Starting /dee2/code/volunteer_pipeline.sh SRR7814859 current disk space = 1550848634880 free memory = 1595638816 SRR7814859 SRAfilesize ebf7e587a22af438ea9a5a849a353f49 SRR7814859.sra SRR7814859.sra file validated SRR7814859 is paired end SRR7814859 is conventional basespace SRR7814859 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.428 37.0 37.0 37.0 37.0 37.0 2 36.421 37.0 37.0 37.0 37.0 37.0 3 36.4865 37.0 37.0 37.0 37.0 37.0 4 36.526 37.0 37.0 37.0 37.0 37.0 5 36.536 37.0 37.0 37.0 37.0 37.0 6 36.5285 37.0 37.0 37.0 37.0 37.0 7 36.4205 37.0 37.0 37.0 37.0 37.0 8 36.564 37.0 37.0 37.0 37.0 37.0 9 36.523 37.0 37.0 37.0 37.0 37.0 10-14 36.5171 37.0 37.0 37.0 37.0 37.0 15-19 36.5287 37.0 37.0 37.0 37.0 37.0 20-24 36.5459 37.0 37.0 37.0 37.0 37.0 25-29 36.4765 37.0 37.0 37.0 37.0 37.0 30-34 36.4116 37.0 37.0 37.0 37.0 37.0 35-39 36.410399999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3832 37.0 37.0 37.0 37.0 37.0 45-49 36.404700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3522 37.0 37.0 37.0 37.0 37.0 55-59 36.3431 37.0 37.0 37.0 37.0 37.0 60-64 36.3041 37.0 37.0 37.0 37.0 37.0 65-69 36.2911 37.0 37.0 37.0 37.0 37.0 70-74 36.3395 37.0 37.0 37.0 37.0 37.0 75-79 36.29730000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2108 37.0 37.0 37.0 37.0 37.0 85-89 36.19690000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.1762 37.0 37.0 37.0 37.0 37.0 95-99 36.2214 37.0 37.0 37.0 37.0 37.0 100-104 36.188 37.0 37.0 37.0 37.0 37.0 105-109 36.17 37.0 37.0 37.0 37.0 37.0 110-114 36.1274 37.0 37.0 37.0 37.0 37.0 115-119 36.06679999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.9674 37.0 37.0 37.0 37.0 37.0 125-129 35.9931 37.0 37.0 37.0 37.0 37.0 130-134 35.950399999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.9129 37.0 37.0 37.0 37.0 37.0 140-144 35.8731 37.0 37.0 37.0 37.0 37.0 145-149 35.820800000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.2 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 4.0 26 1.0 27 10.0 28 8.0 29 17.0 30 27.0 31 44.0 32 59.0 33 81.0 34 151.0 35 318.0 36 2816.0 37 463.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 49.699097291875624 10.932798395185557 4.889669007021062 34.478435305917756 2 25.2 13.625000000000002 32.15 29.025000000000002 3 21.675 18.325 23.0 37.0 4 29.025000000000002 24.75 19.075 27.150000000000002 5 29.325000000000003 28.225 21.9 20.549999999999997 6 22.525000000000002 31.924999999999997 23.599999999999998 21.95 7 19.275000000000002 22.625 38.625 19.475 8 20.599999999999998 21.65 29.2 28.549999999999997 9 21.725 20.65 31.5 26.125 10-14 23.75 26.68 24.185000000000002 25.385 15-19 24.505 24.98 24.48 26.035000000000004 20-24 23.695 24.555 24.915000000000003 26.834999999999997 25-29 24.295 25.124999999999996 24.675 25.905 30-34 24.154999999999998 24.779999999999998 24.935 26.13 35-39 24.310000000000002 24.67 24.5 26.52 40-44 24.305 24.685000000000002 24.765 26.245 45-49 24.3 24.145 24.37 27.185 50-54 24.345 24.255 24.825 26.575 55-59 24.725 24.625 24.295 26.355 60-64 24.195 24.065 24.990000000000002 26.75 65-69 24.2 24.585 24.535 26.68 70-74 25.05 24.765 24.42 25.765 75-79 24.224999999999998 24.555 23.965 27.255000000000003 80-84 25.005 23.810000000000002 24.545 26.640000000000004 85-89 24.975 24.32 23.79 26.915 90-94 25.224999999999998 23.799999999999997 24.63 26.345000000000002 95-99 