Starting /dee2/code/volunteer_pipeline.sh SRR7814857 current disk space = 1551343476736 free memory = 1601399480 SRR7814857 SRAfilesize 95294addb94cca2a3d234b1925bbaf5b SRR7814857.sra SRR7814857.sra file validated SRR7814857 is paired end SRR7814857 is conventional basespace SRR7814857 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5225 37.0 37.0 37.0 37.0 37.0 2 36.349 37.0 37.0 37.0 37.0 37.0 3 36.4685 37.0 37.0 37.0 37.0 37.0 4 36.547 37.0 37.0 37.0 37.0 37.0 5 36.524 37.0 37.0 37.0 37.0 37.0 6 36.595 37.0 37.0 37.0 37.0 37.0 7 36.4575 37.0 37.0 37.0 37.0 37.0 8 36.4755 37.0 37.0 37.0 37.0 37.0 9 36.5685 37.0 37.0 37.0 37.0 37.0 10-14 36.5582 37.0 37.0 37.0 37.0 37.0 15-19 36.511900000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5283 37.0 37.0 37.0 37.0 37.0 25-29 36.4299 37.0 37.0 37.0 37.0 37.0 30-34 36.2835 37.0 37.0 37.0 37.0 37.0 35-39 36.18730000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.2089 37.0 37.0 37.0 37.0 37.0 45-49 36.2899 37.0 37.0 37.0 37.0 37.0 50-54 36.29780000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.251099999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.3066 37.0 37.0 37.0 37.0 37.0 65-69 36.2036 37.0 37.0 37.0 37.0 37.0 70-74 36.1043 37.0 37.0 37.0 37.0 37.0 75-79 36.0888 37.0 37.0 37.0 37.0 37.0 80-84 36.0909 37.0 37.0 37.0 37.0 37.0 85-89 36.0734 37.0 37.0 37.0 37.0 37.0 90-94 35.9729 37.0 37.0 37.0 37.0 37.0 95-99 35.71390000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.42040000000001 37.0 37.0 37.0 34.6 37.0 105-109 35.570499999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.636 37.0 37.0 37.0 37.0 37.0 115-119 35.4802 37.0 37.0 37.0 37.0 37.0 120-124 34.8915 37.0 37.0 37.0 27.4 37.0 125-129 34.60979999999999 37.0 37.0 37.0 25.0 37.0 130-134 35.0739 37.0 37.0 37.0 25.0 37.0 135-139 35.0306 37.0 37.0 37.0 25.0 37.0 140-144 34.960300000000004 37.0 37.0 37.0 25.0 37.0 145-149 34.900400000000005 37.0 37.0 37.0 25.0 37.0 150-151 34.207499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 3.0 23 1.0 24 1.0 25 3.0 26 2.0 27 13.0 28 13.0 29 26.0 30 30.0 31 55.0 32 92.0 33 155.0 34 270.0 35 570.0 36 2603.0 37 162.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.22211105552776 11.180590295147574 6.503251625812906 38.094047023511756 2 26.93846923461731 13.38169084542271 31.51575787893947 28.16408204102051 3 23.825 17.5 22.125 36.55 4 29.45 22.325 19.825 28.4 5 27.925 28.799999999999997 22.275 21.0 6 24.275 29.525000000000002 23.474999999999998 22.725 7 19.85 22.225 38.375 19.55 8 20.849999999999998 22.15 29.5 27.500000000000004 9 20.849999999999998 21.2 31.025000000000002 26.924999999999997 10-14 24.93 24.7 24.099999999999998 26.27 15-19 24.995 24.12 24.29 26.595000000000002 20-24 25.135 23.695 24.43 26.740000000000002 25-29 25.174999999999997 24.060000000000002 23.84 26.924999999999997 30-34 24.395 23.985 24.23 27.389999999999997 35-39 25.080000000000002 23.41 24.505 27.005000000000003 40-44 24.555 24.095 23.544999999999998 27.805000000000003 45-49 25.1 24.060000000000002 23.45 27.389999999999997 50-54 25.66 23.895 23.47 26.974999999999998 55-59 25.34 23.335 23.895 27.43 60-64 25.195 23.544999999999998 23.505000000000003 27.755000000000003 65-69 25.195 23.48 23.865 27.46 70-74 25.174999999999997 23.525 