Starting /dee2/code/volunteer_pipeline.sh SRR7814855 current disk space = 1551333122048 free memory = 1598960492 SRR7814855 SRAfilesize 7f6a41fe93580141246610097804d2cb SRR7814855.sra SRR7814855.sra file validated SRR7814855 is paired end SRR7814855 is conventional basespace SRR7814855 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.47775 37.0 37.0 37.0 37.0 37.0 2 36.3835 37.0 37.0 37.0 37.0 37.0 3 36.5415 37.0 37.0 37.0 37.0 37.0 4 36.5775 37.0 37.0 37.0 37.0 37.0 5 36.5565 37.0 37.0 37.0 37.0 37.0 6 36.5065 37.0 37.0 37.0 37.0 37.0 7 36.5395 37.0 37.0 37.0 37.0 37.0 8 36.512 37.0 37.0 37.0 37.0 37.0 9 36.5525 37.0 37.0 37.0 37.0 37.0 10-14 36.533899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5099 37.0 37.0 37.0 37.0 37.0 20-24 36.49739999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.466499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.264300000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.1939 37.0 37.0 37.0 37.0 37.0 40-44 36.185199999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.283 37.0 37.0 37.0 37.0 37.0 50-54 36.3369 37.0 37.0 37.0 37.0 37.0 55-59 36.2753 37.0 37.0 37.0 37.0 37.0 60-64 36.281099999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.206900000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.129000000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0664 37.0 37.0 37.0 37.0 37.0 80-84 36.0458 37.0 37.0 37.0 37.0 37.0 85-89 36.1246 37.0 37.0 37.0 37.0 37.0 90-94 35.966300000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.667199999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.4146 37.0 37.0 37.0 34.6 37.0 105-109 35.5406 37.0 37.0 37.0 37.0 37.0 110-114 35.708000000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.4978 37.0 37.0 37.0 37.0 37.0 120-124 34.843500000000006 37.0 37.0 37.0 25.0 37.0 125-129 34.6178 37.0 37.0 37.0 25.0 37.0 130-134 35.1716 37.0 37.0 37.0 27.4 37.0 135-139 35.0346 37.0 37.0 37.0 25.0 37.0 140-144 35.0364 37.0 37.0 37.0 27.4 37.0 145-149 34.915099999999995 37.0 37.0 37.0 25.0 37.0 150-151 34.278 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 3.0 26 6.0 27 12.0 28 18.0 29 21.0 30 36.0 31 55.0 32 72.0 33 146.0 34 283.0 35 593.0 36 2561.0 37 189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.44722988217598 11.606919027325144 6.267234895963901 37.67861619453497 2 24.675 14.374999999999998 31.2 29.75 3 23.025000000000002 17.424999999999997 23.25 36.3 4 27.175 24.25 20.7 27.875 5 27.075 28.575 22.175 22.175 6 21.875 30.825000000000003 25.45 21.85 7 17.875 22.6 37.775 21.75 8 19.875 21.2 30.5 28.425 9 21.75 20.05 32.800000000000004 25.4 10-14 23.04 26.085 24.4 26.474999999999998 15-19 23.64 24.935 24.685000000000002 26.740000000000002 20-24 23.54 24.21 24.975 27.275 25-29 23.77 24.85 24.9 26.479999999999997 30-34 23.735 24.18 25.055 27.029999999999998 35-39 23.65 24.005000000000003 25.185000000000002 27.16 40-44 24.15 24.265 24.945 26.640000000000004 45-49 24.145 24.474999999999998 24.709999999999997 26.669999999999998 50-54 24.375 24.22 24.875 26.529999999999998 55-59 24.0 25.285000000000004 23.815 26.900000000000002 60-64 24.310000000000002 23.355 25.095 27.24 65-69 23.995 24.355 25.264999999999997 26.384999999999998 70-74 24.035 23.955000000000002 24.955 27.055 75-79 24.685000000000002 24.795 24.14 26.38 80-84 23.985 24.135 24.82 27.060000000000002 85-89 24.805 24.23 24.195 26.77 