Starting /dee2/code/volunteer_pipeline.sh SRR7814861 current disk space = 1551165054976 free memory = 1601453916 SRR7814861 SRAfilesize 92fc65b8e9ba915c602b0d7fe8c962cb SRR7814861.sra SRR7814861.sra file validated SRR7814861 is paired end SRR7814861 is conventional basespace SRR7814861 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.42525 37.0 37.0 37.0 37.0 37.0 2 36.4 37.0 37.0 37.0 37.0 37.0 3 36.59 37.0 37.0 37.0 37.0 37.0 4 36.542 37.0 37.0 37.0 37.0 37.0 5 36.596 37.0 37.0 37.0 37.0 37.0 6 36.5835 37.0 37.0 37.0 37.0 37.0 7 36.516 37.0 37.0 37.0 37.0 37.0 8 36.5525 37.0 37.0 37.0 37.0 37.0 9 36.5855 37.0 37.0 37.0 37.0 37.0 10-14 36.58540000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.58 37.0 37.0 37.0 37.0 37.0 20-24 36.5103 37.0 37.0 37.0 37.0 37.0 25-29 36.4687 37.0 37.0 37.0 37.0 37.0 30-34 36.34939999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.2746 37.0 37.0 37.0 37.0 37.0 40-44 36.23100000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.32 37.0 37.0 37.0 37.0 37.0 50-54 36.38590000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.3184 37.0 37.0 37.0 37.0 37.0 60-64 36.3189 37.0 37.0 37.0 37.0 37.0 65-69 36.2912 37.0 37.0 37.0 37.0 37.0 70-74 36.1706 37.0 37.0 37.0 37.0 37.0 75-79 36.15339999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.1127 37.0 37.0 37.0 37.0 37.0 85-89 36.12820000000001 37.0 37.0 37.0 37.0 37.0 90-94 36.044799999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.736900000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.535999999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.7082 37.0 37.0 37.0 37.0 37.0 110-114 35.764199999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.581399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.0418 37.0 37.0 37.0 27.4 37.0 125-129 34.822 37.0 37.0 37.0 25.0 37.0 130-134 35.293499999999995 37.0 37.0 37.0 32.2 37.0 135-139 35.117599999999996 37.0 37.0 37.0 27.4 37.0 140-144 35.230000000000004 37.0 37.0 37.0 29.8 37.0 145-149 35.1419 37.0 37.0 37.0 27.4 37.0 150-151 34.395250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 1.0 25 5.0 26 4.0 27 10.0 28 15.0 29 29.0 30 26.0 31 46.0 32 68.0 33 123.0 34 245.0 35 558.0 36 2656.0 37 210.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.534201954397396 10.749185667752444 5.56251566023553 35.15409671761463 2 25.7 13.325000000000001 31.324999999999996 29.65 3 23.575 18.05 23.799999999999997 34.575 4 28.7 23.875 20.9 26.525 5 27.250000000000004 29.15 22.725 20.875 6 22.85 31.574999999999996 22.475 23.1 7 18.35 23.925 38.425 19.3 8 19.5 22.2 29.575000000000003 28.725 9 19.325 20.474999999999998 33.175 27.025 10-14 23.605 26.840000000000003 24.349999999999998 25.205 15-19 23.494999999999997 24.64 25.814999999999998 26.05 20-24 23.830000000000002 25.185000000000002 24.91 26.075 25-29 23.595 25.22 24.955 26.229999999999997 30-34 24.01 24.555 24.88 26.555 35-39 23.919999999999998 24.89 25.230000000000004 25.96 40-44 23.95 25.115 24.425 26.51 45-49 23.635 24.935 24.495 26.935 50-54 24.01 24.745 24.65 26.595000000000002 55-59 23.419999999999998 25.095 25.2 26.284999999999997 60-64 24.295 24.6 24.615000000000002 26.490000000000002 65-69 23.905 24.25 24.915000000000003 26.93 70-74 24.705 24.64 24.095 26.56 75-79 24.14 24.73 23.96 27.169999999999998 80-84 24.16 24.32 24.54 26.979999999999997 85-89 23.89 24.515 24.9 26.695 90-94 