24.279999999999998 27.02 75-79 25.264999999999997 24.165 23.76 26.810000000000002 80-84 25.44 23.56 23.65 27.35 85-89 25.81 22.965 23.855 27.37 90-94 25.915 23.5 24.145 26.44 95-99 25.919999999999998 22.8 23.775 27.505000000000003 100-104 26.240000000000002 22.59 24.055 27.115000000000002 105-109 26.745 23.244999999999997 23.445 26.565 110-114 25.97 23.665 23.36 27.005000000000003 115-119 26.275 22.645 23.69 27.389999999999997 120-124 26.165 24.055 22.42 27.36 125-129 25.745 23.200000000000003 23.825 27.229999999999997 130-134 27.310000000000002 22.939999999999998 22.939999999999998 26.810000000000002 135-139 26.119999999999997 23.78 22.855 27.245 140-144 26.400000000000002 23.369999999999997 22.689999999999998 27.54 145-149 26.590000000000003 23.974999999999998 22.720000000000002 26.715 150-151 27.1375 23.8125 22.875 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.5 28 3.5 29 3.5 30 3.0 31 6.0 32 12.0 33 18.5 34 19.0 35 26.5 36 45.5 37 54.5 38 67.5 39 94.5 40 103.5 41 110.5 42 128.5 43 139.0 44 149.5 45 155.0 46 158.5 47 154.5 48 151.5 49 155.0 50 130.0 51 113.5 52 114.5 53 100.5 54 102.5 55 102.5 56 93.0 57 102.5 58 103.5 59 99.0 60 95.0 61 100.5 62 103.0 63 80.5 64 80.0 65 84.0 66 77.0 67 80.5 68 75.0 69 66.5 70 64.5 71 57.5 72 47.5 73 36.0 74 27.5 75 26.0 76 23.5 77 19.0 78 13.0 79 9.0 80 7.0 81 2.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.875 #Duplication Level Percentage of deduplicated Percentage of total 1 91.14167812929848 82.825 2 7.81292984869326 14.2 3 0.9078404401650619 2.475 4 0.1375515818431912 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.9125 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.475 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.45 0.0 0.0 0.0 0.0 122-123 3.8125 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.25 0.0 0.0 0.0 0.0 132-133 5.8 0.0 0.0 0.0 0.0 134-135 6.1625 0.0 0.0 0.0 0.0 136-137 6.5375 0.0 0.0 0.0 0.0 138-139 7.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGACGT 10 0.006830828 145.0 2 CGTGGCC 10 0.006830828 145.0 6 GACGTGG 10 0.006830828 145.0 4 CGACGTG 10 0.006830828 145.0 3 ACGTGGC 10 0.006830828 145.0 5 >>END_MODULE SRR7814857 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.986 37.0 37.0 37.0 37.0 37.0 2 35.617 37.0 37.0 37.0 37.0 37.0 3 35.476 37.0 37.0 37.0 37.0 37.0 4 35.7135 37.0 37.0 37.0 37.0 37.0 5 35.6035 37.0 37.0 37.0 37.0 37.0 6 35.6395 37.0 37.0 37.0 37.0 37.0 7 35.4165 37.0 37.0 37.0 37.0 37.0 8 35.505 37.0 37.0 37.0 37.0 37.0 9 35.8005 37.0 37.0 37.0 37.0 37.0 10-14 35.6804 37.0 37.0 37.0 37.0 37.0 15-19 35.191500000000005 37.0 37.0 37.0 32.2 37.0 20-24 35.5038 37.0 37.0 37.0 37.0 37.0 25-29 35.3865 37.0 37.0 37.0 34.6 37.0 30-34 35.0386 37.0 37.0 37.0 27.4 37.0 35-39 35.111200000000004 37.0 37.0 37.0 32.2 37.0 40-44 34.7737 37.0 37.0 37.0 25.0 37.0 45-49 34.882999999999996 37.0 37.0 37.0 25.0 37.0 50-54 34.2179 37.0 37.0 37.0 25.0 37.0 55-59 34.0809 37.0 37.0 37.0 25.0 37.0 60-64 34.3763 37.0 37.0 37.0 25.0 37.0 65-69 34.2492 37.0 37.0 37.0 25.0 37.0 70-74 33.9819 37.0 37.0 37.0 25.0 37.0 75-79 33.7725 37.0 37.0 37.0 22.2 37.0 80-84 33.584900000000005 37.0 37.0 37.0 22.2 37.0 85-89 33.9797 37.0 37.0 37.0 25.0 37.0 90-94 33.5098 37.0 37.0 37.0 22.2 37.0 95-99 32.618599999999994 37.0 