Starting /dee2/code/volunteer_pipeline.sh SRR7814856 current disk space = 1551293485056 free memory = 1596029508 SRR7814856 SRAfilesize 54697f6d28b27f90ac7097a2284a7489 SRR7814856.sra SRR7814856.sra file validated SRR7814856 is paired end SRR7814856 is conventional basespace SRR7814856 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.439 37.0 37.0 37.0 37.0 37.0 2 36.489 37.0 37.0 37.0 37.0 37.0 3 36.5325 37.0 37.0 37.0 37.0 37.0 4 36.617 37.0 37.0 37.0 37.0 37.0 5 36.576 37.0 37.0 37.0 37.0 37.0 6 36.6145 37.0 37.0 37.0 37.0 37.0 7 36.5655 37.0 37.0 37.0 37.0 37.0 8 36.6505 37.0 37.0 37.0 37.0 37.0 9 36.615 37.0 37.0 37.0 37.0 37.0 10-14 36.59439999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5392 37.0 37.0 37.0 37.0 37.0 20-24 36.5754 37.0 37.0 37.0 37.0 37.0 25-29 36.4786 37.0 37.0 37.0 37.0 37.0 30-34 36.3438 37.0 37.0 37.0 37.0 37.0 35-39 36.2653 37.0 37.0 37.0 37.0 37.0 40-44 36.2062 37.0 37.0 37.0 37.0 37.0 45-49 36.3398 37.0 37.0 37.0 37.0 37.0 50-54 36.3595 37.0 37.0 37.0 37.0 37.0 55-59 36.367399999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.347300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2262 37.0 37.0 37.0 37.0 37.0 70-74 36.1274 37.0 37.0 37.0 37.0 37.0 75-79 36.0893 37.0 37.0 37.0 37.0 37.0 80-84 36.1523 37.0 37.0 37.0 37.0 37.0 85-89 36.1751 37.0 37.0 37.0 37.0 37.0 90-94 35.996500000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.71130000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.4106 37.0 37.0 37.0 34.6 37.0 105-109 35.654900000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.706399999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.5603 37.0 37.0 37.0 37.0 37.0 120-124 34.918899999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.69590000000001 37.0 37.0 37.0 25.0 37.0 130-134 35.286500000000004 37.0 37.0 37.0 29.8 37.0 135-139 35.1022 37.0 37.0 37.0 29.8 37.0 140-144 35.0954 37.0 37.0 37.0 27.4 37.0 145-149 34.993100000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.28725 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 8.0 27 7.0 28 11.0 29 19.0 30 33.0 31 67.0 32 75.0 33 141.0 34 236.0 35 598.0 36 2612.0 37 190.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.91273821464393 10.732196589769307 5.917753259779338 37.43731193580742 2 24.675 13.225000000000001 31.15 30.95 3 22.6 18.6 23.5 35.3 4 27.325 25.224999999999998 19.55 27.900000000000002 5 26.450000000000003 28.025 23.375 22.15 6 22.275 31.15 23.474999999999998 23.1 7 18.125 22.625 39.2 20.05 8 21.3 21.65 29.125 27.925 9 21.3 19.950000000000003 32.574999999999996 26.174999999999997 10-14 22.89 25.900000000000002 24.77 26.44 15-19 23.24 25.31 24.83 26.619999999999997 20-24 23.825 25.595000000000002 24.07 26.51 25-29 24.215 24.92 24.279999999999998 26.584999999999997 30-34 23.549999999999997 24.16 25.715 26.575 35-39 23.74 24.54 25.185000000000002 26.534999999999997 40-44 24.154999999999998 24.45 24.404999999999998 26.99 45-49 23.235 24.09 25.435000000000002 27.24 50-54 23.665 23.755000000000003 25.72 26.86 