 123 125672 0.20% 124 129797 0.20% 125 131884 0.20% 126 136970 0.21% 127 135757 0.21% 128 137297 0.21% 129 141231 0.22% 130 142023 0.22% 131 143660 0.22% 132 148544 0.23% 133 153061 0.24% 134 155601 0.24% 135 160266 0.25% 136 161457 0.25% 137 161922 0.25% 138 164169 0.25% 139 166677 0.26% 140 166785 0.26% 141 170070 0.26% 142 175020 0.27% 143 176672 0.27% 144 182964 0.28% 145 186291 0.29% 146 188275 0.29% 147 190522 0.30% 148 190340 0.30% 149 190054 0.29% 150 194672 0.30% 151 57151260 88.69% 64439757 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=12 prefix-density=0.64 prefix-fanout=3.2 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=140.03 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=9.4 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=13 prefix-density=0.58 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=18 fanout-score=59.23 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=14.9 sequence=CAAGAAGAAGGT SRR7814854 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:50:48 Started mapping on | Dec 06 12:50:49 Finished on | Dec 06 13:02:34 Mapping speed, Million of reads per hour | 329.05 Number of input reads | 64439757 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 57429271 Uniquely mapped reads % | 89.12% Average mapped length | 294.83 Number of splices: Total | 55549643 Number of splices: Annotated (sjdb) | 52341830 Number of splices: GT/AG | 54766299 Number of splices: GC/AG | 638549 Number of splices: AT/AC | 24932 Number of splices: Non-canonical | 119863 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.02% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1429838 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 153265 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.88% % of reads unmapped: other | 1.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5580648 5580648 5580648 N_multimapping 1429838 1429838 1429838 N_noFeature 2216029 55843366 2677146 N_ambiguous 1377472 9177 254940 UnstrandedReadsAssigned:53835770 PositiveStrandReadsAssigned:1576728 NegativeStrandReadsAssigned:54497185 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814854-trimmed-pair1.fastq SRR7814854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 64,439,757 reads, 55,836,194 reads pseudoaligned [quant] estimated average fragment length: 259.297 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR7814854.ke.tsv 35125 SRR7814854.se.tsv 88098 total ==> SRR7814854.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.205 0 0 PNS24247 1044 785.703 149.357 4.43843 PNS24249 1928 1669.7 587.398 8.214 PNS24246 1044 785.703 149.357 4.43843 PNS24248 1044 785.703 149.357 4.43843 PNS24244 1471 1212.7 212.53 4.09193 PNS24243 293 96.8161 0 0 KQK14069 1603 1344.7 39897.2 692.752 KQK14071 474 237.91 846.79 83.1045 ==> SRR7814854.se.tsv <== BRADI_1g14170v3 44446 BRADI_1g53295v3 4134 BRADI_1g59795v3 403 BRADI_1g07683v3 0 BRADI_1g00485v3 89 BRADI_1g20270v3 4799 BRADI_1g74790v3 1238 BRADI_1g09890v3 12 BRADI_1g77505v3 890 BRADI_1g48960v3 4 SRR7814854 completed mapping pipeline successfully