Starting /dee2/code/volunteer_pipeline.sh SRR7814927 current disk space = 1551214047232 free memory = 1594005428 SRR7814927 SRAfilesize 9a2bda67de5bb073700b86ec38b9f66f SRR7814927.sra SRR7814927.sra file validated SRR7814927 is paired end SRR7814927 is conventional basespace SRR7814927 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814927_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.388 37.0 37.0 37.0 37.0 37.0 2 36.3285 37.0 37.0 37.0 37.0 37.0 3 36.4225 37.0 37.0 37.0 37.0 37.0 4 36.5015 37.0 37.0 37.0 37.0 37.0 5 36.498 37.0 37.0 37.0 37.0 37.0 6 36.4415 37.0 37.0 37.0 37.0 37.0 7 36.4735 37.0 37.0 37.0 37.0 37.0 8 36.528 37.0 37.0 37.0 37.0 37.0 9 36.614 37.0 37.0 37.0 37.0 37.0 10-14 36.53490000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.4884 37.0 37.0 37.0 37.0 37.0 20-24 36.4918 37.0 37.0 37.0 37.0 37.0 25-29 36.439299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.454499999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4207 37.0 37.0 37.0 37.0 37.0 40-44 36.4528 37.0 37.0 37.0 37.0 37.0 45-49 36.3694 37.0 37.0 37.0 37.0 37.0 50-54 36.347699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.335100000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.313300000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.26460000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.1863 37.0 37.0 37.0 37.0 37.0 75-79 36.206 37.0 37.0 37.0 37.0 37.0 80-84 36.1498 37.0 37.0 37.0 37.0 37.0 85-89 36.1519 37.0 37.0 37.0 37.0 37.0 90-94 36.083200000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.154900000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0204 37.0 37.0 37.0 37.0 37.0 105-109 35.9833 37.0 37.0 37.0 37.0 37.0 110-114 35.968199999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.90509999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.7862 37.0 37.0 37.0 37.0 37.0 125-129 35.6887 37.0 37.0 37.0 37.0 37.0 130-134 35.69070000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.7194 37.0 37.0 37.0 37.0 37.0 140-144 35.537299999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.4981 37.0 37.0 37.0 34.6 37.0 150-151 34.671499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 8.0 27 8.0 28 13.0 29 21.0 30 23.0 31 43.0 32 51.0 33 95.0 34 158.0 35 411.0 36 2931.0 37 235.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.264897346019026 13.620430645968954 10.640961442163245 32.473710565848776 2 26.400000000000002 17.974999999999998 31.424999999999997 24.2 3 22.45 25.2 24.425 27.925 4 27.275 31.825 19.900000000000002 21.0 5 24.675 33.225 21.15 20.95 6 22.225 33.425 21.0 23.35 7 16.525000000000002 20.549999999999997 40.949999999999996 21.975 8 20.275000000000002 20.525 27.275 31.924999999999997 9 22.925 19.900000000000002 29.925 27.250000000000004 10-14 23.385 26.155 24.58 25.88 15-19 23.645 24.645 25.53 26.179999999999996 20-24 23.56 25.740000000000002 25.45 25.25 25-29 23.549999999999997 24.63 25.27 26.55 30-34 23.86 25.064999999999998 25.14 25.935000000000002 35-39 23.599999999999998 24.77 25.365 26.265 40-44 23.835 25.215 24.98 25.97 45-49 24.135 24.97 24.925 25.97 50-54 23.96 24.884999999999998 24.935 26.22 55-59 23.89 25.255 24.615000000000002 26.240000000000002 60-64 23.895 24.935 24.959999999999997 26.21 65-69 23.665 25.119999999999997 24.645 26.57 