Starting /dee2/code/volunteer_pipeline.sh SRR7814862 current disk space = 1551227834368 free memory = 1601153276 SRR7814862 SRAfilesize 957021dd94fe50e1a83295042f470ad9 SRR7814862.sra SRR7814862.sra file validated SRR7814862 is paired end SRR7814862 is conventional basespace SRR7814862 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814862_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.358 37.0 37.0 37.0 37.0 37.0 2 36.37875 37.0 37.0 37.0 37.0 37.0 3 36.531 37.0 37.0 37.0 37.0 37.0 4 36.5375 37.0 37.0 37.0 37.0 37.0 5 36.523 37.0 37.0 37.0 37.0 37.0 6 36.533 37.0 37.0 37.0 37.0 37.0 7 36.5555 37.0 37.0 37.0 37.0 37.0 8 36.529 37.0 37.0 37.0 37.0 37.0 9 36.569 37.0 37.0 37.0 37.0 37.0 10-14 36.576 37.0 37.0 37.0 37.0 37.0 15-19 36.500099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.4697 37.0 37.0 37.0 37.0 37.0 25-29 36.463499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.3491 37.0 37.0 37.0 37.0 37.0 35-39 36.275 37.0 37.0 37.0 37.0 37.0 40-44 36.276599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.319300000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.334 37.0 37.0 37.0 37.0 37.0 55-59 36.347 37.0 37.0 37.0 37.0 37.0 60-64 36.3284 37.0 37.0 37.0 37.0 37.0 65-69 36.241 37.0 37.0 37.0 37.0 37.0 70-74 36.1819 37.0 37.0 37.0 37.0 37.0 75-79 36.052099999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.1344 37.0 37.0 37.0 37.0 37.0 85-89 36.1344 37.0 37.0 37.0 37.0 37.0 90-94 36.0301 37.0 37.0 37.0 37.0 37.0 95-99 35.7639 37.0 37.0 37.0 37.0 37.0 100-104 35.4775 37.0 37.0 37.0 34.6 37.0 105-109 35.6446 37.0 37.0 37.0 37.0 37.0 110-114 35.7611 37.0 37.0 37.0 37.0 37.0 115-119 35.5687 37.0 37.0 37.0 37.0 37.0 120-124 34.9896 37.0 37.0 37.0 25.0 37.0 125-129 34.7008 37.0 37.0 37.0 25.0 37.0 130-134 35.2522 37.0 37.0 37.0 29.8 37.0 135-139 35.14970000000001 37.0 37.0 37.0 25.0 37.0 140-144 35.102599999999995 37.0 37.0 37.0 27.4 37.0 145-149 35.0228 37.0 37.0 37.0 25.0 37.0 150-151 34.364999999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 4.0 26 2.0 27 7.0 28 18.0 29 20.0 30 33.0 31 40.0 32 70.0 33 153.0 34 243.0 35 653.0 36 2599.0 37 155.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.63991975927783 11.158475426278837 5.992978936810432 36.2086258776329 2 26.506626656664167 13.053263315828959 32.808202050512634 27.631907976994246 3 21.875 17.95 22.725 37.45 4 28.625 23.799999999999997 20.3 27.275 5 26.35 30.65 22.075 20.925 6 22.0 31.075000000000003 23.375 23.549999999999997 7 18.675 21.925 40.050000000000004 19.35 8 19.925 21.525 31.825 26.724999999999998 9 20.1 21.224999999999998 31.474999999999998 27.200000000000003 10-14 23.875 25.740000000000002 24.255 26.13 15-19 24.185000000000002 24.585 25.1 26.13 20-24 24.51 24.385 24.685000000000002 26.419999999999998 25-29 23.96 24.104999999999997 24.595 27.339999999999996 30-34 24.325 24.490000000000002 24.104999999999997 27.08 35-39 24.84 23.9 24.55 26.71 40-44 24.535 24.169999999999998 24.265 27.029999999999998 45-49 23.91 23.7 24.805 27.584999999999997 50-54 24.165 24.5 24.404999999999998 26.93 55-59 24.21 24.515 24.21 27.065 60-64 24.635 23.849999999999998 24.315 27.200000000000003 65-69 24.81 23.849999999999998 24.455 26.884999999999998 70-74 24.755 24.015 23.985 27.245 75-79 25.385 23.79 23.765 27.060000000000002 80-84 24.845 24.205 24.255 26.695 