25.074999999999996 23.715 24.88 26.33 100-104 25.319999999999997 24.529999999999998 23.72 26.43 105-109 24.895 23.86 24.345 26.900000000000002 110-114 24.965 24.490000000000002 24.33 26.215 115-119 25.44 24.015 23.555 26.99 120-124 25.785000000000004 24.02 23.585 26.61 125-129 25.165 24.01 23.794999999999998 27.029999999999998 130-134 25.900000000000002 23.485 23.645 26.97 135-139 25.264999999999997 24.404999999999998 23.150000000000002 27.18 140-144 25.47 24.165 23.549999999999997 26.815 145-149 26.08 24.175 23.044999999999998 26.700000000000003 150-151 26.1125 24.625 22.9375 26.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.5 28 2.5 29 6.0 30 7.0 31 9.0 32 17.0 33 23.0 34 28.0 35 34.0 36 44.5 37 58.0 38 74.5 39 105.0 40 117.0 41 119.0 42 144.0 43 167.0 44 161.0 45 156.5 46 164.0 47 149.5 48 154.0 49 154.5 50 151.0 51 150.5 52 127.5 53 127.0 54 120.5 55 101.5 56 94.0 57 98.5 58 102.5 59 93.0 60 86.5 61 81.0 62 77.0 63 66.5 64 60.5 65 69.0 66 68.5 67 69.0 68 57.0 69 46.5 70 44.5 71 38.0 72 35.5 73 30.0 74 27.0 75 24.5 76 18.5 77 9.5 78 7.0 79 6.5 80 4.5 81 4.0 82 2.5 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 91.25308472717302 83.2 2 7.979160954208939 14.549999999999999 3 0.6580751302440362 1.7999999999999998 4 0.054839594187003016 0.2 5 0.054839594187003016 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCCCCCTCATTTATTCAACCCATGATAGCAGACACGAAGAGAACCTCTG 5 0.125 No Hit GGGGACGGGTGGGGAGGCGACGGAGCGTACAGTGAAGCACCTCGCCCGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 1.0 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.1 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7375 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.9 0.0 0.0 0.0 0.0 130-131 5.2375 0.0 0.0 0.0 0.0 132-133 5.65 0.0 0.0 0.0 0.0 134-135 6.15 0.0 0.0 0.0 0.0 136-137 6.65 0.0 0.0 0.0 0.0 138-139 7.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814859 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814859_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3275 37.0 37.0 37.0 37.0 37.0 2 35.9995 37.0 37.0 37.0 37.0 37.0 3 35.948 37.0 37.0 37.0 37.0 37.0 4 35.8955 37.0 37.0 37.0 37.0 37.0 5 36.0565 37.0 37.0 37.0 37.0 37.0 6 35.9005 37.0 37.0 37.0 37.0 37.0 7 35.9465 37.0 37.0 37.0 37.0 37.0 8 36.12 37.0 37.0 37.0 37.0 37.0 9 36.0465 37.0 37.0 37.0 37.0 37.0 10-14 36.037699999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.9605 37.0 37.0 37.0 37.0 37.0 20-24 35.957499999999996 37.0 37.0 37.0 37.0 37.0 25-29 35.868300000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.9584 37.0 37.0 37.0 37.0 37.0 35-39 35.8514 37.0 37.0 37.0 37.0 37.0 40-44 35.8917 37.0 37.0 37.0 37.0 37.0 45-49 35.8053 37.0 37.0 37.0 37.0 37.0 50-54 35.841300000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.7395 37.0 37.0 37.0 37.0 37.0 60-64 35.6806 37.0 37.0 37.0 37.0 37.0 65-69 35.651199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.716899999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.6569 37.0 37.0 37.0 37.0 37.0 80-84 35.5735 37.0 37.0 37.0 37.0 37.0 85-89 35.5432 37.0 37.0 37.0 37.0 37.0 90-94 35.5679 37.0 37.0 37.0 37.0 37.0 95-99 35.578700000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.5202 37.0 37.0 37.0 37.0 37.0 105-109 35.4697 37.0 37.0 37.0 37.0 37.0 110-114 35.3629 37.0 37.0 37.0 37.0 37.0 115-119 35.3636 37.0 37.0 37.0 37.0 37.0 120-124 35.291999999999994 37.0 37.0 37.0 32.2 37.0 125-129 35.2545 37.0 37.0 37.0 32.2 37.0 130-134 35.2289 37.0 37.0 37.0 27.4 37.0 135-139 35.0874 37.0 37.0 37.0 27.4 37.0 140-144 34.911199999999994 37.0 37.0 37.0 25.0 37.0 145-149 34.8735 37.0 37.0 37.0 25.0 37.0 150-151 34.03375 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 6.0 15 5.0 16 2.0 17 2.0 18 0.0 19 3.0 20 6.0 21 9.0 22 11.0 23 16.0 24 12.0 25 17.0 26 12.0 27 12.0 28 14.0 29 22.0 30 35.0 31 50.0 32 75.0 33 126.0 34 221.0 35 627.0 36 2507.0 37 209.