Starting /dee2/code/volunteer_pipeline.sh SRR7814863 current disk space = 1551098195968 free memory = 1597255792 SRR7814863 SRAfilesize e3919b431598b24270c0322a51773286 SRR7814863.sra SRR7814863.sra file validated SRR7814863 is paired end SRR7814863 is conventional basespace SRR7814863 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814863_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.31475 37.0 37.0 37.0 37.0 37.0 2 36.38075 37.0 37.0 37.0 37.0 37.0 3 36.4525 37.0 37.0 37.0 37.0 37.0 4 36.4715 37.0 37.0 37.0 37.0 37.0 5 36.481 37.0 37.0 37.0 37.0 37.0 6 36.519 37.0 37.0 37.0 37.0 37.0 7 36.4225 37.0 37.0 37.0 37.0 37.0 8 36.5255 37.0 37.0 37.0 37.0 37.0 9 36.5645 37.0 37.0 37.0 37.0 37.0 10-14 36.436 37.0 37.0 37.0 37.0 37.0 15-19 36.431 37.0 37.0 37.0 37.0 37.0 20-24 36.432900000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.354200000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.3469 37.0 37.0 37.0 37.0 37.0 35-39 36.3255 37.0 37.0 37.0 37.0 37.0 40-44 36.3197 37.0 37.0 37.0 37.0 37.0 45-49 36.2132 37.0 37.0 37.0 37.0 37.0 50-54 36.209500000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.1331 37.0 37.0 37.0 37.0 37.0 60-64 36.113699999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.127599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.0598 37.0 37.0 37.0 37.0 37.0 75-79 36.0693 37.0 37.0 37.0 37.0 37.0 80-84 36.042500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.9157 37.0 37.0 37.0 37.0 37.0 90-94 35.9347 37.0 37.0 37.0 37.0 37.0 95-99 35.832 37.0 37.0 37.0 37.0 37.0 100-104 35.8758 37.0 37.0 37.0 37.0 37.0 105-109 35.78410000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.7654 37.0 37.0 37.0 37.0 37.0 115-119 35.5947 37.0 37.0 37.0 37.0 37.0 120-124 35.6448 37.0 37.0 37.0 37.0 37.0 125-129 35.548 37.0 37.0 37.0 37.0 37.0 130-134 35.5069 37.0 37.0 37.0 37.0 37.0 135-139 35.40749999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.3161 37.0 37.0 37.0 32.2 37.0 145-149 35.154199999999996 37.0 37.0 37.0 27.4 37.0 150-151 34.54625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 6.0 24 6.0 25 8.0 26 7.0 27 14.0 28 30.0 29 26.0 30 50.0 31 58.0 32 72.0 33 95.0 34 170.0 35 368.0 36 2768.0 37 322.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.21523427712352 12.077173640691557 7.141067401653721 29.5665246805312 2 27.33183295823956 13.053263315828959 29.782445611402853 29.83245811452863 3 23.849999999999998 19.225 24.349999999999998 32.574999999999996 4 27.575 25.1 20.575 26.75 5 25.2 29.65 22.55 22.6 6 23.025000000000002 33.1 22.875 21.0 7 17.75 25.0 37.75 19.5 8 19.125 24.775 28.7 27.400000000000002 9 20.05 22.675 32.824999999999996 24.45 10-14 23.66 26.834999999999997 25.019999999999996 24.485 15-19 23.435 25.290000000000003 25.555 25.72 20-24 23.175 25.595000000000002 25.41 25.82 25-29 23.24 25.75 25.645 25.365 30-34 23.535 25.779999999999998 24.745 25.94 35-39 23.645 25.845000000000002 24.59 25.919999999999998 40-44 23.830000000000002 26.13 24.465 25.575 45-49 23.66 25.96 24.4 25.979999999999997 50-54 23.695 25.95 24.865000000000002 25.490000000000002 55-59 23.555 25.895000000000003 24.23 26.32 60-64 24.08 25.515 24.83 25.575 65-69 24.025 25.674999999999997 24.26 26.040000000000003 70-74 24.205 25.545 24.25 26.0 75-79 23.985 25.145 24.375 26.495 80-84 24.205 25.41 24.6 25.785000000000004 