Starting /dee2/code/volunteer_pipeline.sh SRR7814860 current disk space = 1551130447872 free memory = 1604618604 SRR7814860 SRAfilesize fbc8f3c334bb4be7eb3398d6cb49abb7 SRR7814860.sra SRR7814860.sra file validated SRR7814860 is paired end SRR7814860 is conventional basespace SRR7814860 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2465 37.0 37.0 37.0 37.0 37.0 2 36.1345 37.0 37.0 37.0 37.0 37.0 3 36.304 37.0 37.0 37.0 37.0 37.0 4 36.4 37.0 37.0 37.0 37.0 37.0 5 36.4285 37.0 37.0 37.0 37.0 37.0 6 36.4215 37.0 37.0 37.0 37.0 37.0 7 36.3765 37.0 37.0 37.0 37.0 37.0 8 36.4295 37.0 37.0 37.0 37.0 37.0 9 36.5495 37.0 37.0 37.0 37.0 37.0 10-14 36.489999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.496 37.0 37.0 37.0 37.0 37.0 20-24 36.4251 37.0 37.0 37.0 37.0 37.0 25-29 36.4054 37.0 37.0 37.0 37.0 37.0 30-34 36.3341 37.0 37.0 37.0 37.0 37.0 35-39 36.3451 37.0 37.0 37.0 37.0 37.0 40-44 36.313 37.0 37.0 37.0 37.0 37.0 45-49 36.2733 37.0 37.0 37.0 37.0 37.0 50-54 36.19590000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.1493 37.0 37.0 37.0 37.0 37.0 60-64 36.2104 37.0 37.0 37.0 37.0 37.0 65-69 36.120099999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.090999999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0319 37.0 37.0 37.0 37.0 37.0 80-84 36.106100000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.9703 37.0 37.0 37.0 37.0 37.0 90-94 35.9363 37.0 37.0 37.0 37.0 37.0 95-99 35.8446 37.0 37.0 37.0 37.0 37.0 100-104 35.8138 37.0 37.0 37.0 37.0 37.0 105-109 35.8446 37.0 37.0 37.0 37.0 37.0 110-114 35.8339 37.0 37.0 37.0 37.0 37.0 115-119 35.636 37.0 37.0 37.0 37.0 37.0 120-124 35.5688 37.0 37.0 37.0 37.0 37.0 125-129 35.4815 37.0 37.0 37.0 37.0 37.0 130-134 35.4313 37.0 37.0 37.0 37.0 37.0 135-139 35.3719 37.0 37.0 37.0 37.0 37.0 140-144 35.2555 37.0 37.0 37.0 32.2 37.0 145-149 35.034 37.0 37.0 37.0 25.0 37.0 150-151 34.335750000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 0.0 23 4.0 24 6.0 25 6.0 26 7.0 27 26.0 28 18.0 29 24.0 30 40.0 31 54.0 32 88.0 33 103.0 34 183.0 35 366.0 36 2767.0 37 307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.39036628198696 10.68740592072253 5.042649272453588 29.87957852483693 2 26.525 11.875 30.15 31.45 3 23.425 16.525000000000002 24.75 35.3 4 29.575000000000003 23.65 20.05 26.724999999999998 5 29.15 28.1 21.675 21.075 6 24.224999999999998 30.825000000000003 21.375 23.575 7 20.325 21.55 37.425000000000004 20.7 8 20.424999999999997 21.099999999999998 27.800000000000004 30.675 9 21.15 19.825 31.474999999999998 27.55 10-14 25.490000000000002 23.69 23.955000000000002 26.865 15-19 25.669999999999998 23.52 24.03 26.779999999999998 20-24 25.94 23.455000000000002 23.825 26.779999999999998 25-29 25.525 23.16 23.974999999999998 27.339999999999996 30-34 25.465 23.21 24.195 27.13 35-39 25.5 23.48 24.335 26.685 40-44 25.779999999999998 22.495 23.91 27.815 45-49 25.88 23.44 22.994999999999997 27.685 50-54 25.629999999999995 23.645 23.49 27.235 55-59 26.125 23.59 22.939999999999998 27.345000000000002 60-64 25.995 23.52 22.830000000000002 27.655 65-69 26.39 22.705000000000002 23.755000000000003 27.150000000000002 70-74 26.05 22.99 23.630000000000003 27.33 75-79 26.66 22.445 23.294999999999998 27.6 80-84 27.24 23.515 22.665 26.58 85-89 26.584999999999997 23.185 22.715 27.515 90-94 27.065 22.759999999999998 22.79 27.384999999999998 95-99 27.255000000000003 22.365 22.99 27.389999999999997 100-104 27.04 23.335 22.84 26.784999999999997 105-109 27.065 22.58 23.275000000000002 27.08 110-114 27.185 22.935 22.675 27.205000000000002 115-119 27.305 22.725 22.795 27.175 120-124 27.295 23.0 23.075000000000003 26.63 125-129 27.305 22.615 22.455 27.625 130-134 27.77 22.939999999999998 22.650000000000002 26.640000000000004 135-139 27.165 22.759999999999998 22.8 27.275 140-144 27.315 23.04 22.405 27.24 145-149 27.155 23.135 22.27 27.439999999999998 150-151 28.249999999999996 22.537499999999998 21.55 27.