90-94 24.834999999999997 24.2 24.085 26.88 95-99 24.385 24.465 24.3 26.85 100-104 25.435000000000002 23.66 24.025 26.88 105-109 25.275 24.26 23.79 26.674999999999997 110-114 24.765 24.05 24.240000000000002 26.945000000000004 115-119 24.795 23.799999999999997 24.245 27.16 120-124 25.330000000000002 24.23 23.515 26.924999999999997 125-129 25.095 24.169999999999998 23.74 26.995 130-134 25.124999999999996 23.865 23.445 27.565 135-139 24.91 24.6 23.345 27.145000000000003 140-144 24.765 24.23 23.46 27.544999999999998 145-149 24.65 23.79 24.09 27.47 150-151 24.65 24.9375 23.3125 27.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 2.0 27 3.5 28 5.0 29 5.0 30 5.0 31 7.0 32 13.0 33 24.5 34 32.5 35 39.5 36 45.5 37 54.0 38 75.0 39 87.5 40 95.0 41 116.5 42 144.0 43 148.5 44 150.0 45 156.5 46 158.5 47 173.0 48 162.0 49 152.0 50 154.0 51 141.5 52 133.0 53 128.5 54 133.5 55 143.5 56 127.5 57 113.5 58 113.0 59 101.5 60 89.0 61 76.0 62 67.5 63 61.0 64 55.5 65 55.0 66 55.0 67 54.0 68 54.5 69 47.0 70 45.0 71 44.0 72 34.5 73 29.0 74 21.5 75 15.0 76 15.0 77 13.0 78 7.5 79 4.0 80 3.5 81 3.0 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.35 #Duplication Level Percentage of deduplicated Percentage of total 1 88.87945670628183 78.525 2 9.507640067911714 16.8 3 1.245048104131296 3.3000000000000003 4 0.2829654782116582 1.0 5 0.08488964346349745 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGTGTACAAGGCCCGGGAACGGATTCACCGCCGTATGGCTGACCGGCGA 5 0.125 No Hit CGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTT 5 0.125 No Hit ATCACGATGAAATTTCCCAAGATTACCCGGGCCTGTCGGCCAAGGCTATA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.975 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.1875 0.0 0.0 0.0 0.0 112-113 2.5625 0.0 0.0 0.0 0.0 114-115 2.825 0.0 0.0 0.0 0.0 116-117 3.125 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 4.075 0.0 0.0 0.0 0.0 122-123 4.449999999999999 0.0 0.0 0.0 0.0 124-125 4.7875 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.625 0.0 0.0 0.0 0.0 130-131 5.95 0.0 0.0 0.0 0.0 132-133 6.387499999999999 0.0 0.0 0.0 0.0 134-135 7.012499999999999 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138-139 8.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814855 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.205 37.0 37.0 37.0 37.0 37.0 2 36.01 37.0 37.0 37.0 37.0 37.0 3 35.7465 37.0 37.0 37.0 37.0 37.0 4 36.0645 37.0 37.0 37.0 37.0 37.0 5 35.8105 37.0 37.0 37.0 37.0 37.0 6 35.834 37.0 37.0 37.0 37.0 37.0 7 35.6375 37.0 37.0 37.0 37.0 37.0 8 35.7015 37.0 37.0 37.0 37.0 37.0 9 35.959 37.0 37.0 37.0 37.0 37.0 10-14 35.9046 37.0 37.0 37.0 37.0 37.0 15-19 35.45270000000001 37.0 37.0 37.0 37.0 37.0 20-24 35.618500000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.546299999999995 37.0 37.0 37.0 37.0 37.0 30-34 35.32289999999999 37.0 37.0 37.0 34.6 37.0 35-39 35.3679 37.0 37.0 37.0 37.0 37.0 40-44 35.0471 37.0 37.0 37.0 29.8 37.0 45-49 35.09250000000001 37.0 37.0 37.0 29.8 37.0 50-54 34.45 37.0 37.0 37.0 25.0 37.0 55-59 34.3796 37.0 37.0 37.0 25.0 37.0 60-64 34.647000000000006 37.0 37.0 37.0 25.0 37.0 65-69 34.647299999999994 37.0 37.0 37.0 25.0 37.0 70-74 34.2059 37.0 37.0 37.0 25.0 37.0 75-79 34.0598 37.0 37.0 37.0 22.2 37.0 80-84 34.044200000000004 37.0 37.0 37.0 25.0 37.0 85-89 34.2965 37.0 37.0 37.0 25.0 37.0 90-94 33.886700000000005 37.0 37.0 37.0 25.0 37.0 95-99 33.0864 