85-89 23.78 25.369999999999997 24.425 26.424999999999997 90-94 24.08 24.945 24.725 26.25 95-99 23.885 25.345000000000002 24.695 26.075 100-104 24.27 24.97 24.044999999999998 26.715 105-109 24.47 24.425 24.415 26.69 110-114 24.465 25.14 23.875 26.52 115-119 24.46 25.319999999999997 24.325 25.895000000000003 120-124 24.91 25.28 23.555 26.255 125-129 24.7 25.264999999999997 23.955000000000002 26.08 130-134 25.305 25.44 23.66 25.595000000000002 135-139 24.945 24.97 23.53 26.555 140-144 24.755 24.725 24.26 26.26 145-149 25.095 24.695 23.705000000000002 26.505000000000003 150-151 25.7375 23.9875 24.4375 25.837500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.5 13 2.0 14 1.5 15 1.0 16 1.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 2.0 27 3.5 28 4.5 29 7.0 30 9.5 31 13.0 32 15.0 33 18.5 34 23.5 35 35.5 36 51.5 37 62.5 38 89.5 39 108.5 40 111.0 41 129.0 42 142.5 43 162.5 44 179.0 45 187.0 46 206.0 47 200.5 48 180.5 49 169.0 50 155.5 51 138.5 52 127.5 53 131.5 54 127.0 55 107.0 56 92.5 57 85.0 58 85.5 59 76.5 60 69.5 61 72.0 62 63.5 63 60.0 64 60.0 65 64.0 66 60.0 67 43.5 68 40.5 69 38.5 70 32.5 71 31.0 72 25.5 73 16.0 74 15.5 75 15.0 76 10.5 77 9.0 78 7.0 79 6.5 80 3.5 81 0.5 82 1.0 83 1.0 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.925 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91703976823808 90.10000000000001 2 4.819594416644719 9.15 3 0.26336581511719775 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.45 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.4125 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.9625 0.0 0.0 0.0 0.0 130-131 4.237500000000001 0.0 0.0 0.0 0.0 132-133 4.55 0.0 0.0 0.0 0.0 134-135 5.050000000000001 0.0 0.0 0.0 0.0 136-137 5.5125 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCAA 10 0.006830828 145.0 4 CCTTTAT 10 0.006830828 145.0 6 >>END_MODULE SRR7814863 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814863_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1275 37.0 37.0 37.0 37.0 37.0 2 35.6605 37.0 37.0 37.0 37.0 37.0 3 35.7385 37.0 37.0 37.0 37.0 37.0 4 36.0085 37.0 37.0 37.0 37.0 37.0 5 35.8155 37.0 37.0 37.0 37.0 37.0 6 35.668 37.0 37.0 37.0 37.0 37.0 7 35.6855 37.0 37.0 37.0 37.0 37.0 8 35.7305 37.0 37.0 37.0 37.0 37.0 9 35.6765 37.0 37.0 37.0 37.0 37.0 10-14 35.6582 37.0 37.0 37.0 37.0 37.0 15-19 35.5447 37.0 37.0 37.0 37.0 37.0 20-24 35.522299999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.4739 37.0 37.0 37.0 37.0 37.0 30-34 35.3789 37.0 37.0 37.0 37.0 37.0 35-39 35.3759 37.0 37.0 37.0 37.0 37.0 40-44 35.316500000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.2755 37.0 37.0 37.0 37.0 37.0 50-54 35.227199999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.2549 37.0 37.0 37.0 37.0 37.0 60-64 35.107800000000005 37.0 37.0 37.0 32.2 37.0 65-69 35.088499999999996 37.0 37.0 37.0 29.8 37.0 70-74 35.0222 37.0 37.0 37.0 27.4 37.0 75-79 35.0355 37.0 37.0 37.0 29.8 37.0 80-84 34.992 37.0 37.0 37.0 29.8 37.0 85-89 34.9051 37.0 37.0 37.0 25.0 37.0 90-94 34.866200000000006 37.0 37.0 37.0 25.0 37.0 95-99 34.7939 37.0 37.0 37.0 25.0 37.0 100-104 34.7309 37.0 37.0 37.0 25.0 37.0 105-109 34.626 37.0 37.0 37.0 25.0 37.0 110-114 34.4785 37.0 37.0 37.0 25.0 37.0 115-119 34.5084 37.0 37.0 37.0 25.0 37.0 120-124 34.4889 37.0 37.0 37.0 25.0 37.0 125-129 34.3295 37.0 37.0 37.0 25.0 37.0 130-134 34.1395 37.0 37.0 37.0 25.0 37.0 135-139 33.868300000000005 37.0 37.0 37.0 25.0 37.0 140-144 33.9063 37.0 37.0 37.0 25.0 37.0 145-149 33.827200000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.11825 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 10.0 14 15.0 15 19.0 16 8.0 17 12.0 18 7.0 19 8.0 20 7.0 21 15.0 22 16.0 23 20.0 24 18.0 25 12.0 26 24.0 27 16.0 28 33.0 29 35.0 30 44.0 31 60.0 32 86.0 33 164.0 34 288.0 35 798.0 36 2206.0 37 78.