37.0 37.0 11.0 37.0 100-104 32.9692 37.0 37.0 37.0 16.6 37.0 105-109 32.5435 37.0 37.0 37.0 11.0 37.0 110-114 32.7883 37.0 37.0 37.0 11.0 37.0 115-119 33.043200000000006 37.0 37.0 37.0 16.6 37.0 120-124 32.280899999999995 37.0 34.6 37.0 11.0 37.0 125-129 32.3869 37.0 34.6 37.0 11.0 37.0 130-134 31.939099999999996 37.0 27.4 37.0 11.0 37.0 135-139 31.8993 37.0 29.8 37.0 11.0 37.0 140-144 32.1271 37.0 29.8 37.0 11.0 37.0 145-149 31.7997 37.0 27.4 37.0 11.0 37.0 150-151 31.4435 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 4.0 16 2.0 17 0.0 18 3.0 19 2.0 20 4.0 21 5.0 22 27.0 23 44.0 24 57.0 25 71.0 26 90.0 27 91.0 28 113.0 29 124.0 30 105.0 31 155.0 32 191.0 33 272.0 34 345.0 35 823.0 36 1423.0 37 44.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.2 16.925 8.4 36.475 2 29.175 23.474999999999998 25.95 21.4 3 22.625 24.474999999999998 25.974999999999998 26.924999999999997 4 27.400000000000002 28.749999999999996 19.925 23.925 5 29.275000000000002 31.95 17.825 20.95 6 24.675 33.900000000000006 17.549999999999997 23.875 7 23.65 18.125 31.125000000000004 27.1 8 24.4 23.425 21.05 31.125000000000004 9 24.45 21.45 25.724999999999998 28.375 10-14 26.779999999999998 24.495 21.715 27.01 15-19 26.695 24.52 22.085 26.700000000000003 20-24 26.840000000000003 24.09 22.185 26.884999999999998 25-29 26.35 24.75 22.264999999999997 26.634999999999998 30-34 26.619999999999997 24.240000000000002 22.57 26.57 35-39 26.75 24.565 22.13 26.555 40-44 27.43 24.59 21.740000000000002 26.240000000000002 45-49 27.384999999999998 24.19 21.945 26.479999999999997 50-54 27.105 24.565 22.27 26.06 55-59 27.439999999999998 24.54 21.87 26.150000000000002 60-64 27.07 23.525 22.14 27.265 65-69 26.825 24.21 22.395 26.57 70-74 27.26 23.89 22.650000000000002 26.200000000000003 75-79 26.584999999999997 24.565 22.655 26.195 80-84 26.889999999999997 24.21 22.37 26.529999999999998 85-89 27.675 23.7 22.465 26.16 90-94 26.855 24.33 22.59 26.224999999999998 95-99 27.224999999999998 25.19 21.83 25.755 100-104 27.0 24.765 22.675 25.56 105-109 26.685 25.215 22.46 25.64 110-114 26.619999999999997 25.6 21.88 25.900000000000002 115-119 27.165 24.98 21.64 26.215 120-124 26.56 26.25 21.54 25.650000000000002 125-129 27.87 26.22 21.07 24.84 130-134 27.615000000000002 26.625 21.665 24.095 135-139 26.584999999999997 26.275 22.215 24.925 140-144 27.944999999999997 26.029999999999998 21.29 24.735 145-149 28.134999999999998 26.75 21.355 23.76 150-151 28.3125 26.937499999999996 21.25 23.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 0.5 23 1.5 24 4.5 25 3.5 26 2.5 27 3.5 28 2.5 29 4.0 30 11.0 31 15.0 32 14.0 33 15.0 34 20.0 35 25.5 36 40.0 37 53.0 38 58.5 39 65.0 40 75.5 41 106.5 42 127.0 43 126.5 44 130.0 45 142.0 46 137.0 47 131.5 48 136.5 49 129.0 50 118.5 51 123.0 52 115.0 53 94.0 54 94.5 55 98.5 56 95.5 57 94.0 58 104.5 59 117.5 60 112.0 61 113.0 62 117.0 63 105.0 64 101.5 65 96.5 66 93.0 67 87.0 68 71.0 69 73.0 70 75.5 71 61.0 72 47.5 73 43.5 74 37.5 75 30.0 76 27.0 77 16.5 78 8.5 79 6.5 80 6.5 81 7.0 82 6.0 83 2.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 2.