Starting /dee2/code/volunteer_pipeline.sh SRR7814858 current disk space = 1551182548992 free memory = 1599030760 SRR7814858 SRAfilesize b62d943ad609b77ce10d6cdae4cbc246 SRR7814858.sra SRR7814858.sra file validated SRR7814858 is paired end SRR7814858 is conventional basespace SRR7814858 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.34 37.0 37.0 37.0 37.0 37.0 2 36.3715 37.0 37.0 37.0 37.0 37.0 3 36.5095 37.0 37.0 37.0 37.0 37.0 4 36.514 37.0 37.0 37.0 37.0 37.0 5 36.4765 37.0 37.0 37.0 37.0 37.0 6 36.4985 37.0 37.0 37.0 37.0 37.0 7 36.5725 37.0 37.0 37.0 37.0 37.0 8 36.4885 37.0 37.0 37.0 37.0 37.0 9 36.6255 37.0 37.0 37.0 37.0 37.0 10-14 36.5599 37.0 37.0 37.0 37.0 37.0 15-19 36.4929 37.0 37.0 37.0 37.0 37.0 20-24 36.518899999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.42190000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.2886 37.0 37.0 37.0 37.0 37.0 35-39 36.2309 37.0 37.0 37.0 37.0 37.0 40-44 36.050700000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.898 37.0 37.0 37.0 37.0 37.0 50-54 36.1564 37.0 37.0 37.0 37.0 37.0 55-59 35.7832 37.0 37.0 37.0 37.0 37.0 60-64 35.724000000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.631600000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.662499999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.005199999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.0558 37.0 37.0 37.0 37.0 37.0 85-89 36.04619999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.9178 37.0 37.0 37.0 37.0 37.0 95-99 35.6653 37.0 37.0 37.0 37.0 37.0 100-104 35.364999999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.6182 37.0 37.0 37.0 37.0 37.0 110-114 35.6673 37.0 37.0 37.0 37.0 37.0 115-119 35.5143 37.0 37.0 37.0 37.0 37.0 120-124 34.855399999999996 37.0 37.0 37.0 27.4 37.0 125-129 34.5873 37.0 37.0 37.0 25.0 37.0 130-134 35.1505 37.0 37.0 37.0 27.4 37.0 135-139 34.9847 37.0 37.0 37.0 25.0 37.0 140-144 35.0995 37.0 37.0 37.0 27.4 37.0 145-149 34.9242 37.0 37.0 37.0 25.0 37.0 150-151 34.3425 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 3.0 24 2.0 25 8.0 26 5.0 27 7.0 28 13.0 29 34.0 30 35.0 31 60.0 32 109.0 33 176.0 34 293.0 35 600.0 36 2479.0 37 174.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.99297541394882 10.511791269443052 6.246864024084295 35.24836929252383 2 26.650000000000002 14.75 30.099999999999998 28.499999999999996 3 21.775 17.275 23.95 37.0 4 28.425 24.175 18.75 28.65 5 29.349999999999998 28.225 21.15 21.275 6 25.174999999999997 29.4 22.400000000000002 23.025000000000002 7 19.400000000000002 24.7 34.949999999999996 20.95 8 20.599999999999998 23.724999999999998 27.500000000000004 28.175 9 23.599999999999998 20.0 29.625 26.775 10-14 24.64 25.380000000000003 23.165 26.815 15-19 24.635 23.535 24.85 26.979999999999997 20-24 24.44 24.195 24.33 27.034999999999997 25-29 25.085 23.435 24.060000000000002 27.42 30-34 24.490000000000002 23.69 23.805 28.015 35-39 24.915000000000003 24.37 23.275000000000002 27.439999999999998 40-44 24.945 