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.0 27 1.0 28 2.0 29 3.0 30 3.5 31 4.5 32 5.5 33 15.5 34 24.5 35 27.0 36 38.5 37 55.5 38 61.5 39 62.5 40 83.5 41 106.5 42 123.0 43 132.5 44 118.0 45 123.5 46 146.5 47 144.5 48 147.5 49 149.5 50 140.0 51 127.0 52 106.0 53 102.0 54 105.5 55 92.5 56 93.0 57 108.0 58 106.0 59 102.5 60 109.5 61 116.0 62 113.5 63 93.0 64 88.0 65 100.0 66 97.0 67 90.0 68 82.5 69 77.5 70 74.5 71 73.0 72 54.5 73 43.5 74 38.5 75 19.5 76 15.5 77 13.5 78 13.0 79 9.5 80 5.5 81 4.0 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.53528773072746 85.225 2 6.487513572204126 11.95 3 0.8686210640608035 2.4 4 0.08143322475570033 0.3 5 0.02714440825190011 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTCGATCGGCCACACCTGCATGCAGCTGATCCTTCCGCCGTTGCTGACG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.55 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.425 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.7249999999999996 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.7375 0.0 0.0 0.0 0.0 120-121 4.262499999999999 0.0 0.0 0.0 0.0 122-123 4.6375 0.0 0.0 0.0 0.0 124-125 5.2375 0.0 0.0 0.0 0.0 126-127 5.7125 0.0 0.0 0.0 0.0 128-129 6.05 0.0 0.0 0.0 0.0 130-131 6.425000000000001 0.0 0.0 0.0 0.0 132-133 6.9375 0.0 0.0 0.0 0.0 134-135 7.5375 0.0 0.0 0.0 0.0 136-137 8.125 0.0 0.0 0.0 0.0 138-139 8.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATGA 10 0.006830828 145.0 7 >>END_MODULE SRR7814860 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.244 37.0 37.0 37.0 37.0 37.0 2 35.969 37.0 37.0 37.0 37.0 37.0 3 35.976 37.0 37.0 37.0 37.0 37.0 4 36.0105 37.0 37.0 37.0 37.0 37.0 5 36.1495 37.0 37.0 37.0 37.0 37.0 6 36.1175 37.0 37.0 37.0 37.0 37.0 7 36.058 37.0 37.0 37.0 37.0 37.0 8 36.0855 37.0 37.0 37.0 37.0 37.0 9 36.104 37.0 37.0 37.0 37.0 37.0 10-14 36.0169 37.0 37.0 37.0 37.0 37.0 15-19 35.9781 37.0 37.0 37.0 37.0 37.0 20-24 35.9631 37.0 37.0 37.0 37.0 37.0 25-29 35.951800000000006 37.0 37.0 37.0 37.0 37.0 30-34 35.852199999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.80800000000001 37.0 37.0 37.0 37.0 37.0 40-44 35.7821 37.0 37.0 37.0 37.0 37.0 45-49 35.727000000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.75750000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.7759 37.0 37.0 37.0 37.0 37.0 60-64 35.6037 37.0 37.0 37.0 37.0 37.0 65-69 35.542100000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.50750000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.5591 37.0 37.0 37.0 37.0 37.0 80-84 35.46020000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.3682 37.0 37.0 37.0 37.0 37.0 90-94 35.2902 37.0 37.0 37.0 34.6 37.0 95-99 35.162400000000005 37.0 37.0 37.0 27.4 37.0 100-104 35.137299999999996 37.0 37.0 37.0 27.4 37.0 105-109 35.006600000000006 37.0 37.0 37.0 25.0 37.0 110-114 34.923500000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.818 37.0 37.0 37.0 25.0 37.0 120-124 34.71909999999999 37.0 37.0 37.0 25.0 37.0 125-129 34.6346 37.0 37.0 37.0 25.0 37.0 130-134 34.469899999999996 37.0 37.0 37.0 25.0 37.0 135-139 34.163599999999995 37.0 37.0 37.0 25.0 37.0 140-144 34.0043 37.0 37.0 37.0 25.0 37.0 145-149 33.89639999999999 37.0 37.0 37.0 25.0 37.0 150-151 33.1715 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 6.0 14 1.0 15 5.0 16 0.0 17 3.0 18 4.0 19 5.0 20 5.0 21 8.0 22 7.0 23 11.0 24 16.0 25 12.0 26 12.0 27 24.0 28 23.0 29 33.0 30 32.0 31 65.0 32 98.0 33 175.0 34 318.0 35 836.0 36 2212.0 37 88.