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.375 19.2 7.449999999999999 30.975 2 30.275000000000002 23.400000000000002 26.450000000000003 19.875 3 26.125 23.400000000000002 24.5 25.974999999999998 4 28.425 29.299999999999997 18.5 23.775 5 28.325 33.0 17.45 21.224999999999998 6 23.875 34.65 19.125 22.35 7 24.05 18.099999999999998 32.15 25.7 8 23.425 22.075 22.95 31.55 9 24.875 21.85 25.25 28.025 10-14 27.0 25.41 21.17 26.419999999999998 15-19 26.615 24.565 22.62 26.200000000000003 20-24 26.3 24.58 23.44 25.679999999999996 25-29 26.695 24.635 22.814999999999998 25.855 30-34 26.715 24.709999999999997 22.775000000000002 25.8 35-39 26.1 24.905 23.16 25.835 40-44 27.439999999999998 24.54 22.39 25.629999999999995 45-49 26.455000000000002 24.349999999999998 23.305 25.89 50-54 26.834999999999997 23.395 23.494999999999997 26.275 55-59 26.615 24.25 23.44 25.695 60-64 26.529999999999998 24.060000000000002 23.849999999999998 25.56 65-69 26.05 24.224999999999998 23.365 26.36 70-74 27.065 23.82 23.415 25.7 75-79 26.75 24.19 23.255 25.805 80-84 25.775 24.68 23.595 25.95 85-89 26.924999999999997 24.51 22.884999999999998 25.679999999999996 90-94 27.034999999999997 24.535 23.165 25.264999999999997 95-99 26.995 24.685000000000002 23.11 25.21 100-104 27.034999999999997 24.915000000000003 23.055 24.995 105-109 27.560000000000002 24.365000000000002 23.215 24.86 110-114 26.68 24.55 23.425 25.345000000000002 115-119 26.985 24.815 22.435 25.765 120-124 27.025 25.045 23.22 24.709999999999997 125-129 27.455000000000002 24.605 22.825 25.115 130-134 28.025 24.91 22.595000000000002 24.47 135-139 27.744999999999997 24.93 23.205000000000002 24.12 140-144 28.28 24.959999999999997 22.89 23.87 145-149 27.544999999999998 25.724999999999998 22.725 24.005000000000003 150-151 28.1875 24.375 23.1 24.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 1.5 14 1.0 15 1.0 16 2.0 17 1.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 2.5 28 5.0 29 7.0 30 5.0 31 3.5 32 9.5 33 18.0 34 19.0 35 24.5 36 39.0 37 43.5 38 51.0 39 77.5 40 93.0 41 111.5 42 130.0 43 133.5 44 144.5 45 155.5 46 150.5 47 142.0 48 155.0 49 157.5 50 133.5 51 116.0 52 126.0 53 128.0 54 114.5 55 114.5 56 110.0 57 99.0 58 100.0 59 93.0 60 89.0 61 95.0 62 94.0 63 88.0 64 85.5 65 78.0 66 75.5 67 86.5 68 88.0 69 77.5 70 60.5 71 52.0 72 48.0 73 39.5 74 31.5 75 26.5 76 18.5 77 11.5 78 10.0 79 7.0 80 2.5 81 1.0 82 0.0 83 0.5 84 0.5 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.85792349726776 84.05 2 7.377049180327869 13.5 3 0.5737704918032787 1.575 4 0.08196721311475409 0.3 5 0.0546448087431694 0.25 6 0.0273224043715847 0.15 7 0.0273224043715847 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 6 0.15 No Hit CAAGTGCCCAGGAGATCAAGACGGTGGAGGACGCAGCAAATCTTATCGAT 5 0.125 No Hit GTGAGGCTCTGGTCGTCGAGTTCCCGAGTCCACTGCAGCCCACGTTGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9875 