23.935000000000002 24.39 26.729999999999997 45-49 25.485000000000003 23.04 23.98 27.495000000000005 50-54 25.779999999999998 23.07 23.73 27.42 55-59 24.625 23.075000000000003 24.67 27.63 60-64 26.314999999999998 22.5 24.495 26.69 65-69 25.845000000000002 24.275 23.125 26.755000000000003 70-74 28.075 22.295 22.985 26.645000000000003 75-79 28.325 22.955000000000002 22.475 26.245 80-84 28.255000000000003 22.965 22.564999999999998 26.215 85-89 28.285 22.335 22.98 26.400000000000002 90-94 28.23 22.884999999999998 22.53 26.355 95-99 28.685 22.525000000000002 22.175 26.615 100-104 28.449999999999996 23.385 21.975 26.19 105-109 28.494999999999997 21.86 22.81 26.834999999999997 110-114 28.599999999999998 22.96 21.935 26.505000000000003 115-119 28.73 22.31 22.175 26.784999999999997 120-124 28.54 23.275000000000002 21.94 26.245 125-129 28.67 22.564999999999998 22.645 26.119999999999997 130-134 28.794999999999998 22.55 21.995 26.66 135-139 29.12 22.775000000000002 21.605 26.5 140-144 28.865000000000002 22.335 22.205 26.595000000000002 145-149 28.625 22.325 22.634999999999998 26.415 150-151 28.762500000000003 22.400000000000002 22.0125 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 4.0 29 4.0 30 4.5 31 12.0 32 14.5 33 13.5 34 15.5 35 24.0 36 33.0 37 37.5 38 45.5 39 61.5 40 95.0 41 125.0 42 131.0 43 136.0 44 145.0 45 146.0 46 154.0 47 158.5 48 154.0 49 146.5 50 126.0 51 114.0 52 116.0 53 115.0 54 98.5 55 83.0 56 89.0 57 99.0 58 94.0 59 91.5 60 106.0 61 102.0 62 97.5 63 93.0 64 92.5 65 104.5 66 98.5 67 86.5 68 81.5 69 79.0 70 81.0 71 66.5 72 41.5 73 40.0 74 38.5 75 31.5 76 25.0 77 18.5 78 10.5 79 4.5 80 3.0 81 2.5 82 2.5 83 2.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 88.8985759953502 76.47500000000001 2 9.415867480383609 16.2 3 1.3077593722755012 3.375 4 0.26155187445510025 0.8999999999999999 5 0.058122638767800064 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.058122638767800064 2.8000000000000003 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGACCATTATCGCGTAT 57 1.425 TruSeq Adapter, Index 4 (97% over 39bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGACCATTATCTCGTAT 55 1.375 TruSeq Adapter, Index 4 (97% over 39bp) GGCAGAGCCTCTAGTATGGGGGCTACCTCAGTGGCCTCACGCCCATTAAT 5 0.125 No Hit GCCCGTCACAAATCCACCAATATGAGCAAAGTTATCAGCATGAGGTAGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.9125 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.5375 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.2625 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.225 0.0 0.0 0.0 0.0 136-137 6.7125 0.0 0.0 0.0 0.0 138-139 7.