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 91.64146274401979 83.325 2 7.066263403904317 12.85 3 1.0448171569975253 2.85 4 0.192466318394281 0.7000000000000001 5 0.027495188342040146 0.125 6 0.027495188342040146 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.48750000000000004 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 3.05 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.550000000000001 0.0 0.0 0.0 0.0 132-133 5.025 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540908 spots for SRR7814857.sra Written 1540908 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra Read 1540896 spots for SRR7814857.sra Written 1540896 spots for SRR7814857.sra SRR ids: ['SRR7814857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fmcrlll SRR7814857.sra spots: 30817932 blocks: [[1, 1540896], [1540897, 3081792], [3081793, 4622688], [4622689, 6163584], [6163585, 7704480], [7704481, 9245376], [9245377, 10786272], [10786273, 12327168], [12327169, 13868064], [13868065, 15408960], [15408961, 16949856], [16949857, 18490752], [18490753, 20031648], [20031649, 21572544], [21572545, 23113440], [23113441, 24654336], [24654337, 26195232], [26195233, 27736128], [27736129, 29277024], [29277025, 30817932]] SRR7814857 file size 10421485 SRR7814857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814857 SRR7814857_1.fastq SRR7814857_2.fastq Input file: SRR7814857_1.fastq Paired file: SRR7814857_2.fastq trimmed: SRR7814857-trimmed-pair1.fastq, SRR7814857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:46:01 2024 >> started Fri Dec 6 12:46:36 2024 >> done (35.149s) 30817932 read pairs processed; of these: 144 ( 0.00%) short read pairs filtered out after trimming by size control 5445 ( 0.02%) empty read pairs filtered out after trimming by size control 30812343 (99.98%) read pairs available; of these: 3224482 (10.46%) trimmed read pairs available after processing 27587861 (89.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 13 0.00% 20 23 0.00% 21 19 0.00% 22 20 0.00% 23 25 0.00% 24 22 0.00% 25 28 0.00% 26 33 0.00% 27 27 0.00% 28 32 0.00% 29 39 0.00% 30 41 0.00% 31 56 0.00% 32 60 0.00% 33 48 0.00% 34 42 0.00% 35 58 0.00% 36 65 0.00% 37 77 0.00% 38 72 0.00% 39 73 0.00% 40 84 0.00% 41 88 0.00% 42 124 0.00% 43 95 0.00% 44 99 0.00% 45 97 0.00% 46 129 0.00% 47 124 0.00% 48 149 0.00% 49 151 0.00% 50 179 0.00% 51 176 0.00% 52 217 0.00% 53 238 0.00% 54 220 0.00% 55 255 0.00% 56 273 0.00% 57 301 0.00% 58 320 0.00% 59 425 0.00% 60 472 0.00% 61 525 0.00% 62 560 0.00% 63 635 0.00% 64 648 0.00% 65 692 0.00% 66 779 0.00% 67 831 0.00% 68 993 0.00% 69 1130 0.00% 70 1332 0.00% 71 1518 0.00% 72 1696 0.01% 73 1945 0.01% 74 2134 0.01% 75 2418 0.01% 76 2703 0.01% 77 3078 0.01% 78 3355 0.01% 79 3651 0.01% 80 4192 0.01% 81 4557 0.01% 82 5145 0.02% 83 5919 0.02% 84 6410 0.02% 85 7090 0.02% 86 7861 0.03% 87 8452 0.03% 88 9215 0.03% 89 10105 0.03% 90 10839 0.04% 91 12503 0.04% 92 13314 0.04% 93 14408 0.05% 94 15721 0.05% 95 16743 0.05% 96 17633 0.06% 97 19243 0.06% 98 20201 0.07% 99 21630 0.07% 100 23140 0.08% 101 24305 0.08% 102 25742 0.08% 103 27532 0.09% 104 28757 0.09% 105 30312 0.10% 106 32052 0.10% 107 33336 0.11% 108 34192 0.11% 109 36346 0.12% 110 37083 0.12% 111 38443 0.12% 112 40319 0.13% 113 42524 0.14% 114 43999 0.14% 115 45689 0.15% 116 46755 0.15% 117 48477 0.16% 118 48688 0.16% 119 49938 0.16% 120 51443 0.17% 121 52586 0.17% 122 54522 0.18% 123 56207 0.18% 124 