55-59 24.01 23.98 24.865000000000002 27.145000000000003 60-64 23.685000000000002 24.545 24.545 27.224999999999998 65-69 24.2 24.42 24.565 26.815 70-74 24.46 23.905 24.315 27.32 75-79 23.785 24.715 24.64 26.86 80-84 24.305 24.41 24.11 27.175 85-89 24.415 23.935000000000002 24.59 27.060000000000002 90-94 25.105 24.11 24.65 26.135 95-99 24.485 23.79 25.155 26.57 100-104 24.22 24.654999999999998 24.36 26.765 105-109 25.285000000000004 23.855 24.565 26.295 110-114 24.705 24.834999999999997 23.995 26.465 115-119 24.98 24.38 23.724999999999998 26.915 120-124 23.86 24.26 24.495 27.384999999999998 125-129 25.485000000000003 24.26 23.705000000000002 26.55 130-134 25.009999999999998 23.875 24.095 27.02 135-139 24.8 24.395 23.705000000000002 27.1 140-144 25.77 24.625 23.03 26.575 145-149 25.235000000000003 24.37 23.474999999999998 26.919999999999998 150-151 24.349999999999998 23.3375 24.775 27.537499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 2.0 26 2.0 27 0.5 28 2.5 29 5.5 30 8.0 31 12.5 32 16.0 33 15.0 34 26.5 35 38.5 36 48.0 37 61.0 38 70.0 39 79.5 40 101.0 41 114.0 42 122.5 43 150.0 44 162.0 45 156.5 46 160.0 47 167.5 48 167.0 49 161.0 50 155.5 51 163.0 52 160.5 53 132.5 54 112.5 55 143.0 56 148.5 57 110.5 58 95.5 59 94.0 60 92.0 61 84.5 62 64.5 63 60.0 64 63.5 65 50.5 66 53.0 67 51.0 68 50.0 69 43.0 70 36.0 71 39.5 72 34.5 73 30.0 74 24.5 75 19.0 76 12.0 77 7.5 78 6.0 79 5.0 80 3.5 81 1.5 82 1.0 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.2 #Duplication Level Percentage of deduplicated Percentage of total 1 88.57709750566893 78.125 2 9.807256235827664 17.299999999999997 3 1.3321995464852607 3.5249999999999995 4 0.22675736961451248 0.8 5 0.05668934240362812 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTATTGTGACCACCTCGTCATTGGAGATCTTCAACTTGGGTGCCTCCAAA 5 0.125 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0125 0.0 86-87 0.35 0.0 0.0 0.025 0.0 88-89 0.38749999999999996 0.0 0.0 0.025 0.0 90-91 0.44999999999999996 0.0 0.0 0.025 0.0 92-93 0.5625 0.0 0.0 0.025 0.0 94-95 0.625 0.0 0.0 0.025 0.0 96-97 0.8125 0.0 0.0 0.025 0.0 98-99 0.925 0.0 0.0 0.025 0.0 100-101 1.025 0.0 0.0 0.025 0.0 102-103 1.1875 0.0 0.0 0.025 0.0 104-105 1.4249999999999998 0.0 0.0 0.025 0.0 106-107 1.7875 0.0 0.0 0.025 0.0 108-109 2.2 0.0 0.0 0.025 0.0 110-111 2.5250000000000004 0.0 0.0 0.025 0.0 112-113 2.7625 0.0 0.0 0.025 0.0 114-115 3.075 0.0 0.0 0.025 0.0 116-117 3.3375000000000004 0.0 0.0 0.025 0.0 118-119 3.675 0.0 0.0 0.025 0.0 120-121 3.9375 0.0 0.0 0.025 0.0 122-123 4.175000000000001 0.0 0.0 0.025 0.0 124-125 4.5875 0.0 0.0 0.025 0.0 126-127 5.112500000000001 0.0 0.0 0.025 0.0 128-129 5.4875 0.0 0.0 0.025 0.0 130-131 5.825 0.0 0.0 0.025 0.0 132-133 6.5125 0.0 0.0 0.025 0.0 134-135 7.125 0.0 0.0 0.025 0.0 136-137 7.6625 0.0 0.0 0.025 0.0 138-139 8.0375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCAGAA 10 0.006830828 145.0 1 >>END_MODULE SRR7814856 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814856_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1485 