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.375 19.925 7.825 24.875 2 31.424999999999997 20.849999999999998 24.0 23.724999999999998 3 26.125 23.674999999999997 27.650000000000002 22.55 4 29.4 29.65 18.075 22.875 5 29.349999999999998 31.474999999999998 18.075 21.099999999999998 6 25.900000000000002 34.300000000000004 16.950000000000003 22.85 7 25.374999999999996 19.675 31.275 23.674999999999997 8 24.8 24.7 21.05 29.45 9 25.900000000000002 22.775000000000002 23.375 27.950000000000003 10-14 27.48 25.424999999999997 21.5 25.595000000000002 15-19 27.3 24.995 22.855 24.85 20-24 27.150000000000002 25.195 22.985 24.67 25-29 26.86 24.715 23.0 25.424999999999997 30-34 27.150000000000002 25.285000000000004 22.765 24.8 35-39 26.455000000000002 25.06 22.99 25.495 40-44 27.474999999999998 24.95 22.235 25.34 45-49 27.48 25.014999999999997 23.595 23.91 50-54 26.545 25.395 23.43 24.63 55-59 26.825 25.525 22.96 24.69 60-64 26.645000000000003 25.6 22.91 24.845 65-69 26.75 25.35 23.385 24.515 70-74 26.685 25.455 23.04 24.82 75-79 26.76 24.92 23.71 24.610000000000003 80-84 26.71 26.255 22.73 24.305 85-89 27.334999999999997 25.185000000000002 23.14 24.34 90-94 27.005000000000003 25.779999999999998 23.46 23.755000000000003 95-99 27.589999999999996 25.385 23.330000000000002 23.695 100-104 27.365000000000002 24.83 23.27 24.535 105-109 27.529999999999998 25.365 23.115 23.990000000000002 110-114 26.745 25.75 23.68 23.825 115-119 27.27 26.145000000000003 22.66 23.925 120-124 27.58 26.119999999999997 22.975 23.325000000000003 125-129 27.16 26.21 23.369999999999997 23.26 130-134 28.050000000000004 25.19 23.555 23.205000000000002 135-139 27.77 26.229999999999997 22.825 23.175 140-144 27.615000000000002 26.245 23.18 22.96 145-149 28.255000000000003 25.35 23.66 22.735 150-151 27.8875 25.25 22.7125 24.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 1.5 10 3.5 11 2.0 12 1.0 13 1.0 14 0.0 15 2.0 16 2.5 17 3.5 18 3.0 19 1.0 20 3.5 21 3.0 22 1.5 23 1.5 24 2.5 25 3.5 26 2.5 27 2.0 28 2.5 29 4.5 30 6.0 31 7.5 32 7.5 33 8.0 34 20.0 35 29.5 36 36.5 37 50.5 38 63.5 39 78.5 40 96.0 41 108.0 42 121.5 43 134.5 44 143.5 45 164.0 46 170.5 47 166.5 48 174.5 49 160.5 50 145.0 51 152.0 52 145.5 53 131.0 54 125.5 55 122.0 56 107.0 57 95.5 58 96.0 59 87.0 60 82.5 61 83.0 62 78.0 63 74.0 64 63.5 65 63.5 66 76.0 67 69.0 68 58.0 69 52.5 70 45.0 71 38.0 72 37.5 73 34.0 74 25.0 75 23.0 76 18.5 77 11.5 78 6.5 79 6.0 80 5.0 81 2.5 82 1.5 83 2.5 84 2.0 85 1.5 86 2.0 87 1.0 88 1.0 89 1.0 90 0.5 91 1.0 92 2.5 93 2.5 94 2.5 95 2.0 96 0.5 97 1.5 98 2.5 99 2.