37.0 37.0 37.0 13.8 37.0 100-104 33.3614 37.0 37.0 37.0 19.4 37.0 105-109 32.8965 37.0 37.0 37.0 13.8 37.0 110-114 33.3136 37.0 37.0 37.0 19.4 37.0 115-119 33.4386 37.0 37.0 37.0 22.2 37.0 120-124 32.717200000000005 37.0 37.0 37.0 11.0 37.0 125-129 32.82809999999999 37.0 37.0 37.0 11.0 37.0 130-134 32.3278 37.0 37.0 37.0 11.0 37.0 135-139 32.284499999999994 37.0 32.2 37.0 11.0 37.0 140-144 32.572199999999995 37.0 37.0 37.0 11.0 37.0 145-149 32.1886 37.0 32.2 37.0 11.0 37.0 150-151 31.5445 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 7.0 16 2.0 17 1.0 18 3.0 19 6.0 20 5.0 21 5.0 22 15.0 23 27.0 24 49.0 25 72.0 26 79.0 27 72.0 28 98.0 29 96.0 30 125.0 31 139.0 32 187.0 33 223.0 34 323.0 35 750.0 36 1667.0 37 48.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.475 17.325 8.9 31.3 2 30.525000000000002 22.45 26.85 20.175 3 22.475 24.95 27.450000000000003 25.124999999999996 4 28.4 29.9 19.2 22.5 5 30.75 30.8 17.474999999999998 20.974999999999998 6 25.025 32.775 19.475 22.725 7 23.674999999999997 20.175 31.624999999999996 24.525 8 24.75 22.025 22.975 30.25 9 25.15 21.9 24.675 28.275 10-14 27.38 24.735 21.525 26.36 15-19 27.48 24.85 22.64 25.03 20-24 27.029999999999998 25.145 22.81 25.014999999999997 25-29 27.36 25.019999999999996 22.695 24.925 30-34 26.985 25.11 22.695 25.21 35-39 27.48 25.545 22.05 24.925 40-44 26.965 25.775 22.71 24.55 45-49 28.060000000000002 24.3 22.81 24.83 50-54 27.029999999999998 25.495 23.155 24.32 55-59 27.26 24.88 23.69 24.169999999999998 60-64 27.075 24.73 23.105 25.09 65-69 27.224999999999998 25.21 22.425 25.14 70-74 27.52 25.240000000000002 22.685 24.555 75-79 27.765 24.595 23.175 24.465 80-84 27.250000000000004 25.81 22.625 24.315 85-89 27.165 25.424999999999997 22.745 24.665 90-94 27.37 25.4 22.81 24.42 95-99 26.889999999999997 26.155 23.244999999999997 23.71 100-104 26.265 26.924999999999997 22.6 24.21 105-109 26.950000000000003 26.61 22.830000000000002 23.61 110-114 27.32 25.95 22.765 23.965 115-119 27.21 25.490000000000002 23.3 24.0 120-124 26.634999999999998 26.625 22.96 23.78 125-129 27.185 26.895000000000003 21.845 24.075 130-134 27.205000000000002 27.345000000000002 21.9 23.549999999999997 135-139 27.839999999999996 26.3 22.93 22.93 140-144 28.43 26.38 22.325 22.865 145-149 27.639999999999997 28.055000000000003 21.654999999999998 22.650000000000002 150-151 27.5875 25.912499999999998 23.4875 23.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 3.5 26 2.5 27 1.5 28 4.5 29 9.5 30 12.0 31 12.5 32 13.5 33 18.0 34 28.0 35 30.5 36 28.5 37 42.5 38 59.0 39 79.5 40 101.5 41 112.0 42 120.0 43 122.0 44 132.0 45 137.5 46 146.0 47 155.5 48 149.0 49 150.0 50 138.5 51 131.0 52 130.5 53 128.5 54 148.0 55 134.0 56 109.5 57 116.5 58 122.5 59 115.0 60 103.0 61 94.0 62 83.0 63 81.5 64 77.0 65 75.5 66 71.5 67 64.0 68 67.0 69 57.5 70 46.5 71 42.0 72 34.0 73 35.0 74 32.5 75 20.0 76 16.0 77 12.0 78 7.0 79 5.0 80 2.0 81 1.5 82 1.5 83 1.5 84 1.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 1.0 97 0.5 98 0.