37.0 37.0 37.0 37.0 37.0 2 35.8065 37.0 37.0 37.0 37.0 37.0 3 35.8075 37.0 37.0 37.0 37.0 37.0 4 35.7855 37.0 37.0 37.0 37.0 37.0 5 35.849 37.0 37.0 37.0 37.0 37.0 6 35.7035 37.0 37.0 37.0 37.0 37.0 7 35.592 37.0 37.0 37.0 37.0 37.0 8 35.771 37.0 37.0 37.0 37.0 37.0 9 36.042 37.0 37.0 37.0 37.0 37.0 10-14 35.8314 37.0 37.0 37.0 37.0 37.0 15-19 35.3556 37.0 37.0 37.0 34.6 37.0 20-24 35.598400000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.4736 37.0 37.0 37.0 34.6 37.0 30-34 35.2294 37.0 37.0 37.0 34.6 37.0 35-39 35.2436 37.0 37.0 37.0 32.2 37.0 40-44 34.84779999999999 37.0 37.0 37.0 27.4 37.0 45-49 34.9995 37.0 37.0 37.0 27.4 37.0 50-54 34.32809999999999 37.0 37.0 37.0 25.0 37.0 55-59 34.201 37.0 37.0 37.0 25.0 37.0 60-64 34.5409 37.0 37.0 37.0 25.0 37.0 65-69 34.4088 37.0 37.0 37.0 25.0 37.0 70-74 34.0647 37.0 37.0 37.0 25.0 37.0 75-79 33.929199999999994 37.0 37.0 37.0 25.0 37.0 80-84 33.831399999999995 37.0 37.0 37.0 22.2 37.0 85-89 34.1957 37.0 37.0 37.0 25.0 37.0 90-94 33.666599999999995 37.0 37.0 37.0 22.2 37.0 95-99 32.842200000000005 37.0 37.0 37.0 11.0 37.0 100-104 33.2355 37.0 37.0 37.0 16.6 37.0 105-109 32.6777 37.0 37.0 37.0 13.8 37.0 110-114 33.0293 37.0 37.0 37.0 13.8 37.0 115-119 33.1999 37.0 37.0 37.0 16.6 37.0 120-124 32.4189 37.0 34.6 37.0 11.0 37.0 125-129 32.7618 37.0 37.0 37.0 11.0 37.0 130-134 32.1729 37.0 29.8 37.0 11.0 37.0 135-139 32.0917 37.0 29.8 37.0 11.0 37.0 140-144 32.2847 37.0 32.2 37.0 11.0 37.0 145-149 31.9416 37.0 27.4 37.0 11.0 37.0 150-151 31.180999999999997 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 3.0 16 5.0 17 6.0 18 4.0 19 3.0 20 5.0 21 4.0 22 19.0 23 32.0 24 52.0 25 71.0 26 67.0 27 98.0 28 109.0 29 109.0 30 131.0 31 154.0 32 156.0 33 246.0 34 321.0 35 772.0 36 1595.0 37 35.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.9 17.25 9.125 31.724999999999998 2 30.525000000000002 22.575 25.974999999999998 20.925 3 26.5 23.25 25.525 24.725 4 26.625 31.25 18.575 23.549999999999997 5 29.65 32.1 19.05 19.2 6 25.95 34.949999999999996 18.625 20.474999999999998 7 25.124999999999996 19.0 33.0 22.875 8 24.7 22.625 23.075000000000003 29.599999999999998 9 25.924999999999997 22.375 25.6 26.1 10-14 27.49 25.095 22.05 25.365 15-19 26.87 24.325 23.145 25.66 20-24 26.790000000000003 24.875 23.095 25.240000000000002 25-29 26.915 24.58 23.215 25.290000000000003 30-34 27.045 24.585 23.705000000000002 24.665 35-39 26.855 24.75 22.735 25.66 40-44 27.295 25.095 23.07 24.54 45-49 27.175 24.645 23.294999999999998 24.884999999999998 50-54 27.224999999999998 25.305 23.195 24.275 55-59 26.924999999999997 25.645 23.150000000000002 24.279999999999998 60-64 26.555 24.87 23.62 24.955 65-69 27.04 24.34 23.735 24.884999999999998 70-74 26.995 24.560000000000002 23.575 24.87 75-79 25.729999999999997 25.865 23.565 24.84 80-84 26.955000000000002 25.619999999999997 22.89 24.535 85-89 27.415 25.165 23.145 24.275 90-94 26.66 25.2 23.380000000000003 24.759999999999998 95-99 26.825 25.82 22.99 24.365000000000002 100-104 27.54 