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACATC 10 0.006830828 145.0 4 >>END_MODULE SRR7814858 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814858_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.971 37.0 37.0 37.0 37.0 37.0 2 35.8065 37.0 37.0 37.0 37.0 37.0 3 35.6205 37.0 37.0 37.0 37.0 37.0 4 35.597 37.0 37.0 37.0 37.0 37.0 5 35.708 37.0 37.0 37.0 37.0 37.0 6 35.5555 37.0 37.0 37.0 37.0 37.0 7 35.236 37.0 37.0 37.0 37.0 37.0 8 35.1915 37.0 37.0 37.0 37.0 37.0 9 35.524 37.0 37.0 37.0 37.0 37.0 10-14 35.350699999999996 37.0 37.0 37.0 37.0 37.0 15-19 34.890499999999996 37.0 37.0 37.0 27.4 37.0 20-24 35.0522 37.0 37.0 37.0 29.8 37.0 25-29 34.76989999999999 37.0 37.0 37.0 27.4 37.0 30-34 34.509299999999996 37.0 37.0 37.0 25.0 37.0 35-39 34.564 37.0 37.0 37.0 25.0 37.0 40-44 34.17190000000001 37.0 37.0 37.0 25.0 37.0 45-49 34.255700000000004 37.0 37.0 37.0 25.0 37.0 50-54 33.62329999999999 37.0 37.0 37.0 19.4 37.0 55-59 33.5625 37.0 37.0 37.0 19.4 37.0 60-64 33.8767 37.0 37.0 37.0 25.0 37.0 65-69 33.7201 37.0 37.0 37.0 22.2 37.0 70-74 33.322500000000005 37.0 37.0 37.0 16.6 37.0 75-79 33.2868 37.0 37.0 37.0 16.6 37.0 80-84 33.158 37.0 37.0 37.0 13.8 37.0 85-89 33.7207 37.0 37.0 37.0 22.2 37.0 90-94 33.344100000000005 37.0 37.0 37.0 16.6 37.0 95-99 32.474599999999995 37.0 37.0 37.0 11.0 37.0 100-104 32.9813 37.0 37.0 37.0 13.8 37.0 105-109 32.472699999999996 37.0 34.6 37.0 13.8 37.0 110-114 32.815000000000005 37.0 37.0 37.0 11.0 37.0 115-119 33.036500000000004 37.0 37.0 37.0 16.6 37.0 120-124 32.1782 37.0 34.6 37.0 11.0 37.0 125-129 32.5077 37.0 37.0 37.0 11.0 37.0 130-134 31.949300000000004 37.0 29.8 37.0 11.0 37.0 135-139 31.902199999999993 37.0 29.8 37.0 11.0 37.0 140-144 32.107299999999995 37.0 29.8 37.0 11.0 37.0 145-149 31.742200000000004 37.0 27.4 37.0 11.0 37.0 150-151 31.343249999999998 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 7.0 16 6.0 17 3.0 18 8.0 19 13.0 20 13.0 21 20.0 22 28.0 23 46.0 24 70.0 25 92.0 26 85.0 27 110.0 28 110.0 29 118.0 30 136.0 31 148.0 32 153.0 33 211.0 34 360.0 35 781.0 36 1451.0 37 26.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.625 18.05 7.324999999999999 32.0 2 33.074999999999996 20.45 24.575 21.9 3 25.224999999999998 23.95 24.775 26.05 4 30.599999999999998 28.875 17.474999999999998 23.05 5 31.674999999999997 30.375000000000004 16.950000000000003 21.0 6 27.85 33.45 17.299999999999997 21.4 7 25.724999999999998 17.95 32.35 23.974999999999998 8 26.35 19.8 23.200000000000003 30.65 9 28.95 21.099999999999998 22.3 27.650000000000002 10-14 29.32 23.895 20.36 26.424999999999997 15-19 28.115000000000002 23.94 21.279999999999998 26.665 20-24 28.994999999999997 23.305 21.365000000000002 26.334999999999997 25-29 28.305000000000003 23.849999999999998 21.595 26.25 30-34 27.145000000000003 23.855 22.675 26.325 35-39 27.834999999999997 24.055 21.255 26.855 40-44 27.525 24.215 21.735 26.525 45-49 27.139999999999997 23.815 22.52 26.525 50-54 26.88 24.135 22.71 26.275 55-59 28.525 23.23 22.215 26.029999999999998 60-64 28.810000000000002 22.64 22.065 26.484999999999996 65-69 27.955000000000002 23.71 21.87 26.465 70-74 27.41 24.635 22.275 25.679999999999996 75-79 27.025 24.25 22.305 26.419999999999998 80-84 28.299999999999997 24.27 21.709999999999997 25.72 85-89 29.020000000000003 23.27 21.65 26.06 90-94 29.349999999999998 23.74 21.08 25.83 95-99 29.095 24.265 21.560000000000002 