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 2.1 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.75 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.449999999999999 0.0 0.0 0.0 0.0 128-129 4.9125 0.0 0.0 0.0 0.0 130-131 5.2125 0.0 0.0 0.0 0.0 132-133 5.612500000000001 0.0 0.0 0.0 0.0 134-135 6.1 0.0 0.0 0.0 0.0 136-137 6.6 0.0 0.0 0.0 0.0125 138-139 7.1375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTCA 10 0.006830828 145.0 4 >>END_MODULE Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681915 spots for SRR7814859.sra Written 2681915 spots for SRR7814859.sra Read 2681922 spots for SRR7814859.sra Written 2681922 spots for SRR7814859.sra SRR ids: ['SRR7814859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2xpe0vn8 SRR7814859.sra spots: 53638307 blocks: [[1, 2681915], [2681916, 5363830], [5363831, 8045745], [8045746, 10727660], [10727661, 13409575], [13409576, 16091490], [16091491, 18773405], [18773406, 21455320], [21455321, 24137235], [24137236, 26819150], [26819151, 29501065], [29501066, 32182980], [32182981, 34864895], [34864896, 37546810], [37546811, 40228725], [40228726, 42910640], [42910641, 45592555], [45592556, 48274470], [48274471, 50956385], [50956386, 53638307]] SRR7814859 file size 18154561 SRR7814859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814859 SRR7814859_1.fastq SRR7814859_2.fastq Input file: SRR7814859_1.fastq Paired file: SRR7814859_2.fastq trimmed: SRR7814859-trimmed-pair1.fastq, SRR7814859-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 12:55:03 2024 >> started Fri Dec 6 12:56:03 2024 >> done (60.055s) 53638307 read pairs processed; of these: 289 ( 0.00%) short read pairs filtered out after trimming by size control 5372 ( 0.01%) empty read pairs filtered out after trimming by size control 53632646 (99.99%) read pairs available; of these: 5523717 (10.30%) trimmed read pairs available after processing 48108929 (89.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 20 0.00% 20 21 0.00% 21 18 0.00% 22 21 0.00% 23 22 0.00% 24 39 0.00% 25 26 0.00% 26 39 0.00% 27 43 0.00% 28 55 0.00% 29 44 0.00% 30 59 0.00% 31 55 0.00% 32 56 0.00% 33 72 0.00% 34 55 0.00% 35 72 0.00% 36 81 0.00% 37 86 0.00% 38 84 0.00% 39 98 0.00% 40 105 0.00% 41 100 0.00% 42 117 0.00% 43 119 0.00% 44 113 0.00% 45 105 0.00% 46 144 0.00% 47 153 0.00% 48 188 0.00% 49 223 0.00% 50 260 0.00% 51 258 0.00% 52 305 0.00% 53 332 0.00% 54 325 0.00% 55 320 0.00% 56 365 0.00% 57 425 0.00% 58 446 0.00% 59 561 0.00% 60 685 0.00% 61 803 0.00% 62 822 0.00% 63 928 0.00% 64 994 0.00% 65 1073 0.00% 66 1154 0.00% 67 1381 0.00% 68 1628 0.00% 69 1790 0.00% 70 2116 0.00% 71 2314 0.00% 72 2742 0.01% 73 3054 0.01% 74 3346 0.01% 75 3764 0.01% 76 4285 0.01% 77 4618 0.01% 78 5090 0.01% 79 5905 0.01% 80 6482 0.01% 81 7312 0.01% 82 8454 0.02% 83 9358 0.02% 84 10470 0.02% 85 11237 0.02% 86 12844 0.02% 87 14045 0.03% 88 15062 0.03% 89 16061 0.03% 90 17816 0.03% 91 19860 0.04% 92 21459 0.04% 93 23550 0.04% 94 25779 0.05% 95 27652 0.05% 96 29422 0.05% 97 31679 0.06% 98 33110 0.06% 99 35444 0.07% 100 37728 0.07% 101 40096 0.07% 102 42104 0.08% 103 45589 0.09% 104 47181 0.09% 105 49372 0.09% 106 53203 0.10% 107 54863 0.10% 108 57145 0.11% 109 59468 0.11% 110 61349 0.11% 111 63915 0.12% 112 67624 0.13% 113 69789 0.13% 114 72865 0.14% 115 76188 0.14% 116 78522 0.15% 117 