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.55 19.075 5.925 27.450000000000003 2 28.275 22.125 25.35 24.25 3 24.575 22.825 26.025 26.575 4 28.549999999999997 30.225 17.424999999999997 23.799999999999997 5 28.825 31.724999999999998 17.299999999999997 22.15 6 24.05 34.725 17.9 23.325000000000003 7 25.25 18.15 30.65 25.95 8 23.275000000000002 21.425 23.5 31.8 9 24.9 20.775 24.175 30.15 10-14 27.595 24.545 20.46 27.400000000000002 15-19 27.725 22.915 21.975 27.384999999999998 20-24 27.33 24.26 21.255 27.155 25-29 26.915 24.154999999999998 21.565 27.365000000000002 30-34 26.950000000000003 23.345 21.7 28.005000000000003 35-39 27.169999999999998 23.72 21.93 27.18 40-44 26.775 22.939999999999998 22.0 28.285 45-49 27.595 22.59 21.68 28.134999999999998 50-54 26.965 23.185 22.11 27.74 55-59 27.6 22.785 21.65 27.965 60-64 27.415 22.34 21.925 28.32 65-69 27.215 23.315 21.455 28.015 70-74 27.384999999999998 22.264999999999997 22.220000000000002 28.13 75-79 27.589999999999996 22.18 22.17 28.060000000000002 80-84 27.689999999999998 22.61 21.685 28.015 85-89 27.87 22.53 21.349999999999998 28.249999999999996 90-94 27.58 22.48 21.825 28.115000000000002 95-99 27.389999999999997 22.830000000000002 21.91 27.87 100-104 27.925 23.05 21.44 27.584999999999997 105-109 27.98 22.645 21.759999999999998 27.615000000000002 110-114 28.57 23.385 20.86 27.185 115-119 28.494999999999997 23.169999999999998 21.295 27.04 120-124 29.09 23.455000000000002 20.845 26.61 125-129 28.88 23.615 21.115000000000002 26.39 130-134 29.395 23.445 20.705000000000002 26.455000000000002 135-139 29.770000000000003 23.185 21.47 25.575 140-144 29.78 23.29 21.47 25.46 145-149 30.409999999999997 23.150000000000002 21.490000000000002 24.95 150-151 30.6875 23.35 21.099999999999998 24.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 2.0 27 4.5 28 6.0 29 5.5 30 2.5 31 3.0 32 6.0 33 10.0 34 15.0 35 18.5 36 23.5 37 27.5 38 35.0 39 50.0 40 65.5 41 82.0 42 106.5 43 120.0 44 106.0 45 120.5 46 133.0 47 124.5 48 132.5 49 121.0 50 118.5 51 111.5 52 103.5 53 105.5 54 112.5 55 110.0 56 93.0 57 98.0 58 119.0 59 129.0 60 131.5 61 133.0 62 135.5 63 130.0 64 109.0 65 103.0 66 99.5 67 98.5 68 96.0 69 98.5 70 92.5 71 72.5 72 63.0 73 51.0 74 39.5 75 33.5 76 23.5 77 14.5 78 13.0 79 8.5 80 4.0 81 3.5 82 1.5 83 0.5 84 0.5 85 1.5 86 1.0 87 0.0 88 0.0 89 0.0 90 0.5 91 1.5 92 1.0 93 0.0 94 0.5 95 1.5 96 1.5 97 0.5 98 1.0 99 1.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 92.66030013642565 84.89999999999999 2 6.2755798090040935 11.5 3 0.7366984993178717 2.025 4 0.21828103683492497 0.8 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.027285129604365622 0.17500000000000002 8 0.0 0.0 9 0.027285129604365622 0.22499999999999998 >10 0.027285129604365622 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 10 0.25 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 7 0.17500000000000002 No Hit GAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0125 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.037500000000000006 0.0 0.025 0.0 0.0 74-75 0.0625 0.0 0.025 0.0 0.0 76-77 0.1125 0.0 0.025 0.0 0.0 78-79 0.15 0.0 0.025 0.0 0.0 80-81 0.15 0.0 0.025 0.0 0.0 82-83 0.175 0.0 0.025 0.0 0.0 84-85 0.2625 0.0 0.025 0.0 0.0 86-87 0.325 0.0 0.025 0.0 0.0 88-89 0.3625 0.0 0.025 0.0 0.0 90-91 0.4125 0.0 0.025 0.0 0.0 92-93 0.55 0.0 0.025 0.0 0.0 94-95 0.6375 