85-89 25.35 23.66 23.915 27.075 90-94 25.4 24.490000000000002 24.0 26.11 95-99 24.755 23.405 24.235 27.605 100-104 25.369999999999997 24.25 24.32 26.06 105-109 25.8 24.005000000000003 24.37 25.825 110-114 24.495 24.14 24.54 26.825 115-119 24.905 23.66 23.96 27.474999999999998 120-124 25.230000000000004 24.275 23.51 26.985 125-129 25.369999999999997 23.49 23.91 27.229999999999997 130-134 25.61 23.41 23.669999999999998 27.310000000000002 135-139 24.990000000000002 24.01 23.915 27.084999999999997 140-144 25.94 23.880000000000003 23.27 26.91 145-149 25.009999999999998 23.695 23.98 27.315 150-151 25.55 23.6625 23.0875 27.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 2.0 25 2.0 26 1.0 27 5.5 28 6.0 29 4.5 30 6.5 31 8.5 32 18.0 33 23.5 34 25.5 35 30.0 36 35.5 37 44.5 38 57.5 39 80.0 40 103.5 41 117.5 42 128.0 43 141.5 44 152.0 45 146.0 46 149.0 47 172.0 48 156.0 49 137.5 50 150.0 51 161.5 52 153.5 53 130.5 54 125.0 55 132.0 56 128.5 57 103.0 58 101.0 59 113.0 60 93.5 61 83.5 62 79.0 63 70.0 64 74.5 65 69.0 66 61.0 67 57.5 68 51.5 69 51.0 70 48.0 71 43.5 72 37.5 73 32.5 74 30.0 75 21.5 76 16.5 77 11.0 78 5.5 79 3.5 80 2.0 81 2.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.725 #Duplication Level Percentage of deduplicated Percentage of total 1 88.51524650897692 77.64999999999999 2 9.546879452835565 16.75 3 1.5388999715018523 4.05 4 0.28498147620404674 1.0 5 0.05699629524080935 0.25 6 0.05699629524080935 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCATTCTTGC 6 0.15 No Hit GAAAATTCTTATGAACCAAGGTAATTGGTGGCTCTTTTTTAACTCCATTG 6 0.15 No Hit GTCAAATTAAGCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTC 5 0.125 No Hit GTCGAGTTATCATGAATCATCGGATCAGCGAGCAAAGCCCGCGTCAGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.2750000000000004 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.425 0.0 0.0 0.0 0.0 132-133 5.8375 0.0 0.0 0.0 0.0 134-135 6.3625 0.0 0.0 0.0 0.0 136-137 6.800000000000001 0.0 0.0 0.0 0.0 138-139 7.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGAT 10 0.006830828 145.0 2 >>END_MODULE SRR7814862 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814862_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9975 37.0 37.0 37.0 37.0 37.0 2 35.738 37.0 37.0 37.0 37.0 37.0 3 35.718 37.0 37.0 37.0 37.0 37.0 4 35.869 37.0 37.0 37.0 37.0 37.0 5 35.8275 37.0 37.0 37.0 37.0 37.0 6 35.594 37.0 37.0 37.0 37.0 37.0 7 35.441 37.0 37.0 37.0 37.0 37.0 8 35.702 37.0 37.0 37.0 37.0 37.0 9 35.9815 37.0 37.0 37.0 37.0 37.0 10-14 35.7786 37.0 37.0 37.0 37.0 37.0 15-19 35.4073 37.0 37.0 37.0 34.6 37.0 20-24 35.6721 37.0 37.0 37.0 37.0 37.0 25-29 35.595200000000006 37.0 37.0 37.0 34.6 37.0 30-34 35.2675 37.0 37.0 37.0 32.2 37.0 35-39 35.289899999999996 37.0 37.0 37.0 34.6 37.0 40-44 35.006600000000006 37.0 37.0 37.0 25.0 37.0 45-49 35.1582 37.0 37.0 37.0 29.8 37.0 50-54 34.487700000000004 37.0 37.0 37.0 25.0 37.0 55-59 34.40989999999999 37.0 37.0 37.0 25.0 37.0 60-64 34.6699 37.0 37.0 37.0 25.0 37.0 65-69 34.5852 37.0 37.0 37.0 25.0 37.0 70-74 34.2367 37.0 37.0 37.0 25.0 37.0 75-79 34.0811 37.0 37.0 37.0 25.0 37.0 80-84 33.9962 37.0 37.0 37.0 22.2 37.0 85-89 34.2402 37.0 37.0 37.0 25.0 37.0 90-94 33.8621 37.0 37.0 37.0 25.0 37.0 95-99 32.942899999999995 37.0 37.0 37.0 11.0 37.0 100-104 33.27419999999999 37.0 37.0 37.0 16.6 37.0 105-109 32.9107 37.0 37.0 37.0 13.8 37.0 110-114 33.235 37.0 37.0 37.0 16.6 37.0 115-119 33.339800000000004 37.0 37.0 37.0 22.2 37.0 120-124 32.6468 37.0 37.0 37.0 11.0 37.0 125-129 32.959700000000005 37.0 37.0 37.0 13.8 37.0 130-134 32.23 37.0 32.2 37.0 11.0 37.0 135-139 32.3005 37.0 32.2 37.0 11.0 37.0 140-144 32.5717 37.0 37.0 37.0 11.0 37.0 145-149 32.1619 37.0 32.2 37.0 11.0 37.0 150-151 31.7665 37.0 31.0 37.