24.675 24.845 24.7 25.779999999999998 95-99 24.42 24.33 24.445 26.805 100-104 25.014999999999997 24.145 24.14 26.700000000000003 105-109 25.165 24.154999999999998 24.23 26.450000000000003 110-114 24.915000000000003 24.245 24.735 26.105 115-119 25.335 24.335 24.005000000000003 26.325 120-124 24.845 24.834999999999997 23.315 27.005000000000003 125-129 24.905 24.349999999999998 23.669999999999998 27.075 130-134 25.235000000000003 23.715 24.33 26.72 135-139 25.259999999999998 24.36 23.265 27.115000000000002 140-144 25.435000000000002 24.355 23.615 26.595000000000002 145-149 25.085 23.775 23.79 27.35 150-151 25.687500000000004 23.25 22.8625 28.199999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 1.0 26 2.5 27 2.5 28 1.0 29 3.0 30 9.5 31 14.0 32 18.5 33 22.5 34 28.5 35 36.0 36 46.5 37 66.0 38 86.5 39 93.0 40 104.0 41 129.5 42 137.0 43 137.5 44 159.0 45 172.5 46 178.0 47 157.5 48 139.0 49 153.5 50 159.0 51 147.5 52 132.0 53 122.5 54 121.5 55 142.0 56 145.0 57 125.0 58 105.0 59 86.0 60 78.0 61 75.5 62 68.0 63 65.0 64 71.0 65 68.5 66 59.5 67 59.5 68 51.0 69 36.0 70 26.5 71 26.0 72 30.5 73 27.5 74 19.5 75 14.5 76 15.5 77 10.0 78 3.0 79 3.5 80 3.5 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.275 #Duplication Level Percentage of deduplicated Percentage of total 1 87.79719278143799 76.625 2 10.455456889143512 18.25 3 1.2317387568032083 3.225 4 0.40103122314523065 1.4000000000000001 5 0.11458034947006589 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCA 5 0.125 No Hit GGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGCTA 5 0.125 No Hit GGGCTGTCCAAAGAGTAACATGTGGCCAATCGTTCCTGGAATTGACCTTC 5 0.125 No Hit GTCCTTCCCGGTCCTCTCGTACTAGGGAAAGGTCCTCTCAATGCTCTAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.55 0.0 0.0 0.0 0.0 114-115 2.9 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.525 0.0 0.0 0.0 0.0 120-121 4.074999999999999 0.0 0.0 0.0 0.0 122-123 4.3625 0.0 0.0 0.0 0.0 124-125 4.625 0.0 0.0 0.0 0.0 126-127 4.975 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 5.9125 0.0 0.0 0.0 0.0 132-133 6.324999999999999 0.0 0.0 0.0 0.0 134-135 7.025 0.0 0.0 0.0 0.0 136-137 7.5875 0.0 0.0 0.0 0.0 138-139 7.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGTA 10 0.006830828 145.0 6 GTGCTCG 10 0.006830828 145.0 8 >>END_MODULE SRR7814861 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.149 37.0 37.0 37.0 37.0 37.0 2 35.8405 37.0 37.0 37.0 37.0 37.0 3 35.6615 37.0 37.0 37.0 37.0 37.0 4 35.833 37.0 37.0 37.0 37.0 37.0 5 35.8225 37.0 37.0 37.0 37.0 37.0 6 35.7165 37.0 37.0 37.0 37.0 37.0 7 35.4965 37.0 37.0 37.0 37.0 37.0 8 35.7965 37.0 37.0 37.0 37.0 37.0 9 36.0495 37.0 37.0 37.0 37.0 37.0 10-14 35.780499999999996 37.0 37.0 37.0 37.0 37.0 15-19 35.3921 37.0 37.0 37.0 34.6 37.0 20-24 35.66080000000001 37.0 37.0 37.0 37.0 37.0 25-29 35.5395 37.0 37.0 37.0 37.0 37.0 30-34 35.3078 37.0 37.0 37.0 34.6 37.0 35-39 35.2692 37.0 37.0 37.0 34.6 37.0 40-44 35.0232 37.0 37.0 37.0 27.4 37.0 45-49 35.051899999999996 37.0 37.0 37.0 29.8 37.0 50-54 34.4551 37.0 37.0 37.0 25.0 37.0 55-59 34.351099999999995 37.0 37.0 37.0 25.0 37.0 60-64 34.625099999999996 37.0 37.0 37.0 25.0 37.0 65-69 34.59159999999999 37.0 37.0 37.0 25.0 37.0 70-74 34.1391 37.0 37.0 37.0 25.0 37.0 75-79 33.9127 37.0 37.0 37.0 22.2 37.0 80-84 33.877700000000004 37.0 37.0 37.0 22.2 37.0 85-89 34.241600000000005 37.0 37.0 37.0 