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.6911928651059 81.35 2 7.6923076923076925 13.8 3 1.254180602006689 3.375 4 0.2787068004459309 1.0 5 0.0 0.0 6 0.055741360089186176 0.3 7 0.027870680044593088 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0125 108-109 1.7374999999999998 0.0 0.0 0.0 0.025 110-111 1.9 0.0 0.0 0.0 0.025 112-113 2.1875 0.0 0.0 0.0 0.025 114-115 2.4125 0.0 0.0 0.0 0.025 116-117 2.675 0.0 0.0 0.0 0.025 118-119 3.0375 0.0 0.0 0.0 0.025 120-121 3.4625 0.0 0.0 0.0 0.025 122-123 3.875 0.0 0.0 0.0 0.025 124-125 4.2 0.0 0.0 0.0 0.025 126-127 4.6625 0.0 0.0 0.0 0.025 128-129 5.012499999999999 0.0 0.0 0.0 0.025 130-131 5.275 0.0 0.0 0.0 0.025 132-133 5.612500000000001 0.0 0.0 0.0 0.025 134-135 6.1625 0.0 0.0 0.0 0.025 136-137 6.6875 0.0 0.0 0.0 0.025 138-139 7.050000000000001 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGGAAA 10 0.006830828 145.0 3 >>END_MODULE Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589243 spots for SRR7814855.sra Written 1589243 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra Read 1589233 spots for SRR7814855.sra Written 1589233 spots for SRR7814855.sra SRR ids: ['SRR7814855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zra17iqt SRR7814855.sra spots: 31784670 blocks: [[1, 1589233], [1589234, 3178466], [3178467, 4767699], [4767700, 6356932], [6356933, 7946165], [7946166, 9535398], [9535399, 11124631], [11124632, 12713864], [12713865, 14303097], [14303098, 15892330], [15892331, 17481563], [17481564, 19070796], [19070797, 20660029], [20660030, 22249262], [22249263, 23838495], [23838496, 25427728], [25427729, 27016961], [27016962, 28606194], [28606195, 30195427], [30195428, 31784670]] SRR7814855 file size 10749081 SRR7814855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814855 SRR7814855_1.fastq SRR7814855_2.fastq Input file: SRR7814855_1.fastq Paired file: SRR7814855_2.fastq trimmed: SRR7814855-trimmed-pair1.fastq, SRR7814855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:45:05 2024 >> started Fri Dec 6 12:45:39 2024 >> done (33.805s) 31784670 read pairs processed; of these: 175 ( 0.00%) short read pairs filtered out after trimming by size control 6687 ( 0.02%) empty read pairs filtered out after trimming by size control 31777808 (99.98%) read pairs available; of these: 3411876 (10.74%) trimmed read pairs available after processing 28365932 (89.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 13 0.00% 20 13 0.00% 21 13 0.00% 22 9 0.00% 23 19 0.00% 24 16 0.00% 25 23 0.00% 26 33 0.00% 27 40 0.00% 28 25 0.00% 29 40 0.00% 30 46 0.00% 31 30 0.00% 32 37 0.00% 33 44 0.00% 34 62 0.00% 35 51 0.00% 36 64 0.00% 37 62 0.00% 38 83 0.00% 39 75 0.00% 40 53 0.00% 41 88 0.00% 42 93 0.00% 43 81 0.00% 44 101 0.00% 45 109 0.00% 46 120 0.00% 47 97 0.00% 48 125 0.00% 49 188 0.00% 50 162 0.00% 51 208 0.00% 52 217 0.00% 53 255 0.00% 54 238 0.00% 55 259 0.00% 56 312 0.00% 57 335 0.00% 58 385 0.00% 59 489 0.00% 60 507 0.00% 61 552 0.00% 62 664 0.00% 63 720 0.00% 64 785 0.00% 65 817 0.00% 66 907 0.00% 67 1024 0.00% 68 1131 0.00% 69 1255 0.00% 70 1520 0.00% 71 1687 0.01% 72 1917 0.01% 73 2261 0.01% 74 2387 0.01% 75 2680 0.01% 76 3082 0.01% 77 3284 0.01% 78 3585 0.01% 79 4226 0.01% 80 4666 0.01% 81 5281 0.02% 82 5952 0.02% 83 6541 0.02% 84 7119 0.02% 85 8068 0.03% 86 9026 0.03% 87 9643 0.03% 88 10284 0.03% 89 11023 0.03% 90 12286 0.04% 91 13693 0.04% 92 14993 0.05% 93 16448 0.05% 94 17690 0.06% 95 18924 0.06% 96 20241 0.06% 97 21466 0.07% 98 22630 0.07% 99 23946 0.08% 100 25261 0.08% 101 26380 0.08% 102 28259 0.09% 103 29618 0.09% 104 31290 0.10% 105 32317 0.10% 106 33916 0.11% 107 35827 0.11% 108 36995 0.12% 109 38810 0.12% 110 39593 0.12% 111 41753 0.13% 112 43597 0.14% 113 44198 0.14% 114 46068 0.14% 115 48692 