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 2.0 17 2.0 18 3.0 19 2.0 20 5.0 21 9.0 22 15.0 23 28.0 24 29.0 25 56.0 26 84.0 27 106.0 28 113.0 29 107.0 30 121.0 31 150.0 32 183.0 33 217.0 34 368.0 35 728.0 36 1628.0 37 43.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.775 18.0 8.924999999999999 31.3 2 30.725 22.650000000000002 25.3 21.325 3 24.525 24.099999999999998 26.85 24.525 4 27.275 31.775 18.375 22.575 5 27.800000000000004 31.75 18.075 22.375 6 24.725 35.825 18.65 20.8 7 22.55 19.925 32.175 25.35 8 24.05 22.325 23.225 30.4 9 25.4 21.725 25.025 27.85 10-14 27.145000000000003 25.555 21.43 25.869999999999997 15-19 26.490000000000002 23.865 23.380000000000003 26.265 20-24 27.115000000000002 25.069999999999997 22.215 25.6 25-29 26.44 24.825 22.689999999999998 26.045 30-34 26.245 25.525 22.685 25.545 35-39 26.295 25.035 22.235 26.435 40-44 26.724999999999998 24.709999999999997 22.97 25.595000000000002 45-49 27.0 24.85 22.63 25.52 50-54 26.41 25.3 22.869999999999997 25.419999999999998 55-59 26.855 24.81 22.295 26.040000000000003 60-64 27.095000000000002 24.625 22.955000000000002 25.324999999999996 65-69 26.58 24.545 23.880000000000003 24.995 70-74 27.365000000000002 24.245 22.994999999999997 25.395 75-79 25.995 25.21 22.79 26.005 80-84 26.875 25.335 22.705000000000002 25.085 85-89 26.985 24.474999999999998 22.755 25.785000000000004 90-94 26.705000000000002 24.94 23.195 25.16 95-99 26.815 25.845000000000002 22.625 24.715 100-104 26.325 26.46 22.39 24.825 105-109 26.52 25.8 22.900000000000002 24.779999999999998 110-114 26.905 25.474999999999998 22.825 24.795 115-119 27.145000000000003 25.495 22.85 24.51 120-124 26.43 27.060000000000002 22.2 24.310000000000002 125-129 27.400000000000002 26.005 22.21 24.385 130-134 26.865 26.395000000000003 22.5 24.240000000000002 135-139 27.01 26.895000000000003 22.53 23.565 140-144 28.04 26.145000000000003 22.220000000000002 23.595 145-149 27.91 26.125 22.7 23.265 150-151 28.075 26.0625 22.412499999999998 23.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 2.5 24 3.0 25 2.5 26 3.5 27 6.0 28 7.5 29 6.5 30 9.0 31 14.0 32 15.0 33 16.5 34 23.0 35 30.5 36 38.0 37 49.5 38 62.0 39 72.5 40 97.5 41 112.5 42 113.0 43 136.0 44 148.5 45 134.0 46 142.5 47 143.5 48 127.5 49 133.0 50 135.0 51 134.5 52 124.0 53 117.0 54 127.0 55 133.5 56 120.0 57 104.0 58 109.0 59 115.0 60 110.5 61 110.5 62 99.0 63 84.5 64 88.0 65 76.5 66 67.0 67 67.0 68 55.0 69 51.0 70 55.5 71 52.0 72 53.5 73 46.5 74 28.5 75 21.0 76 15.0 77 9.5 78 9.5 79 8.0 80 5.0 81 3.0 82 2.5 83 1.0 84 1.0 85 1.