0.0 0.025 0.0 0.0 96-97 0.75 0.0 0.025 0.0 0.0 98-99 0.9375 0.0 0.025 0.0 0.0 100-101 1.1625 0.0 0.025 0.0 0.0 102-103 1.3875000000000002 0.0 0.025 0.0 0.0 104-105 1.6 0.0 0.025 0.0 0.0 106-107 1.8624999999999998 0.0 0.025 0.0 0.0 108-109 2.0999999999999996 0.0 0.025 0.0 0.0 110-111 2.3875 0.0 0.025 0.0 0.0 112-113 2.675 0.0 0.025 0.0 0.0 114-115 2.9625000000000004 0.0 0.025 0.0 0.0 116-117 3.375 0.0 0.025 0.0 0.0 118-119 3.7625 0.0 0.025 0.0 0.0 120-121 4.262499999999999 0.0 0.025 0.0 0.0 122-123 4.6375 0.0 0.025 0.0 0.0 124-125 5.2125 0.0 0.025 0.0 0.0 126-127 5.65 0.0 0.025 0.0 0.0 128-129 5.975 0.0 0.025 0.0 0.0 130-131 6.375 0.0 0.025 0.0 0.0 132-133 6.875 0.0 0.025 0.0 0.0 134-135 7.45 0.0 0.025 0.0 0.0 136-137 8.0125 0.0 0.025 0.0 0.0 138-139 8.475 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACACC 10 0.006830828 145.0 9 >>END_MODULE Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262724 spots for SRR7814860.sra Written 2262724 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra Read 2262713 spots for SRR7814860.sra Written 2262713 spots for SRR7814860.sra SRR ids: ['SRR7814860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_locg1hpu SRR7814860.sra spots: 45254271 blocks: [[1, 2262713], [2262714, 4525426], [4525427, 6788139], [6788140, 9050852], [9050853, 11313565], [11313566, 13576278], [13576279, 15838991], [15838992, 18101704], [18101705, 20364417], [20364418, 22627130], [22627131, 24889843], [24889844, 27152556], [27152557, 29415269], [29415270, 31677982], [31677983, 33940695], [33940696, 36203408], [36203409, 38466121], [38466122, 40728834], [40728835, 42991547], [42991548, 45254271]] SRR7814860 file size 15313487 SRR7814860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814860 SRR7814860_1.fastq SRR7814860_2.fastq Input file: SRR7814860_1.fastq Paired file: SRR7814860_2.fastq trimmed: SRR7814860-trimmed-pair1.fastq, SRR7814860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:02:26 2024 >> started Fri Dec 6 13:03:27 2024 >> done (60.960s) 45254271 read pairs processed; of these: 447 ( 0.00%) short read pairs filtered out after trimming by size control 32452 ( 0.07%) empty read pairs filtered out after trimming by size control 45221372 (99.93%) read pairs available; of these: 6084275 (13.45%) trimmed read pairs available after processing 39137097 (86.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 34 0.00% 19 36 0.00% 20 44 0.00% 21 50 0.00% 22 60 0.00% 23 57 0.00% 24 59 0.00% 25 61 0.00% 26 71 0.00% 27 67 0.00% 28 73 0.00% 29 87 0.00% 30 87 0.00% 31 87 0.00% 32 108 0.00% 33 103 0.00% 34 113 0.00% 35 110 0.00% 36 102 0.00% 37 129 0.00% 38 135 0.00% 39 131 0.00% 40 145 0.00% 41 178 0.00% 42 160 0.00% 43 187 0.00% 44 178 0.00% 45 169 0.00% 46 196 0.00% 47 240 0.00% 48 234 0.00% 49 286 0.00% 50 308 0.00% 51 348 0.00% 52 386 0.00% 53 380 0.00% 54 452 0.00% 55 508 0.00% 56 526 0.00% 57 608 0.00% 58 684 0.00% 59 804 0.00% 60 972 0.00% 61 1003 0.00% 62 1156 0.00% 63 1297 0.00% 64 1397 0.00% 65 1552 0.00% 66 1764 0.00% 67 1931 0.00% 68 2188 0.00% 69 2563 0.01% 70 2821 0.01% 71 3280 0.01% 72 3793 0.01% 73 4411 0.01% 74 4675 0.01% 75 5387 0.01% 76 5777 0.01% 77 6603 0.01% 78 7280 0.02% 79 8306 0.02% 80 9242 0.02% 81 10458 0.02% 82 11858 0.03% 83 12925 0.03% 84 14044 0.03% 85 15269 0.03% 86 16596 0.04% 87 18213 0.04% 88 19572 0.04% 89 21082 0.05% 90 23452 0.05% 91 25945 0.06% 92 27662 0.06% 93 30442 0.07% 94 32868 0.07% 95 34656 0.08% 96 36816 0.08% 97 39279 0.09% 98 40763 0.09% 99 43142 0.10% 100 45964 0.10% 101 48720 0.11% 102 50932 0.11% 103 54459 0.12% 104 56938 0.13% 