0.15% 116 49966 0.16% 117 50603 0.16% 118 51649 0.16% 119 52159 0.16% 120 55086 0.17% 121 55490 0.17% 122 57486 0.18% 123 59661 0.19% 124 60658 0.19% 125 62565 0.20% 126 64319 0.20% 127 65525 0.21% 128 65510 0.21% 129 68142 0.21% 130 67725 0.21% 131 69629 0.22% 132 71393 0.22% 133 72917 0.23% 134 74161 0.23% 135 75942 0.24% 136 77038 0.24% 137 76840 0.24% 138 77517 0.24% 139 79710 0.25% 140 80363 0.25% 141 81996 0.26% 142 84024 0.26% 143 85064 0.27% 144 87084 0.27% 145 88531 0.28% 146 89484 0.28% 147 91726 0.29% 148 91884 0.29% 149 93127 0.29% 150 94691 0.30% 151 28365932 89.26% 31777808 reads passed initial QC criterion=sequence-density sequence-density=0.93 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.92 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=49.71 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=3.6 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=1.24 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=20 prefix-density=1.32 prefix-fanout=2.3 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=18.45 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.5 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCCCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG SRR7814855 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:46:37 Started mapping on | Dec 06 12:46:37 Finished on | Dec 06 12:51:36 Mapping speed, Million of reads per hour | 382.61 Number of input reads | 31777808 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 25564881 Uniquely mapped reads % | 80.45% Average mapped length | 295.18 Number of splices: Total | 22466040 Number of splices: Annotated (sjdb) | 21197869 Number of splices: GT/AG | 22134359 Number of splices: GC/AG | 265116 Number of splices: AT/AC | 8504 Number of splices: Non-canonical | 58061 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2090923 % of reads mapped to multiple loci | 6.58% Number of reads mapped to too many loci | 359435 % of reads mapped to too many loci | 1.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.51% % of reads unmapped: other | 7.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4122004 4122004 4122004 N_multimapping 2090923 2090923 2090923 N_noFeature 2497028 24768093 2698390 N_ambiguous 727468 3306 133472 UnstrandedReadsAssigned:22340385 PositiveStrandReadsAssigned:793482 NegativeStrandReadsAssigned:22733019 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814855-trimmed-pair1.fastq SRR7814855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,777,808 reads, 23,630,307 reads pseudoaligned [quant] estimated average fragment length: 263.499 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52973 SRR7814855.ke.tsv 35125 SRR7814855.se.tsv 88098 total ==> SRR7814855.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 673.857 0 0 PNS24247 1044 781.501 78.2811 4.87252 PNS24249 1928 1665.5 119.746 3.49737 PNS24246 1044 781.501 78.2811 4.87252 PNS24248 1044 781.501 78.2811 4.87252 PNS24244 1471 1208.5 213.411 8.59008 PNS24243 293 96.1516 5 2.52953 KQK14069 1603 1340.5 13593.5 493.277 KQK14071 474 232.987 180.603 37.7067 ==> SRR7814855.se.tsv <== BRADI_1g14170v3 14357 BRADI_1g53295v3 1605 BRADI_1g59795v3 224 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 202 BRADI_1g74790v3 225 BRADI_1g09890v3 0 BRADI_1g77505v3 652 BRADI_1g48960v3 0 SRR7814855 completed mapping pipeline successfully