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.25 #Duplication Level Percentage of deduplicated Percentage of total 1 89.94397759103641 80.27499999999999 2 8.4593837535014 15.1 3 1.2324929971988796 3.3000000000000003 4 0.33613445378151263 1.2 5 0.028011204481792715 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTGTTTCCAGTGGCGAACGGGTGAGTAACGCGTAAGAACCTGCCCTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8625 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.3499999999999996 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.7375 0.0 0.0 0.0 0.0 120-121 2.95 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.4125 0.0 0.0 0.0 0.0 126-127 3.8125 0.0 0.0 0.0 0.0 128-129 4.2375 0.0 0.0 0.0 0.0 130-131 4.7125 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527122 spots for SRR7814862.sra Written 2527122 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra Read 2527117 spots for SRR7814862.sra Written 2527117 spots for SRR7814862.sra SRR ids: ['SRR7814862.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ijor_ohp SRR7814862.sra spots: 50542345 blocks: [[1, 2527117], [2527118, 5054234], [5054235, 7581351], [7581352, 10108468], [10108469, 12635585], [12635586, 15162702], [15162703, 17689819], [17689820, 20216936], [20216937, 22744053], [22744054, 25271170], [25271171, 27798287], [27798288, 30325404], [30325405, 32852521], [32852522, 35379638], [35379639, 37906755], [37906756, 40433872], [40433873, 42960989], [42960990, 45488106], [45488107, 48015223], [48015224, 50542345]] SRR7814862 file size 17105441 SRR7814862 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814862 SRR7814862_1.fastq SRR7814862_2.fastq Input file: SRR7814862_1.fastq Paired file: SRR7814862_2.fastq trimmed: SRR7814862-trimmed-pair1.fastq, SRR7814862-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:11:07 2024 >> started Fri Dec 6 13:12:02 2024 >> done (55.546s) 50542345 read pairs processed; of these: 225 ( 0.00%) short read pairs filtered out after trimming by size control 8478 ( 0.02%) empty read pairs filtered out after trimming by size control 50533642 (99.98%) read pairs available; of these: 5695727 (11.27%) trimmed read pairs available after processing 44837915 (88.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 27 0.00% 20 23 0.00% 21 26 0.00% 22 24 0.00% 23 30 0.00% 24 30 0.00% 25 34 0.00% 26 38 0.00% 27 31 0.00% 28 43 0.00% 29 55 0.00% 30 61 0.00% 31 52 0.00% 32 58 0.00% 33 63 0.00% 34 71 0.00% 35 77 0.00% 36 91 0.00% 37 72 0.00% 38 104 0.00% 39 111 0.00% 40 92 0.00% 41 105 0.00% 42 118 0.00% 43 130 0.00% 44 121 0.00% 45 146 0.00% 46 166 0.00% 47 177 0.00% 48 197 0.00% 49 275 0.00% 50 224 0.00% 51 294 0.00% 52 314 0.00% 53 306 0.00% 54 314 0.00% 55 331 0.00% 56 376 0.00% 57 461 0.00% 58 572 0.00% 59 679 0.00% 60 687 0.00% 61 838 0.00% 62 1007 0.00% 63 952 0.00% 64 1146 0.00% 65 1209 0.00% 66 1411 0.00% 67 1506 0.00% 68 1674 0.00% 69 1954 0.00% 70 2222 0.00% 71 2633 0.01% 72 2903 0.01% 73 3500 0.01% 74 3712 0.01% 75 4072 0.01% 76 4581 0.01% 77 5049 0.01% 78 5750 0.01% 79 6515 0.01% 80 7254 0.01% 81 8142 0.02% 82 9334 0.02% 83 10761 0.02% 84 11786 0.02% 85 12880 0.03% 86 14067 0.03% 87 15081 0.03% 88 16696 0.03% 89 17852 0.04% 90 19314 0.04% 91 21794 0.04% 92 24108 0.05% 93 25852 0.05% 94 27874 0.06% 95 30362 0.06% 96 31972 0.06% 97 34730 0.07% 98 35881 0.07% 99 37856 0.07% 100 40402 0.08% 101 42998 0.09% 102 45536 0.09% 103 47851 0.09% 104 50765 0.10% 105 52532 0.10% 106 55525 0.11% 107 57831 0.11% 108 60494 0.12% 109 63131 0.12% 110 64615 0.13% 111 67365 0.13% 112 71475 0.14% 113 73377 0.15% 114 76416 0.15% 115 80510 0.16% 116 82665 0.16% 117 84013 0.17% 118 85124 0.17% 119 86776 