25.0 37.0 90-94 33.7444 37.0 37.0 37.0 25.0 37.0 95-99 32.8588 37.0 37.0 37.0 11.0 37.0 100-104 33.2819 37.0 37.0 37.0 16.6 37.0 105-109 32.9471 37.0 37.0 37.0 13.8 37.0 110-114 33.1725 37.0 37.0 37.0 16.6 37.0 115-119 33.3136 37.0 37.0 37.0 19.4 37.0 120-124 32.548500000000004 37.0 37.0 37.0 11.0 37.0 125-129 32.864 37.0 37.0 37.0 13.8 37.0 130-134 32.2472 37.0 32.2 37.0 11.0 37.0 135-139 32.2007 37.0 32.2 37.0 11.0 37.0 140-144 32.4495 37.0 34.6 37.0 11.0 37.0 145-149 32.0717 37.0 29.8 37.0 11.0 37.0 150-151 31.63575 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 4.0 16 5.0 17 0.0 18 2.0 19 2.0 20 4.0 21 7.0 22 11.0 23 28.0 24 57.0 25 65.0 26 74.0 27 93.0 28 107.0 29 115.0 30 112.0 31 140.0 32 173.0 33 221.0 34 313.0 35 773.0 36 1657.0 37 30.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.75 18.975 8.25 30.025000000000002 2 31.6 22.025 26.150000000000002 20.225 3 23.474999999999998 24.625 27.675 24.224999999999998 4 28.95 29.799999999999997 18.475 22.775000000000002 5 29.625 31.225 18.175 20.974999999999998 6 23.400000000000002 36.825 18.0 21.775 7 23.95 18.85 32.45 24.75 8 24.349999999999998 22.075 23.1 30.475 9 26.224999999999998 21.95 26.275 25.55 10-14 28.15 24.47 21.745 25.635 15-19 27.025 24.215 23.225 25.535000000000004 20-24 27.384999999999998 24.48 22.919999999999998 25.215 25-29 27.339999999999996 24.52 23.064999999999998 25.074999999999996 30-34 26.674999999999997 24.595 22.855 25.874999999999996 35-39 26.995 24.615000000000002 23.145 25.245 40-44 26.950000000000003 25.035 22.91 25.105 45-49 26.645000000000003 24.145 23.84 25.369999999999997 50-54 26.810000000000002 25.074999999999996 23.185 24.93 55-59 27.24 24.474999999999998 23.335 24.95 60-64 26.955000000000002 25.165 23.225 24.654999999999998 65-69 26.950000000000003 24.79 23.305 24.955 70-74 26.724999999999998 24.85 23.34 25.085 75-79 26.674999999999997 25.34 22.785 25.2 80-84 26.99 25.3 23.32 24.39 85-89 27.060000000000002 24.43 23.27 25.240000000000002 90-94 26.72 25.56 23.09 24.63 95-99 26.875 25.074999999999996 23.535 24.515 100-104 27.029999999999998 25.46 23.395 24.115000000000002 105-109 26.27 26.845000000000002 22.73 24.154999999999998 110-114 26.52 26.045 22.689999999999998 24.745 115-119 26.995 25.39 22.925 24.69 120-124 26.595000000000002 27.034999999999997 22.715 23.655 125-129 27.63 26.77 22.605 22.994999999999997 130-134 26.86 27.1 22.915 23.125 135-139 27.07 27.11 22.759999999999998 23.06 140-144 28.044999999999998 26.165 23.145 22.645 145-149 27.894999999999996 26.810000000000002 22.915 22.38 150-151 29.2 24.3125 23.9 22.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 2.0 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 1.5 22 2.0 23 1.5 24 1.0 25 0.5 26 2.0 27 5.5 28 6.0 29 8.0 30 13.5 31 15.0 32 21.0 33 22.0 34 23.5 35 32.5 36 41.5 37 53.5 38 59.0 39 78.5 40 100.5 41 106.0 42 126.0 43 140.0 44 147.0 45 135.0 46 126.5 47 139.5 48 129.0 49 137.5 50 143.5 51 138.5 52 132.0 53 117.0 54 120.5 55 127.0 56 127.0 57 118.5 58 109.0 59 100.5 60 95.5 61 103.5 62 94.5 63 78.0 64 68.5 65 67.0 66 76.5 67 77.0 68 70.5 69 57.0 70 56.5 71 53.0 72 37.5 73 36.5 74 30.5 75 16.5 76 13.5 77 13.5 78 9.0 79 6.0 80 5.0 81 2.5 82 1.5 83 1.5 84 1.5 85 1.5 86 1.0 87 1.0 88 1.0 89 0.5 90 0.0 91 0.0 92 1.0 93 1.