105 58960 0.13% 106 62516 0.14% 107 63858 0.14% 108 65968 0.15% 109 68888 0.15% 110 71465 0.16% 111 74113 0.16% 112 77151 0.17% 113 80156 0.18% 114 83744 0.19% 115 87441 0.19% 116 88496 0.20% 117 91772 0.20% 118 91441 0.20% 119 94320 0.21% 120 96977 0.21% 121 98468 0.22% 122 100980 0.22% 123 105303 0.23% 124 108210 0.24% 125 111484 0.25% 126 113804 0.25% 127 114940 0.25% 128 116639 0.26% 129 120083 0.27% 130 121039 0.27% 131 122877 0.27% 132 127594 0.28% 133 130529 0.29% 134 131997 0.29% 135 135416 0.30% 136 134387 0.30% 137 135792 0.30% 138 138212 0.31% 139 141558 0.31% 140 142238 0.31% 141 145269 0.32% 142 148025 0.33% 143 150033 0.33% 144 155581 0.34% 145 156997 0.35% 146 157092 0.35% 147 160071 0.35% 148 160504 0.35% 149 160417 0.35% 150 163236 0.36% 151 39137097 86.55% 45221372 reads passed initial QC criterion=sequence-density sequence-density=1.64 sequence-density-rank=1 fanout-score=2.74 fanout-score-rank=23 prefix-density=1.71 prefix-fanout=2.6 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=96.57 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.4 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=1.27 sequence-density-rank=1 fanout-score=3.29 fanout-score-rank=12 prefix-density=1.40 prefix-fanout=3.0 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=44.65 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=4.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7814860 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:04:06 Started mapping on | Dec 06 13:04:07 Finished on | Dec 06 13:09:21 Mapping speed, Million of reads per hour | 518.46 Number of input reads | 45221372 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 42501112 Uniquely mapped reads % | 93.98% Average mapped length | 293.78 Number of splices: Total | 40784432 Number of splices: Annotated (sjdb) | 38794119 Number of splices: GT/AG | 40231644 Number of splices: GC/AG | 464962 Number of splices: AT/AC | 9505 Number of splices: Non-canonical | 78321 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 3.01 Insertion rate per base | 0.02% Insertion average length | 2.57 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 617670 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 80701 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.52% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2102590 2102590 2102590 N_multimapping 617670 617670 617670 N_noFeature 1062331 41153964 1352048 N_ambiguous 1343077 4310 287972 UnstrandedReadsAssigned:40095704 PositiveStrandReadsAssigned:1342838 NegativeStrandReadsAssigned:40861092 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814860-trimmed-pair1.fastq SRR7814860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,221,372 reads, 41,304,883 reads pseudoaligned [quant] estimated average fragment length: 249.523 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 SRR7814860.ke.tsv 35125 SRR7814860.se.tsv 88098 total ==> SRR7814860.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.844 0 0 PNS24247 1044 795.477 32.0542 1.19196 PNS24249 1928 1679.48 124.593 2.19444 PNS24246 1044 795.477 32.0542 1.19196 PNS24248 1044 795.477 32.0542 1.19196 PNS24244 1471 1222.48 69.2442 1.67551 PNS24243 293 99.9433 1 0.295971 KQK14069 1603 1354.48 1510.09 32.9787 KQK14071 474 243.531 20.5682 2.49831 ==> SRR7814860.se.tsv <== BRADI_1g14170v3 1614 BRADI_1g53295v3 1385 BRADI_1g59795v3 275 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 459 BRADI_1g74790v3 225 BRADI_1g09890v3 1 BRADI_1g77505v3 445 BRADI_1g48960v3 0 SRR7814860 completed mapping pipeline successfully