70-74 24.095 24.884999999999998 24.935 26.085 75-79 24.135 24.86 25.03 25.974999999999998 80-84 24.765 24.715 25.005 25.515 85-89 24.099999999999998 24.990000000000002 24.545 26.365 90-94 24.675 25.169999999999998 24.03 26.125 95-99 24.015 25.095 24.075 26.815 100-104 24.295 24.535 24.39 26.779999999999998 105-109 24.4 24.68 24.560000000000002 26.36 110-114 24.27 24.325 24.64 26.765 115-119 24.05 24.04 25.264999999999997 26.645000000000003 120-124 25.040000000000003 24.36 24.02 26.58 125-129 24.985 24.435000000000002 24.375 26.205000000000002 130-134 25.119999999999997 24.605 23.974999999999998 26.3 135-139 24.815 24.365000000000002 24.265 26.555 140-144 24.02 24.625 24.68 26.674999999999997 145-149 26.0 23.465 24.779999999999998 25.755 150-151 24.85 24.625 24.5125 26.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.0 26 0.5 27 2.5 28 4.5 29 4.5 30 7.0 31 10.5 32 11.0 33 16.0 34 29.0 35 34.0 36 40.5 37 64.0 38 78.0 39 90.0 40 112.0 41 132.0 42 153.0 43 168.0 44 180.0 45 181.5 46 195.5 47 195.0 48 184.0 49 177.5 50 152.0 51 150.0 52 150.0 53 130.0 54 121.0 55 110.0 56 96.0 57 90.0 58 87.0 59 80.5 60 70.5 61 77.0 62 72.0 63 64.5 64 60.5 65 48.0 66 52.0 67 56.5 68 53.0 69 45.5 70 36.0 71 26.0 72 16.5 73 18.5 74 23.0 75 18.0 76 7.5 77 5.5 78 4.5 79 2.5 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 91.93460490463215 84.35000000000001 2 7.247956403269755 13.3 3 0.7356948228882834 2.025 4 0.05449591280653951 0.2 5 0.027247956403269755 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAAAATCAAGTGGATGATATGTAGGTGGAGAGACCAATAATCTTGGATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.42500000000000004 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1 0.0 0.0 0.0 0.0 134-135 1.1625 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138-139 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCATTA 10 0.006830828 145.0 1 >>END_MODULE SRR7814927 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814927_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4175 37.0 37.0 37.0 37.0 37.0 2 36.1185 37.0 37.0 37.0 37.0 37.0 3 36.3045 37.0 37.0 37.0 37.0 37.0 4 36.279 37.0 37.0 37.0 37.0 37.0 5 36.288 37.0 37.0 37.0 37.0 37.0 6 36.2405 37.0 37.0 37.0 37.0 37.0 7 36.1425 37.0 37.0 37.0 37.0 37.0 8 36.1485 37.0 37.0 37.0 37.0 37.0 9 36.228 37.0 37.0 37.0 37.0 37.0 10-14 36.144999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.0891 37.0 37.0 37.0 37.0 37.0 20-24 36.0493 37.0 37.0 37.0 37.0 37.0 25-29 36.0 37.0 37.0 37.0 37.0 37.0 30-34 35.9533 37.0 37.0 37.0 37.0 37.0 35-39 35.903800000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.8686 37.0 37.0 37.0 37.0 37.0 45-49 35.8121 37.0 37.0 37.0 37.0 37.0 50-54 35.641600000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.4639 37.0 37.0 37.0 37.0 37.0 60-64 35.588100000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.575199999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.468 37.0 37.0 37.0 37.0 37.0 75-79 35.383799999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.3029 37.0 37.0 37.0 34.6 37.0 85-89 35.258 37.0 37.0 37.0 32.2 37.0 90-94 35.1623 37.0 37.0 37.0 27.4 37.0 95-99 34.912800000000004 37.0 37.0 37.0 27.4 37.0 100-104 34.861000000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.6606 37.0 37.0 37.0 25.0 37.0 110-114 