25.080000000000002 100-104 28.765 24.26 21.68 25.295 105-109 28.79 24.565 21.665 24.98 110-114 29.315 24.09 21.785 24.81 115-119 29.265 23.705000000000002 21.325 25.705 120-124 29.195 24.75 21.3 24.755 125-129 29.585 24.935 20.845 24.635 130-134 29.04 25.515 21.59 23.855 135-139 29.154999999999998 25.540000000000003 21.445 23.86 140-144 30.095 24.695 21.595 23.615 145-149 29.56 25.585 21.63 23.225 150-151 30.225 24.6625 21.55 23.5625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.5 22 1.0 23 1.5 24 1.5 25 1.5 26 3.5 27 5.0 28 4.0 29 6.0 30 6.0 31 5.0 32 9.5 33 13.5 34 22.5 35 34.5 36 42.5 37 42.0 38 50.5 39 73.5 40 83.5 41 87.0 42 90.0 43 98.5 44 104.0 45 118.0 46 129.5 47 121.0 48 129.5 49 136.5 50 126.0 51 114.5 52 116.0 53 122.5 54 106.0 55 98.5 56 109.5 57 107.0 58 104.5 59 120.0 60 117.0 61 99.0 62 110.0 63 114.0 64 103.0 65 100.0 66 97.0 67 88.5 68 70.0 69 68.0 70 72.5 71 66.0 72 67.5 73 55.5 74 41.0 75 34.5 76 25.5 77 22.0 78 14.5 79 6.5 80 6.5 81 4.0 82 2.5 83 4.5 84 4.5 85 5.5 86 5.5 87 3.5 88 4.0 89 6.5 90 4.0 91 0.5 92 2.0 93 3.0 94 4.0 95 3.0 96 1.5 97 1.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.48549107142857 81.075 2 8.0078125 14.35 3 1.0602678571428572 2.85 4 0.33482142857142855 1.2 5 0.08370535714285714 0.375 6 0.027901785714285712 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit ATCCATTTGGTTGTGAACATGCTAAGTTTGCTGTTTATTGGAATTCGTCT 5 0.125 No Hit ATCAGGTCACATTGTTCACTAGAGGAAAGGCACCCGTAACCCAGCAGTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0125 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.075 0.0 0.0 0.0 0.025 74-75 0.075 0.0 0.0 0.0 0.025 76-77 0.075 0.0 0.0 0.0 0.025 78-79 0.075 0.0 0.0 0.0 0.025 80-81 0.1125 0.0 0.0 0.0 0.025 82-83 0.15 0.0 0.0 0.0 0.025 84-85 0.16249999999999998 0.0 0.0 0.0 0.025 86-87 0.2375 0.0 0.0 0.0 0.025 88-89 0.3125 0.0 0.0 0.0 0.025 90-91 0.4125 0.0 0.0 0.0 0.025 92-93 0.5 0.0 0.0 0.0 0.025 94-95 0.6125 0.0 0.0 0.0 0.025 96-97 0.625 0.0 0.0 0.0 0.025 98-99 0.675 0.0 0.0 0.0 0.025 100-101 0.7375 0.0 0.0 0.0 0.025 102-103 0.875 0.0 0.0 0.0 0.025 104-105 1.2 0.0 0.0 0.0 0.025 106-107 1.4 0.0 0.0 0.0 0.025 108-109 1.55 0.0 0.0 0.0 0.025 110-111 1.775 0.0 0.0 0.0 0.025 112-113 1.975 0.0 0.0 0.0 0.025 114-115 2.1500000000000004 0.0 0.0 0.0 0.025 116-117 2.425 0.0 0.0 0.0 0.025 118-119 2.8625 0.0 0.0 0.0 0.025 120-121 3.25 0.0 0.0 0.0 0.025 122-123 3.4749999999999996 0.0 0.0 0.0 0.025 124-125 3.5999999999999996 0.0 0.0 0.0 0.025 126-127 3.975 0.0 0.0 0.0 0.025 128-129 4.2875 0.0 0.0 0.0 0.025 130-131 4.625 0.0 0.0 0.0 0.025 132-133 4.9875 0.0 0.0 0.0 0.025 134-135 5.4 0.0 0.0 0.0 0.025 136-137 5.8375 0.0 0.0 0.0 0.025 138-139 6.35 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAAGGG 10 0.006830828 145.0 9 >>END_MODULE Read 1826016 spots for SRR7814858.sra Written 1826016 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra Read 1825997 spots for SRR7814858.sra Written 1825997 spots for SRR7814858.sra SRR ids: ['SRR7814858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j1c5a7h7 SRR7814858.sra spots: 36519959 blocks: [[1, 1825997], [1825998, 3651994], [3651995, 5477991], [5477992, 7303988], [7303989, 9129985], [9129986, 10955982], [10955983, 12781979], [12781980, 14607976], [14607977, 16433973], [16433974, 18259970], [18259971, 20085967], [20085968, 21911964], [21911965, 23737961], [23737962, 25563958], [25563959, 27389955], [27389956, 29215952], [29215953, 31041949], [31041950, 32867946], [32867947, 34693943], [34693944, 36519959]] SRR7814858 file size 12353715 SRR7814858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814858 SRR7814858_1.fastq SRR7814858_2.fastq Input file: SRR7814858_1.fastq Paired file: SRR7814858_2.fastq trimmed: SRR7814858-trimmed-pair1.fastq, SRR7814858-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:52:15 2024 >> started Fri Dec 6 12:53:10 2024 >> done (54.793s) 36519959 read pairs processed; of these: 528 ( 0.00%) short read pairs filtered out after trimming by size control 993540 ( 2.72%) empty read pairs filtered out after trimming by size control 35525891 (97.28%) read pairs available; of these: 3721260 (10.47%) trimmed read pairs available after processing 31804631 (89.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 21 0.00% 21 31 0.00% 22 23 0.00% 23 31 0.00% 24 39 0.00% 25 42 0.00% 26 52 0.00% 27 48 0.00% 28 55 0.00% 29 47 0.00% 30 48 0.00% 31 62 0.00% 32 47 0.00% 33 61 0.00% 34 79 0.00% 35 73 0.00% 36 70 0.00% 37 87 0.00% 38 85 0.00% 39 88 0.00% 40 83 0.00% 41 116 0.00% 42 109 0.00% 43 109 0.00% 44 111 0.00% 45 126 0.00% 46 121 0.00% 47 128 0.00% 48 175 0.00% 49 163 0.00% 50 184 0.00% 51 205 0.00% 52 226 0.00% 53 212 0.00% 54 248 0.00% 55 281 0.00% 56 268 0.00% 57 308 0.00% 58 351 0.00% 59 378 0.00% 60 518 0.00% 61 549 0.00% 62 640 0.00% 63 678 0.00% 64 700 0.00% 65 818 0.00% 66 863 0.00% 67 942 0.00% 68 1067 0.00% 69 1165 0.00% 70 1427 0.00% 71 1583 0.00% 72 1775 0.00% 73 2038 0.01% 74 2232 0.01% 75 2484 0.01% 76 2722 0.01% 77 2993 0.01% 78 3356 0.01% 79 3979 0.01% 80 4287 0.01% 81 4930 0.01% 82 5741 0.02% 83 6366 0.02% 84 7170 0.02% 85 7576 0.02% 86 8208 0.02% 87 9157 0.03% 88 9775 0.03% 89 10383 0.03% 90 11764 0.03% 91 13105 0.04% 92 14219 0.04% 93 15660 0.04% 94 17196 0.05% 95 18384 0.05% 96 19434 0.05% 97 20798 0.06% 98 21895 0.06% 99 23383 0.07% 100 24976 0.07% 101 26534 0.07% 102 27907 0.08% 103 30392 0.09% 104 31703 0.09% 105 32825 0.09% 106 35365 0.10% 107 36839 0.10% 108 38444 0.11% 109 39793 0.11% 110 41231 0.12% 111 42859 0.12% 112 45256 0.13% 113 46786 0.13% 114 49053 0.14% 115 51657 0.15% 116 52997 0.15% 117 54345 0.15% 118 56146 0.16% 119 56964 0.16% 120 58340 0.16% 121 60407 0.17% 122 61557 0.17% 123 64190 0.18% 124 66530 0.19% 125 68727 0.19% 126 70551 0.20% 127 72289 0.20% 128 73128 0.21% 129 75171 0.21% 130 76010 0.21% 131 77449 0.22% 132 80191 0.23% 133 81812 0.23% 134 83679 0.24% 135 86084 0.24% 136 86379 0.24% 137 87797 0.25% 138 88844 0.25% 139 90998 0.26% 140 90786 0.26% 141 93681 0.26% 