0.17% 120 91058 0.18% 121 92023 0.18% 122 95212 0.19% 123 100637 0.20% 124 101891 0.20% 125 104778 0.21% 126 108463 0.21% 127 109217 0.22% 128 110333 0.22% 129 114064 0.23% 130 114369 0.23% 131 117260 0.23% 132 120477 0.24% 133 123742 0.24% 134 125345 0.25% 135 128012 0.25% 136 131861 0.26% 137 130696 0.26% 138 131617 0.26% 139 136938 0.27% 140 135702 0.27% 141 138297 0.27% 142 142671 0.28% 143 144401 0.29% 144 148301 0.29% 145 150900 0.30% 146 152529 0.30% 147 156059 0.31% 148 157152 0.31% 149 158653 0.31% 150 160218 0.32% 151 44837915 88.73% 50533642 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.78 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=13.87 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.6 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGACGACCAAATTACGCATCACAAGTACAACCCCGCGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCGCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=22 prefix-density=1.10 prefix-fanout=2.2 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=51.84 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=4.2 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR7814862 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:12:55 Started mapping on | Dec 06 13:12:55 Finished on | Dec 06 13:21:01 Mapping speed, Million of reads per hour | 374.32 Number of input reads | 50533642 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 41833972 Uniquely mapped reads % | 82.78% Average mapped length | 294.91 Number of splices: Total | 39758508 Number of splices: Annotated (sjdb) | 37603510 Number of splices: GT/AG | 39172662 Number of splices: GC/AG | 482873 Number of splices: AT/AC | 13968 Number of splices: Non-canonical | 89005 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2496418 % of reads mapped to multiple loci | 4.94% Number of reads mapped to too many loci | 505727 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.14% % of reads unmapped: other | 6.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6203252 6203252 6203252 N_multimapping 2496418 2496418 2496418 N_noFeature 2956183 40501495 3318781 N_ambiguous 1191598 5607 222961 UnstrandedReadsAssigned:37686191 PositiveStrandReadsAssigned:1326870 NegativeStrandReadsAssigned:38292230 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814862 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814862-trimmed-pair1.fastq SRR7814862-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 50,533,642 reads, 39,606,627 reads pseudoaligned [quant] estimated average fragment length: 260.868 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR7814862.ke.tsv 35125 SRR7814862.se.tsv 88098 total ==> SRR7814862.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 676.527 0 0 PNS24247 1044 784.132 74.0568 2.80548 PNS24249 1928 1668.13 300.645 5.35371 PNS24246 1044 784.132 74.0568 2.80548 PNS24248 1044 784.132 74.0568 2.80548 PNS24244 1471 1211.13 115.185 2.82511 PNS24243 293 96.4672 11 3.38723 KQK14069 1603 1343.13 7640.58 168.982 KQK14071 474 235.358 34.6116 4.36842 ==> SRR7814862.se.tsv <== BRADI_1g14170v3 7738 BRADI_1g53295v3 1735 BRADI_1g59795v3 261 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 516 BRADI_1g74790v3 642 BRADI_1g09890v3 0 BRADI_1g77505v3 756 BRADI_1g48960v3 2 SRR7814862 completed mapping pipeline successfully