34.6982 37.0 37.0 37.0 25.0 37.0 115-119 34.78829999999999 37.0 37.0 37.0 25.0 37.0 120-124 34.5168 37.0 37.0 37.0 25.0 37.0 125-129 34.5835 37.0 37.0 37.0 25.0 37.0 130-134 34.21210000000001 37.0 37.0 37.0 25.0 37.0 135-139 33.94780000000001 37.0 37.0 37.0 25.0 37.0 140-144 34.26 37.0 37.0 37.0 25.0 37.0 145-149 34.0022 37.0 37.0 37.0 25.0 37.0 150-151 33.5045 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 5.0 15 11.0 16 7.0 17 5.0 18 4.0 19 5.0 20 7.0 21 5.0 22 5.0 23 16.0 24 12.0 25 8.0 26 9.0 27 22.0 28 21.0 29 20.0 30 39.0 31 62.0 32 89.0 33 173.0 34 337.0 35 889.0 36 2187.0 37 59.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.375 16.05 11.725 30.85 2 30.625000000000004 20.8 25.95 22.625 3 24.775 23.400000000000002 27.125 24.7 4 27.575 29.925 18.4 24.099999999999998 5 27.500000000000004 33.25 17.2 22.05 6 23.075000000000003 34.5 18.3 24.125 7 21.775 15.7 36.725 25.8 8 23.7 19.875 22.25 34.175 9 25.074999999999996 21.875 24.925 28.125 10-14 26.155 24.759999999999998 21.98 27.105 15-19 25.825 24.57 23.425 26.179999999999996 20-24 26.375 25.035 23.32 25.27 25-29 26.525 24.825 23.315 25.335 30-34 25.840000000000003 24.69 23.880000000000003 25.590000000000003 35-39 26.6 25.080000000000002 22.88 25.44 40-44 26.450000000000003 25.064999999999998 22.57 25.915 45-49 26.334999999999997 24.855 23.29 25.52 50-54 27.189999999999998 25.395 22.869999999999997 24.545 55-59 26.979999999999997 24.935 22.86 25.224999999999998 60-64 26.38 25.06 23.285 25.275 65-69 26.55 25.545 22.865 25.040000000000003 70-74 26.655 25.665 22.85 24.83 75-79 26.435 24.935 23.51 25.119999999999997 80-84 26.705000000000002 25.31 23.335 24.65 85-89 26.97 25.3 22.96 24.77 90-94 26.61 25.4 23.285 24.705 95-99 26.56 25.52 22.85 25.069999999999997 100-104 27.355 24.67 23.49 24.485 105-109 26.39 24.81 23.905 24.895 110-114 26.63 25.305 22.875 25.19 115-119 26.419999999999998 25.374999999999996 23.835 24.37 120-124 26.700000000000003 25.419999999999998 23.095 24.785 125-129 26.784999999999997 24.925 23.165 25.124999999999996 130-134 27.139999999999997 25.355 22.96 24.545 135-139 27.384999999999998 24.695 23.57 24.349999999999998 140-144 27.255000000000003 25.369999999999997 23.119999999999997 24.255 145-149 27.12 24.834999999999997 23.935000000000002 24.11 150-151 27.5125 25.587500000000002 23.225 23.674999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 1.0 9 1.5 10 1.0 11 1.0 12 1.5 13 1.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 4.5 26 6.0 27 3.0 28 1.5 29 3.5 30 4.5 31 7.5 32 12.5 33 14.0 34 15.5 35 22.5 36 37.0 37 46.5 38 49.0 39 54.0 40 74.0 41 105.0 42 124.0 43 140.0 44 159.0 45 168.0 46 178.0 47 179.5 48 169.5 49 169.5 50 149.0 51 142.5 52 138.5 53 122.5 54 123.5 55 118.5 56 115.5 57 118.0 58 108.0 59 91.0 60 97.0 61 93.0 62 76.0 63 76.0 64 79.5 65 81.0 66 79.0 67 64.5 68 58.0 69 58.0 70 48.0 71 40.5 72 35.0 73 26.0 74 23.5 75 18.5 76 10.0 77 8.5 78 6.5 79 5.0 80 3.5 81 2.0 82 2.0 83 2.0 84 1.0 85 0.0 86 1.0 87 1.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.24489795918367 84.75 2 6.938775510204081 12.75 3 0.7074829931972789 1.95 4 0.0816326530612245 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027210884353741496 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.32499999999999996 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.42500000000000004 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6875 0.0 0.0 0.0 0.0 124-125 0.8375 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.0375 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3 0.0 0.0 0.0 0.0 136-137 1.3875 0.0 0.0 0.0 0.0 138-139 1.