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 95.246897280169 90.17500000000001 2 4.409823078954318 8.35 3 0.2112490097702667 0.6 4 0.07921837866385001 0.3 5 0.0 0.0 6 0.026406126221283337 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026406126221283337 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.05 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.9749999999999999 0.0 0.0 0.0 0.0 118-119 2.1 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.7249999999999996 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.975 0.0 0.0 0.0 0.0 130-131 4.3 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 5.1 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 6.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTGA 10 0.006830828 145.0 4 GAGTGTA 10 0.006830828 145.0 3 AGTGTAT 10 0.006830828 145.0 4 >>END_MODULE Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra Read 1849580 spots for SRR7814863.sra Written 1849580 spots for SRR7814863.sra SRR ids: ['SRR7814863.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h1mzsaer SRR7814863.sra spots: 36991600 blocks: [[1, 1849580], [1849581, 3699160], [3699161, 5548740], [5548741, 7398320], [7398321, 9247900], [9247901, 11097480], [11097481, 12947060], [12947061, 14796640], [14796641, 16646220], [16646221, 18495800], [18495801, 20345380], [20345381, 22194960], [22194961, 24044540], [24044541, 25894120], [25894121, 27743700], [27743701, 29593280], [29593281, 31442860], [31442861, 33292440], [33292441, 35142020], [35142021, 36991600]] SRR7814863 file size 12513539 SRR7814863 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814863 SRR7814863_1.fastq SRR7814863_2.fastq Input file: SRR7814863_1.fastq Paired file: SRR7814863_2.fastq trimmed: SRR7814863-trimmed-pair1.fastq, SRR7814863-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:07:49 2024 >> started Fri Dec 6 13:08:38 2024 >> done (49.308s) 36991600 read pairs processed; of these: 156 ( 0.00%) short read pairs filtered out after trimming by size control 38375 ( 0.10%) empty read pairs filtered out after trimming by size control 36953069 (99.90%) read pairs available; of these: 3567568 ( 9.65%) trimmed read pairs available after processing 33385501 (90.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 19 0.00% 20 21 0.00% 21 36 0.00% 22 20 0.00% 23 27 0.00% 24 32 0.00% 25 38 0.00% 26 33 0.00% 27 38 0.00% 28 42 0.00% 29 51 0.00% 30 50 0.00% 31 55 0.00% 32 67 0.00% 33 57 0.00% 34 40 0.00% 35 72 0.00% 36 76 0.00% 37 70 0.00% 38 84 0.00% 39 95 0.00% 40 84 0.00% 41 82 0.00% 42 112 0.00% 43 84 0.00% 44 92 0.00% 45 115 0.00% 46 102 0.00% 47 132 0.00% 48 139 0.00% 49 156 0.00% 50 159 0.00% 51 191 0.00% 52 220 0.00% 53 212 0.00% 54 214 0.00% 55 243 0.00% 56 273 0.00% 57 275 0.00% 58 322 0.00% 59 346 0.00% 60 447 0.00% 61 455 0.00% 62 540 0.00% 63 559 0.00% 64 622 0.00% 65 657 0.00% 66 705 0.00% 67 788 0.00% 68 933 0.00% 69 1069 0.00% 70 1128 0.00% 71 1306 0.00% 72 1633 0.00% 73 1721 0.00% 74 1957 0.01% 75 2119 0.01% 76 2281 0.01% 77 2538 0.01% 78 2890 0.01% 79 3234 0.01% 80 3598 0.01% 81 4141 0.01% 82 4613 0.01% 83 5297 0.01% 84 5904 0.02% 85 6564 0.02% 86 7258 0.02% 87 7822 0.02% 88 8483 0.02% 89 9205 0.02% 90 10271 0.03% 91 11382 0.03% 92 12435 0.03% 93 14140 0.04% 94 15205 0.04% 95 16335 0.04% 96 17680 0.05% 97 18746 0.05% 98 19597 0.05% 99 21049 0.06% 100 22931 0.06% 101 24246 0.07% 102 26005 0.07% 103 28278 0.08% 104 29653 0.08% 105 31611 0.09% 106 32638 0.09% 107 33886 0.09% 108 35764 0.10% 109 37326 0.10% 110 38626 0.10% 111 40794 0.11% 112 42735 0.12% 113 44701 0.12% 114 46707 0.13% 115 48618 