26.650000000000002 22.475 23.335 105-109 27.115000000000002 26.395000000000003 23.119999999999997 23.369999999999997 110-114 26.490000000000002 26.015 23.380000000000003 24.115000000000002 115-119 27.025 25.380000000000003 23.544999999999998 24.05 120-124 27.200000000000003 27.084999999999997 22.465 23.25 125-129 27.389999999999997 26.255 22.89 23.465 130-134 26.939999999999998 27.534999999999997 22.86 22.665 135-139 27.35 27.400000000000002 22.525000000000002 22.725 140-144 27.825 27.235 22.400000000000002 22.54 145-149 28.075 26.69 22.58 22.655 150-151 27.9375 26.2625 23.425 22.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 3.0 24 2.5 25 2.5 26 3.0 27 4.0 28 5.5 29 6.5 30 10.0 31 18.5 32 20.5 33 20.0 34 23.0 35 27.5 36 43.5 37 55.5 38 65.5 39 88.0 40 97.5 41 100.5 42 109.0 43 121.5 44 137.5 45 146.0 46 171.0 47 168.5 48 145.5 49 154.0 50 143.5 51 127.0 52 116.0 53 107.0 54 120.5 55 134.5 56 130.0 57 114.5 58 107.5 59 102.0 60 98.5 61 98.0 62 90.5 63 80.5 64 71.5 65 81.5 66 75.5 67 59.5 68 66.5 69 65.5 70 52.5 71 40.5 72 34.5 73 29.0 74 20.5 75 16.5 76 15.0 77 14.0 78 12.5 79 5.5 80 2.0 81 1.0 82 1.0 83 1.0 84 1.0 85 1.0 86 0.0 87 0.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.825 #Duplication Level Percentage of deduplicated Percentage of total 1 90.31450041747843 81.125 2 8.377400500974117 15.049999999999999 3 1.057612023378792 2.85 4 0.19482326746451434 0.7000000000000001 5 0.027831895352073477 0.125 6 0.027831895352073477 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 6 0.15 No Hit CGAATTTTTGGAGGCTGCACTTACTATCATACGCCCCTCCTCGCTCCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0125 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.037500000000000006 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.0875 0.0 0.0 0.025 0.0 78-79 0.16249999999999998 0.0 0.0 0.025 0.0 80-81 0.25 0.0 0.0 0.025 0.0 82-83 0.275 0.0 0.0 0.025 0.0 84-85 0.275 0.0 0.0 0.025 0.0 86-87 0.3 0.0 0.0 0.025 0.0 88-89 0.3375 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.4875 0.0 0.0 0.025 0.0 94-95 0.55 0.0 0.0 0.025 0.0 96-97 0.7375 0.0 0.0 0.025 0.0 98-99 0.85 0.0 0.0 0.025 0.0 100-101 0.9125000000000001 0.0 0.0 0.025 0.0 102-103 1.05 0.0 0.0 0.025 0.0 104-105 1.2374999999999998 0.0 0.0 0.025 0.0 106-107 1.5750000000000002 0.0 0.0 0.025 0.0 108-109 1.975 0.0 0.0 0.025 0.0 110-111 2.25 0.0 0.0 0.025 0.0 112-113 2.4875 0.0 0.0 0.025 0.0 114-115 2.75 0.0 0.0 0.025 0.0 116-117 3.025 0.0 0.0 0.025 0.0 118-119 3.2875 0.0 0.0 0.025 0.0 120-121 3.4625 0.0 0.0 0.025 0.0 122-123 3.65 0.0 0.0 0.025 0.0 124-125 4.025 0.0 0.0 0.025 0.0 126-127 4.512499999999999 0.0 0.0 0.025 0.0 128-129 4.8375 0.0 0.0 0.025 0.0 130-131 5.05 0.0 0.0 0.025 0.0 132-133 5.612500000000001 0.0 0.0 0.025 0.0 134-135 6.2 0.0 0.0 0.025 0.0 136-137 6.65 0.0 0.0 0.025 0.0 138-139 6.9625 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAAAG 10 0.006830828 145.0 1 >>END_MODULE Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004733 spots for SRR7814856.sra Written 2004733 