142 95675 0.27% 143 97329 0.27% 144 99066 0.28% 145 101683 0.29% 146 101900 0.29% 147 104180 0.29% 148 105196 0.30% 149 105081 0.30% 150 107505 0.30% 151 31804631 89.53% 35525891 reads passed initial QC criterion=sequence-density sequence-density=1.19 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=18 prefix-density=1.24 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.26 sequence-density-rank=28 fanout-score=14.14 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=4.3 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=13 prefix-density=0.85 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=49.22 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=TGCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR7814858 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:53:56 Started mapping on | Dec 06 12:53:56 Finished on | Dec 06 12:57:48 Mapping speed, Million of reads per hour | 551.26 Number of input reads | 35525891 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 33219187 Uniquely mapped reads % | 93.51% Average mapped length | 295.24 Number of splices: Total | 28863639 Number of splices: Annotated (sjdb) | 27275133 Number of splices: GT/AG | 28461941 Number of splices: GC/AG | 317653 Number of splices: AT/AC | 14591 Number of splices: Non-canonical | 69454 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.03% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 715030 % of reads mapped to multiple loci | 2.01% Number of reads mapped to too many loci | 60134 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.15% % of reads unmapped: other | 1.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1591674 1591674 1591674 N_multimapping 715030 715030 715030 N_noFeature 1204556 32157042 1574935 N_ambiguous 879425 3918 188502 UnstrandedReadsAssigned:31135206 PositiveStrandReadsAssigned:1058227 NegativeStrandReadsAssigned:31455750 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814858 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814858-trimmed-pair1.fastq SRR7814858-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,525,891 reads, 31,945,024 reads pseudoaligned [quant] estimated average fragment length: 265.309 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,148 rounds 52973 SRR7814858.ke.tsv 35125 SRR7814858.se.tsv 88098 total ==> SRR7814858.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 672.132 0.0183449 0.00105805 PNS24247 1044 779.691 39.4126 1.95956 PNS24249 1928 1663.69 193.265 4.50325 PNS24246 1044 779.691 39.4126 1.95956 PNS24248 1044 779.691 39.4126 1.95956 PNS24244 1471 1206.69 84.4784 2.71391 PNS24243 293 97.0455 1 0.399457 KQK14069 1603 1338.69 14288.7 413.77 KQK14071 474 233.258 46.1755 7.67397 ==> SRR7814858.se.tsv <== BRADI_1g14170v3 14460 BRADI_1g53295v3 3326 BRADI_1g59795v3 70 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 710 BRADI_1g74790v3 377 BRADI_1g09890v3 7 BRADI_1g77505v3 452 BRADI_1g48960v3 0 SRR7814858 completed mapping pipeline successfully