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.17500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.76731146621812 80.05 2 8.858985141575554 15.8 3 0.9812167087188113 2.625 4 0.3083823941687692 1.0999999999999999 5 0.02803476310625175 0.125 6 0.0560695262125035 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit GTTCGATCCTGGCTCAGGATGAACGCTGGCGGCATGCTTAACACATGCAA 6 0.15 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.6125 0.0 0.0 0.0 0.0 122-123 3.8875 0.0 0.0 0.0 0.0 124-125 4.125 0.0 0.0 0.0 0.0 126-127 4.4125 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.15 0.0 0.0 0.0 0.0 132-133 5.4875 0.0 0.0 0.0 0.0 134-135 6.0375 0.0 0.0 0.0 0.0 136-137 6.475 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027916 spots for SRR7814861.sra Written 2027916 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra Read 2027903 spots for SRR7814861.sra Written 2027903 spots for SRR7814861.sra SRR ids: ['SRR7814861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jt9fjp5r SRR7814861.sra spots: 40558073 blocks: [[1, 2027903], [2027904, 4055806], [4055807, 6083709], [6083710, 8111612], [8111613, 10139515], [10139516, 12167418], [12167419, 14195321], [14195322, 16223224], [16223225, 18251127], [18251128, 20279030], [20279031, 22306933], [22306934, 24334836], [24334837, 26362739], [26362740, 28390642], [28390643, 30418545], [30418546, 32446448], [32446449, 34474351], [34474352, 36502254], [36502255, 38530157], [38530158, 40558073]] SRR7814861 file size 13722099 SRR7814861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814861 SRR7814861_1.fastq SRR7814861_2.fastq Input file: SRR7814861_1.fastq Paired file: SRR7814861_2.fastq trimmed: SRR7814861-trimmed-pair1.fastq, SRR7814861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:09:30 2024 >> started Fri Dec 6 13:10:23 2024 >> done (53.236s) 40558073 read pairs processed; of these: 149 ( 0.00%) short read pairs filtered out after trimming by size control 8640 ( 0.02%) empty read pairs filtered out after trimming by size control 40549284 (99.98%) read pairs available; of these: 4503437 (11.11%) trimmed read pairs available after processing 36045847 (88.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 20 0.00% 20 19 0.00% 21 12 0.00% 22 21 0.00% 23 25 0.00% 24 27 0.00% 25 30 0.00% 26 27 0.00% 27 32 0.00% 28 29 0.00% 29 46 0.00% 30 39 0.00% 31 45 0.00% 32 45 0.00% 33 48 0.00% 34 52 0.00% 35 37 0.00% 36 70 0.00% 37 68 0.00% 38 60 0.00% 39 78 0.00% 40 77 0.00% 41 88 0.00% 42 93 0.00% 43 81 0.00% 44 99 0.00% 45 111 0.00% 46 112 0.00% 47 116 0.00% 48 148 0.00% 49 158 0.00% 50 196 0.00% 51 188 0.00% 52 235 0.00% 53 260 0.00% 54 244 0.00% 55 302 0.00% 56 325 0.00% 57 365 0.00% 58 414 0.00% 59 488 0.00% 60 570 0.00% 61 643 0.00% 62 710 0.00% 63 749 0.00% 64 816 0.00% 65 894 0.00% 66 992 0.00% 67 1072 0.00% 68 1210 0.00% 69 1403 0.00% 70 1624 0.00% 71 1894 0.00% 72 2213 0.01% 73 2519 0.01% 74 2756 0.01% 75 3134 0.01% 76 3487 0.01% 77 3813 0.01% 78 4128 0.01% 79 4789 0.01% 80 5471 0.01% 81 6236 0.02% 82 6906 0.02% 83 7820 0.02% 84 8655 0.02% 85 9539 0.02% 86 10285 0.03% 87 11437 0.03% 88 12470 0.03% 89 13297 0.03% 90 14712 0.04% 91 16391 0.04% 92 17720 0.04% 93 19621 0.05% 94 20966 0.05% 95 23033 0.06% 96 24326 0.06% 97 26265 0.06% 98 27185 0.07% 99 28934 0.07% 100 30358 0.07% 101 32197 0.08% 102 34483 0.09% 103 36599 0.09% 104 38901 0.10% 105 39872 0.10% 106 42648 0.11% 107 44831 0.11% 108 46226 0.11% 109 48566 0.12% 110 50207 0.12% 