0.13% 116 50287 0.14% 117 51813 0.14% 118 52259 0.14% 119 53792 0.15% 120 56158 0.15% 121 57876 0.16% 122 59748 0.16% 123 62302 0.17% 124 64693 0.18% 125 66294 0.18% 126 67926 0.18% 127 68949 0.19% 128 69844 0.19% 129 71828 0.19% 130 72861 0.20% 131 74361 0.20% 132 76247 0.21% 133 79343 0.21% 134 81836 0.22% 135 82750 0.22% 136 84494 0.23% 137 85422 0.23% 138 86830 0.23% 139 88751 0.24% 140 89109 0.24% 141 91053 0.25% 142 93367 0.25% 143 94267 0.26% 144 96519 0.26% 145 99866 0.27% 146 101824 0.28% 147 103850 0.28% 148 102944 0.28% 149 104496 0.28% 150 107184 0.29% 151 33385501 90.35% 36953069 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=27 prefix-density=0.30 prefix-fanout=2.9 sequence=AATCATCTTCAC criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=296.26 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=32.7 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=28 prefix-density=0.41 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=811.87 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=19.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814863 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:09:33 Started mapping on | Dec 06 13:09:35 Finished on | Dec 06 13:20:45 Mapping speed, Million of reads per hour | 198.55 Number of input reads | 36953069 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 31779320 Uniquely mapped reads % | 86.00% Average mapped length | 295.67 Number of splices: Total | 30374650 Number of splices: Annotated (sjdb) | 28621706 Number of splices: GT/AG | 29929740 Number of splices: GC/AG | 355797 Number of splices: AT/AC | 22425 Number of splices: Non-canonical | 66688 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 3.08 Insertion rate per base | 0.03% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 584120 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 23212 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.93% % of reads unmapped: other | 0.43% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4589629 4589629 4589629 N_multimapping 584120 584120 584120 N_noFeature 735913 30934401 1004442 N_ambiguous 663022 3913 90472 UnstrandedReadsAssigned:30380385 PositiveStrandReadsAssigned:841006 NegativeStrandReadsAssigned:30684406 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814863 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814863-trimmed-pair1.fastq SRR7814863-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,953,069 reads, 31,869,090 reads pseudoaligned [quant] estimated average fragment length: 267.949 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,352 rounds 52973 SRR7814863.ke.tsv 35125 SRR7814863.se.tsv 88098 total ==> SRR7814863.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 669.507 0 0 PNS24247 1044 777.051 84.312 4.32699 PNS24249 1928 1661.05 290.23 6.96796 PNS24246 1044 777.051 84.312 4.32699 PNS24248 1044 777.051 84.312 4.32699 PNS24244 1471 1204.05 356.834 11.8186 PNS24243 293 93.8662 0 0 KQK14069 1603 1336.05 7769.61 231.912 KQK14071 474 229.787 70.5079 12.2366 ==> SRR7814863.se.tsv <== BRADI_1g14170v3 7924 BRADI_1g53295v3 1238 BRADI_1g59795v3 131 BRADI_1g07683v3 0 BRADI_1g00485v3 131 BRADI_1g20270v3 3000 BRADI_1g74790v3 273 BRADI_1g09890v3 0 BRADI_1g77505v3 544 BRADI_1g48960v3 0 SRR7814863 completed mapping pipeline successfully