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra Read 2004720 spots for SRR7814856.sra Written 2004720 spots for SRR7814856.sra SRR ids: ['SRR7814856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9ea_4nlf SRR7814856.sra spots: 40094413 blocks: [[1, 2004720], [2004721, 4009440], [4009441, 6014160], [6014161, 8018880], [8018881, 10023600], [10023601, 12028320], [12028321, 14033040], [14033041, 16037760], [16037761, 18042480], [18042481, 20047200], [20047201, 22051920], [22051921, 24056640], [24056641, 26061360], [26061361, 28066080], [28066081, 30070800], [30070801, 32075520], [32075521, 34080240], [34080241, 36084960], [36084961, 38089680], [38089681, 40094413]] SRR7814856 file size 13564980 SRR7814856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814856 SRR7814856_1.fastq SRR7814856_2.fastq Input file: SRR7814856_1.fastq Paired file: SRR7814856_2.fastq trimmed: SRR7814856-trimmed-pair1.fastq, SRR7814856-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:47:32 2024 >> started Fri Dec 6 12:48:53 2024 >> done (80.204s) 40094413 read pairs processed; of these: 178 ( 0.00%) short read pairs filtered out after trimming by size control 7434 ( 0.02%) empty read pairs filtered out after trimming by size control 40086801 (99.98%) read pairs available; of these: 4568455 (11.40%) trimmed read pairs available after processing 35518346 (88.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 11 0.00% 20 15 0.00% 21 16 0.00% 22 18 0.00% 23 29 0.00% 24 20 0.00% 25 35 0.00% 26 43 0.00% 27 29 0.00% 28 42 0.00% 29 43 0.00% 30 37 0.00% 31 48 0.00% 32 48 0.00% 33 46 0.00% 34 54 0.00% 35 49 0.00% 36 73 0.00% 37 66 0.00% 38 77 0.00% 39 79 0.00% 40 76 0.00% 41 82 0.00% 42 107 0.00% 43 101 0.00% 44 94 0.00% 45 113 0.00% 46 117 0.00% 47 134 0.00% 48 138 0.00% 49 151 0.00% 50 212 0.00% 51 236 0.00% 52 252 0.00% 53 275 0.00% 54 267 0.00% 55 269 0.00% 56 304 0.00% 57 399 0.00% 58 432 0.00% 59 472 0.00% 60 577 0.00% 61 656 0.00% 62 751 0.00% 63 862 0.00% 64 870 0.00% 65 1006 0.00% 66 1031 0.00% 67 1277 0.00% 68 1374 0.00% 69 1553 0.00% 70 1815 0.00% 71 2260 0.01% 72 2368 0.01% 73 2730 0.01% 74 2957 0.01% 75 3323 0.01% 76 3728 0.01% 77 4089 0.01% 78 4663 0.01% 79 5394 0.01% 80 5864 0.01% 81 6752 0.02% 82 7329 0.02% 83 8480 0.02% 84 9619 0.02% 85 10207 0.03% 86 11333 0.03% 87 12245 0.03% 88 13521 0.03% 89 14440 0.04% 90 15610 0.04% 91 17704 0.04% 92 19174 0.05% 93 21147 0.05% 94 22446 0.06% 95 24329 0.06% 96 25854 0.06% 97 27990 0.07% 98 29084 0.07% 99 30663 0.08% 100 32391 0.08% 101 34241 0.09% 102 36125 0.09% 103 38659 0.10% 104 40729 0.10% 105 42421 0.11% 106 44197 0.11% 107 46592 0.12% 108 47982 0.12% 109 50827 0.13% 110 51476 0.13% 111 53978 0.13% 112 57240 0.14% 113 58113 0.14% 114 60868 0.15% 115 63977 0.16% 116 65418 0.16% 117 67037 0.17% 118 68271 0.17% 119 69455 0.17% 120 72228 0.18% 121 74010 0.18% 122 75923 0.19% 123 79374 0.20% 124 81202 0.20% 125 83990 0.21% 126 85942 0.21% 127 87724 0.22% 128 88762 0.22% 129 91433 0.23% 130 91904 0.23% 131 93856 0.23% 132 96289 0.24% 