111 52590 0.13% 112 54613 0.13% 113 56760 0.14% 114 59343 0.15% 115 62318 0.15% 116 63957 0.16% 117 65610 0.16% 118 67335 0.17% 119 68163 0.17% 120 70969 0.18% 121 72255 0.18% 122 74278 0.18% 123 78118 0.19% 124 79889 0.20% 125 82646 0.20% 126 85198 0.21% 127 87298 0.22% 128 88453 0.22% 129 90482 0.22% 130 91156 0.22% 131 93027 0.23% 132 95965 0.24% 133 98145 0.24% 134 101433 0.25% 135 102649 0.25% 136 106022 0.26% 137 105731 0.26% 138 106298 0.26% 139 109799 0.27% 140 110082 0.27% 141 112683 0.28% 142 114164 0.28% 143 116939 0.29% 144 120149 0.30% 145 122177 0.30% 146 123964 0.31% 147 125560 0.31% 148 127430 0.31% 149 128451 0.32% 150 130824 0.32% 151 36045847 88.89% 40549284 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.69 prefix-fanout=2.0 sequence=GTATTTAGCCTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=57.67 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=3.4 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=17 prefix-density=0.95 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=30 fanout-score=11.18 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=3.9 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGGCGGCCTCGACTACCTTGGCAACCC SRR7814861 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:11:16 Started mapping on | Dec 06 13:11:18 Finished on | Dec 06 13:16:14 Mapping speed, Million of reads per hour | 493.17 Number of input reads | 40549284 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 34368827 Uniquely mapped reads % | 84.76% Average mapped length | 295.03 Number of splices: Total | 30122472 Number of splices: Annotated (sjdb) | 28341806 Number of splices: GT/AG | 29676576 Number of splices: GC/AG | 357292 Number of splices: AT/AC | 10493 Number of splices: Non-canonical | 78111 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.53 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2125688 % of reads mapped to multiple loci | 5.24% Number of reads mapped to too many loci | 333282 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.80% % of reads unmapped: other | 5.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4054769 4054769 4054769 N_multimapping 2125688 2125688 2125688 N_noFeature 2746629 33235671 3014679 N_ambiguous 1044883 4372 181398 UnstrandedReadsAssigned:30577315 PositiveStrandReadsAssigned:1128784 NegativeStrandReadsAssigned:31172750 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814861-trimmed-pair1.fastq SRR7814861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,549,284 reads, 32,129,043 reads pseudoaligned [quant] estimated average fragment length: 254.912 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52973 SRR7814861.ke.tsv 35125 SRR7814861.se.tsv 88098 total ==> SRR7814861.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.399 0 0 PNS24247 1044 790.088 99.6351 4.61649 PNS24249 1928 1674.09 179.612 3.92763 PNS24246 1044 790.088 99.6351 4.61649 PNS24248 1044 790.088 99.6351 4.61649 PNS24244 1471 1217.09 305.483 9.18839 PNS24243 293 96.625 2 0.757731 KQK14069 1603 1349.09 15551.6 421.996 KQK14071 474 237.916 199.82 30.7461 ==> SRR7814861.se.tsv <== BRADI_1g14170v3 16425 BRADI_1g53295v3 2297 BRADI_1g59795v3 395 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 276 BRADI_1g74790v3 390 BRADI_1g09890v3 0 BRADI_1g77505v3 813 BRADI_1g48960v3 2 SRR7814861 completed mapping pipeline successfully