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCGTCT 10 0.006830828 145.0 3 CAAAGGT 10 0.006830828 145.0 3 GAAGGCA 10 0.006830828 145.0 4 >>END_MODULE Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965501 spots for SRR7814927.sra Written 1965501 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra Read 1965483 spots for SRR7814927.sra Written 1965483 spots for SRR7814927.sra SRR ids: ['SRR7814927.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i7gbq0e0 SRR7814927.sra spots: 39309678 blocks: [[1, 1965483], [1965484, 3930966], [3930967, 5896449], [5896450, 7861932], [7861933, 9827415], [9827416, 11792898], [11792899, 13758381], [13758382, 15723864], [15723865, 17689347], [17689348, 19654830], [19654831, 21620313], [21620314, 23585796], [23585797, 25551279], [25551280, 27516762], [27516763, 29482245], [29482246, 31447728], [31447729, 33413211], [33413212, 35378694], [35378695, 37344177], [37344178, 39309678]] SRR7814927 file size 13299059 SRR7814927 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814927 SRR7814927_1.fastq SRR7814927_2.fastq Input file: SRR7814927_1.fastq Paired file: SRR7814927_2.fastq trimmed: SRR7814927-trimmed-pair1.fastq, SRR7814927-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:09:44 2024 >> started Fri Dec 6 13:11:07 2024 >> done (83.537s) 39309678 read pairs processed; of these: 107 ( 0.00%) short read pairs filtered out after trimming by size control 5124 ( 0.01%) empty read pairs filtered out after trimming by size control 39304447 (99.99%) read pairs available; of these: 1019472 ( 2.59%) trimmed read pairs available after processing 38284975 (97.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 23 0.00% 20 17 0.00% 21 25 0.00% 22 33 0.00% 23 28 0.00% 24 38 0.00% 25 30 0.00% 26 47 0.00% 27 43 0.00% 28 46 0.00% 29 39 0.00% 30 72 0.00% 31 61 0.00% 32 82 0.00% 33 67 0.00% 34 51 0.00% 35 72 0.00% 36 68 0.00% 37 113 0.00% 38 100 0.00% 39 83 0.00% 40 72 0.00% 41 79 0.00% 42 94 0.00% 43 92 0.00% 44 96 0.00% 45 107 0.00% 46 109 0.00% 47 114 0.00% 48 107 0.00% 49 123 0.00% 50 125 0.00% 51 116 0.00% 52 128 0.00% 53 137 0.00% 54 164 0.00% 55 174 0.00% 56 135 0.00% 57 168 0.00% 58 164 0.00% 59 191 0.00% 60 172 0.00% 61 191 0.00% 62 184 0.00% 63 178 0.00% 64 241 0.00% 65 200 0.00% 66 222 0.00% 67 261 0.00% 68 261 0.00% 69 305 0.00% 70 352 0.00% 71 344 0.00% 72 392 0.00% 73 459 0.00% 74 431 0.00% 75 505 0.00% 76 484 0.00% 77 564 0.00% 78 632 0.00% 79 695 0.00% 80 701 0.00% 81 788 0.00% 82 970 0.00% 83 1049 0.00% 84 1110 0.00% 85 1199 0.00% 86 1239 0.00% 87 1424 0.00% 88 1553 0.00% 89 1730 0.00% 90 1913 0.00% 91 1994 0.01% 92 2322 0.01% 93 2435 0.01% 94 2768 0.01% 95 2882 0.01% 96 3137 0.01% 97 3442 0.01% 98 3585 0.01% 99 3904 0.01% 100 4222 0.01% 101 4475 0.01% 102 4924 0.01% 103 5459 0.01% 104 5588 0.01% 105 6030 0.02% 106 6265 0.02% 107 6571 0.02% 108 6915 0.02% 109 7502 0.02% 110 7835 0.02% 111 8440 0.02% 112 9058 0.02% 113 9536 0.02% 114 10095 0.03% 115 10666 0.03% 116 