133 98495 0.25% 134 100216 0.25% 135 102926 0.26% 136 105043 0.26% 137 105926 0.26% 138 106113 0.26% 139 109393 0.27% 140 110193 0.27% 141 112080 0.28% 142 114441 0.29% 143 115716 0.29% 144 120112 0.30% 145 121510 0.30% 146 122748 0.31% 147 125195 0.31% 148 126207 0.31% 149 127341 0.32% 150 129970 0.32% 151 35518346 88.60% 40086801 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.70 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=38 fanout-score=55.07 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=3.9 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=17 prefix-density=1.03 prefix-fanout=2.3 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=79.82 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=4.2 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814856 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:49:49 Started mapping on | Dec 06 12:49:49 Finished on | Dec 06 12:58:34 Mapping speed, Million of reads per hour | 274.88 Number of input reads | 40086801 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 33047710 Uniquely mapped reads % | 82.44% Average mapped length | 294.85 Number of splices: Total | 29995152 Number of splices: Annotated (sjdb) | 28259730 Number of splices: GT/AG | 29543993 Number of splices: GC/AG | 362469 Number of splices: AT/AC | 11449 Number of splices: Non-canonical | 77241 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.58 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2211122 % of reads mapped to multiple loci | 5.52% Number of reads mapped to too many loci | 349622 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.59% % of reads unmapped: other | 5.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4827969 4827969 4827969 N_multimapping 2211122 2211122 2211122 N_noFeature 2813987 31977107 3114055 N_ambiguous 932216 4489 162958 UnstrandedReadsAssigned:29301507 PositiveStrandReadsAssigned:1066114 NegativeStrandReadsAssigned:29770697 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814856 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814856-trimmed-pair1.fastq SRR7814856-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,086,801 reads, 30,799,775 reads pseudoaligned [quant] estimated average fragment length: 256.775 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 SRR7814856.ke.tsv 35125 SRR7814856.se.tsv 88098 total ==> SRR7814856.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 680.685 0 0 PNS24247 1044 788.225 100.865 4.95391 PNS24249 1928 1672.23 192.175 4.44898 PNS24246 1044 788.225 100.865 4.95391 PNS24248 1044 788.225 100.865 4.95391 PNS24244 1471 1215.23 216.229 6.88836 PNS24243 293 97.1181 9 3.58757 KQK14069 1603 1347.23 15123.8 434.588 KQK14071 474 237.533 182.074 29.6744 ==> SRR7814856.se.tsv <== BRADI_1g14170v3 16015 BRADI_1g53295v3 2329 BRADI_1g59795v3 367 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 274 BRADI_1g74790v3 334 BRADI_1g09890v3 0 BRADI_1g77505v3 812 BRADI_1g48960v3 0 SRR7814856 completed mapping pipeline successfully