80736 0.15% 118 82275 0.15% 119 84308 0.16% 120 87255 0.16% 121 89578 0.17% 122 91502 0.17% 123 95402 0.18% 124 99223 0.19% 125 100926 0.19% 126 103573 0.19% 127 106970 0.20% 128 107620 0.20% 129 110896 0.21% 130 112077 0.21% 131 113973 0.21% 132 118002 0.22% 133 120628 0.22% 134 122253 0.23% 135 125985 0.23% 136 128867 0.24% 137 129890 0.24% 138 132022 0.25% 139 134930 0.25% 140 136076 0.25% 141 137374 0.26% 142 142554 0.27% 143 143388 0.27% 144 147840 0.28% 145 150180 0.28% 146 150943 0.28% 147 153516 0.29% 148 156605 0.29% 149 158177 0.29% 150 159537 0.30% 151 48108929 89.70% 53632646 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.70 fanout-score-rank=9 prefix-density=0.70 prefix-fanout=3.4 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=17.11 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=3.4 sequence=AGCATGGCCCACCTGCAGTGGATCACCTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=4.00 fanout-score-rank=12 prefix-density=0.66 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.18 sequence-density-rank=14 fanout-score=87.57 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=19.0 sequence=CAAGAAGAAGGT SRR7814859 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 12:56:47 Started mapping on | Dec 06 12:56:47 Finished on | Dec 06 13:02:34 Mapping speed, Million of reads per hour | 556.42 Number of input reads | 53632646 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 50544420 Uniquely mapped reads % | 94.24% Average mapped length | 295.87 Number of splices: Total | 48967621 Number of splices: Annotated (sjdb) | 46314874 Number of splices: GT/AG | 48295544 Number of splices: GC/AG | 540107 Number of splices: AT/AC | 26745 Number of splices: Non-canonical | 105225 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 3.08 Insertion rate per base | 0.02% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 875384 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 70039 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.17% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2212842 2212842 2212842 N_multimapping 875384 875384 875384 N_noFeature 1519119 49254621 1901685 N_ambiguous 1096894 7157 191171 UnstrandedReadsAssigned:47928407 PositiveStrandReadsAssigned:1282642 NegativeStrandReadsAssigned:48451564 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814859 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814859-trimmed-pair1.fastq SRR7814859-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 53,632,646 reads, 49,010,704 reads pseudoaligned [quant] estimated average fragment length: 262.296 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52973 SRR7814859.ke.tsv 35125 SRR7814859.se.tsv 88098 total ==> SRR7814859.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.133 0 0 PNS24247 1044 782.704 104.834 3.71635 PNS24249 1928 1666.7 247.219 4.11561 PNS24246 1044 782.704 104.834 3.71635 PNS24248 1044 782.704 104.834 3.71635 PNS24244 1471 1209.7 164.278 3.76801 PNS24243 293 94.5348 2 0.587014 KQK14069 1603 1341.7 11705.9 242.08 KQK14071 474 235.203 142.718 16.8362 ==> SRR7814859.se.tsv <== BRADI_1g14170v3 12468 BRADI_1g53295v3 5833 BRADI_1g59795v3 193 BRADI_1g07683v3 0 BRADI_1g00485v3 140 BRADI_1g20270v3 8146 BRADI_1g74790v3 352 BRADI_1g09890v3 39 BRADI_1g77505v3 692 BRADI_1g48960v3 0 SRR7814859 completed mapping pipeline successfully