11067 0.03% 117 11319 0.03% 118 11780 0.03% 119 12680 0.03% 120 13002 0.03% 121 13664 0.03% 122 14325 0.04% 123 15600 0.04% 124 16223 0.04% 125 17032 0.04% 126 17533 0.04% 127 17862 0.05% 128 18628 0.05% 129 19216 0.05% 130 19839 0.05% 131 21108 0.05% 132 22184 0.06% 133 23392 0.06% 134 24164 0.06% 135 25518 0.06% 136 26293 0.07% 137 26894 0.07% 138 28192 0.07% 139 29015 0.07% 140 29586 0.08% 141 31164 0.08% 142 32301 0.08% 143 33492 0.09% 144 35235 0.09% 145 36655 0.09% 146 37828 0.10% 147 38620 0.10% 148 39829 0.10% 149 40662 0.10% 150 43118 0.11% 151 38284975 97.41% 39304447 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=4.81 fanout-score-rank=21 prefix-density=0.30 prefix-fanout=4.3 sequence=TGCCGCACTTGCAGCCTCCGTTCTCGGCTCCGGCGGCGGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=296.91 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=23.7 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=19 prefix-density=0.60 prefix-fanout=3.4 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=178.93 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=22.1 sequence=CGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR7814927 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:11:59 Started mapping on | Dec 06 13:11:59 Finished on | Dec 06 13:22:04 Mapping speed, Million of reads per hour | 233.88 Number of input reads | 39304447 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 35379701 Uniquely mapped reads % | 90.01% Average mapped length | 300.08 Number of splices: Total | 35204017 Number of splices: Annotated (sjdb) | 32998293 Number of splices: GT/AG | 34763223 Number of splices: GC/AG | 388865 Number of splices: AT/AC | 22385 Number of splices: Non-canonical | 29544 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327714 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 31830 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.42% % of reads unmapped: other | 0.65% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3597032 3597032 3597032 N_multimapping 327714 327714 327714 N_noFeature 967525 34432370 1297222 N_ambiguous 740360 6349 126452 UnstrandedReadsAssigned:33671816 PositiveStrandReadsAssigned:940982 NegativeStrandReadsAssigned:33956027 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814927 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814927-trimmed-pair1.fastq SRR7814927-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,304,447 reads, 34,714,255 reads pseudoaligned [quant] estimated average fragment length: 317.584 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR7814927.ke.tsv 35125 SRR7814927.se.tsv 88098 total ==> SRR7814927.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 620.362 0 0 PNS24247 1044 727.416 148.768 7.63189 PNS24249 1928 1611.42 286.384 6.63204 PNS24246 1044 727.416 148.768 7.63189 PNS24248 1044 727.416 148.768 7.63189 PNS24244 1471 1154.42 245.312 7.92981 PNS24243 293 72.118 1 0.517442 KQK14069 1603 1286.42 19411.5 563.098 KQK14071 474 193.259 116.167 22.4309 ==> SRR7814927.se.tsv <== BRADI_1g14170v3 19461 BRADI_1g53295v3 519 BRADI_1g59795v3 667 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 1455 BRADI_1g74790v3 383 BRADI_1g09890v3 0 BRADI_1g77505v3 374 BRADI_1g48960v3 0 SRR7814927 completed mapping pipeline successfully