57563 0.19% 125 59241 0.19% 126 61115 0.20% 127 62472 0.20% 128 62830 0.20% 129 64360 0.21% 130 65518 0.21% 131 66486 0.22% 132 68979 0.22% 133 69942 0.23% 134 70850 0.23% 135 71816 0.23% 136 73082 0.24% 137 73806 0.24% 138 74242 0.24% 139 76767 0.25% 140 76929 0.25% 141 78974 0.26% 142 80855 0.26% 143 81860 0.27% 144 84286 0.27% 145 85122 0.28% 146 85069 0.28% 147 86369 0.28% 148 88362 0.29% 149 88351 0.29% 150 89936 0.29% 151 27587861 89.54% 30812343 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=12 prefix-density=0.88 prefix-fanout=3.3 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=35 fanout-score=22.62 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=4.9 sequence=TTCTTGGCGAACGTCTCTGGGTCAGCTGACAACCCCGCGGTGTCCCAGCCGTAGTCACCGGGGAACTCGCCGGTCAGGTA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=13 prefix-density=0.72 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.29 sequence-density-rank=15 fanout-score=27.74 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=10.6 sequence=CAAGAAGAAGGT SRR7814857 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:47:27 Started mapping on | Dec 06 12:47:27 Finished on | Dec 06 12:52:46 Mapping speed, Million of reads per hour | 347.73 Number of input reads | 30812343 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 28572113 Uniquely mapped reads % | 92.73% Average mapped length | 295.08 Number of splices: Total | 25859007 Number of splices: Annotated (sjdb) | 24409186 Number of splices: GT/AG | 25494647 Number of splices: GC/AG | 293712 Number of splices: AT/AC | 12198 Number of splices: Non-canonical | 58450 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.02% Deletion average length | 3.00 Insertion rate per base | 0.03% Insertion average length | 2.76 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 539621 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 41360 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.49% % of reads unmapped: other | 0.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1700609 1700609 1700609 N_multimapping 539621 539621 539621 N_noFeature 1057731 27709363 1340542 N_ambiguous 723552 3805 144758 UnstrandedReadsAssigned:26790830 PositiveStrandReadsAssigned:858945 NegativeStrandReadsAssigned:27086813 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814857-trimmed-pair1.fastq SRR7814857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,812,343 reads, 27,508,018 reads pseudoaligned [quant] estimated average fragment length: 269.791 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR7814857.ke.tsv 35125 SRR7814857.se.tsv 88098 total ==> SRR7814857.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 667.615 0 0 PNS24247 1044 775.209 52.942 3.26802 PNS24249 1928 1659.21 138.568 3.99635 PNS24246 1044 775.209 52.942 3.26802 PNS24248 1044 775.209 52.942 3.26802 PNS24244 1471 1202.21 65.6064 2.61137 PNS24243 293 96.2347 1 0.497246 KQK14069 1603 1334.21 12683.8 454.914 KQK14071 474 231.07 56.0153 11.6002 ==> SRR7814857.se.tsv <== BRADI_1g14170v3 12855 BRADI_1g53295v3 2930 BRADI_1g59795v3 88 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 677 BRADI_1g74790v3 247 BRADI_1g09890v3 5 BRADI_1g77505v3 394 BRADI_1g48960v3 0 SRR7814857 completed mapping pipeline successfully