Starting /dee2/code/volunteer_pipeline.sh SRR7814928 current disk space = 1551038308352 free memory = 1389101140 SRR7814928 SRAfilesize 3ed48883bfebf292d8c79bc0535ac773 SRR7814928.sra SRR7814928.sra file validated SRR7814928 is paired end SRR7814928 is conventional basespace SRR7814928 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814928_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2415 37.0 37.0 37.0 37.0 37.0 2 36.139 37.0 37.0 37.0 37.0 37.0 3 36.386 37.0 37.0 37.0 37.0 37.0 4 36.469 37.0 37.0 37.0 37.0 37.0 5 36.448 37.0 37.0 37.0 37.0 37.0 6 36.493 37.0 37.0 37.0 37.0 37.0 7 36.402 37.0 37.0 37.0 37.0 37.0 8 36.4665 37.0 37.0 37.0 37.0 37.0 9 36.522 37.0 37.0 37.0 37.0 37.0 10-14 36.4745 37.0 37.0 37.0 37.0 37.0 15-19 36.4727 37.0 37.0 37.0 37.0 37.0 20-24 36.4384 37.0 37.0 37.0 37.0 37.0 25-29 36.37800000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.4013 37.0 37.0 37.0 37.0 37.0 35-39 36.354 37.0 37.0 37.0 37.0 37.0 40-44 36.3095 37.0 37.0 37.0 37.0 37.0 45-49 36.303399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.2498 37.0 37.0 37.0 37.0 37.0 55-59 36.272299999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.1908 37.0 37.0 37.0 37.0 37.0 65-69 36.139300000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.086 37.0 37.0 37.0 37.0 37.0 75-79 36.1141 37.0 37.0 37.0 37.0 37.0 80-84 36.0672 37.0 37.0 37.0 37.0 37.0 85-89 36.039699999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.9649 37.0 37.0 37.0 37.0 37.0 95-99 35.9399 37.0 37.0 37.0 37.0 37.0 100-104 35.8589 37.0 37.0 37.0 37.0 37.0 105-109 35.871900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8115 37.0 37.0 37.0 37.0 37.0 115-119 35.8018 37.0 37.0 37.0 37.0 37.0 120-124 35.6871 37.0 37.0 37.0 37.0 37.0 125-129 35.595099999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.5173 37.0 37.0 37.0 37.0 37.0 135-139 35.5319 37.0 37.0 37.0 37.0 37.0 140-144 35.425200000000004 37.0 37.0 37.0 34.6 37.0 145-149 35.322199999999995 37.0 37.0 37.0 32.2 37.0 150-151 34.48125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 0.0 23 4.0 24 4.0 25 4.0 26 3.0 27 10.0 28 19.0 29 15.0 30 39.0 31 47.0 32 62.0 33 100.0 34 185.0 35 453.0 36 2816.0 37 236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.669010547463586 13.736815670517327 8.237066800602712 29.357106981416376 2 25.775 17.075000000000003 32.0 25.15 3 21.675 25.75 25.624999999999996 26.950000000000003 4 28.199999999999996 30.725 19.900000000000002 21.175 5 25.424999999999997 31.35 22.825 20.4 6 22.25 31.225 23.125 23.400000000000002 7 17.9 20.05 40.425 21.625 8 21.475 20.65 27.250000000000004 30.625000000000004 9 21.7 18.8 29.625 29.875 10-14 23.935000000000002 25.130000000000003 24.01 26.924999999999997 15-19 24.2 24.675 25.335 25.790000000000003 20-24 24.654999999999998 24.235 25.115 25.995 25-29 23.925 25.355 24.48 26.240000000000002 30-34 24.154999999999998 24.905 24.59 26.35 35-39 23.765 24.545 25.09 26.6 40-44 24.635 23.47 25.095 26.8 45-49 24.085 24.875 24.765 26.275 50-54 24.415 23.645 24.605 27.334999999999997 55-59 24.305 24.395 23.985 27.315 60-64 24.875 24.099999999999998 24.42 26.605 65-69 24.84 24.16 24.595 26.405 70-74 24.959999999999997 24.104999999999997 24.42 26.515 75-79 25.31 23.98 24.04 26.669999999999998 80-84 24.72 24.085 24.47 26.724999999999998 85-89 24.695 24.349999999999998 24.715 26.240000000000002 90-94 25.705 24.275 24.01 26.009999999999998 95-99 25.009999999999998 23.635 24.425 26.93 100-104 25.41 23.405 23.945 27.24 105-109 25.259999999999998 23.96 24.529999999999998 26.25 110-114 24.915000000000003 23.95 23.72 27.415 115-119 25.05 24.3 23.185 27.465 120-124 25.05 23.805 24.375 26.77 125-129 25.590000000000003 23.615 24.34 26.455000000000002 130-134 25.775 24.16 23.425 26.640000000000004 135-139 25.775 23.294999999999998 23.73 27.200000000000003 140-144 25.974999999999998 23.365 24.275 26.384999999999998 145-149 25.435000000000002 23.82 24.044999999999998 26.700000000000003 150-151 24.837500000000002 23.7125 23.25 28.199999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 2.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 1.5 29 4.0 30 6.0 31 9.0 32 16.0 33 21.0 34 24.5 35 32.5 36 37.5 37 49.0 38 68.0 39 82.5 40 116.0 41 145.0 42 154.0 43 160.0 44 160.5 45 166.0 46 171.0 47 168.5 48 164.5 49 163.5 50 141.0 51 125.5 52 122.0 53 114.5 54 114.5 55 106.5 56 94.5 57 89.5 58 98.0 59 90.0 60 80.5 61 86.5 62 83.0 63 81.0 64 86.0 65 82.5 66 78.0 67 73.0 68 62.5 69 49.5 70 41.0 71 38.5 72 29.5 73 26.0 74 24.0 75 14.0 76 11.5 77 9.0 78 5.0 79 3.5 80 1.5 81 1.5 82 1.0 83 0.5 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.33333333333333 81.3 2 8.472222222222223 15.25 3 1.027777777777778 2.775 4 0.1111111111111111 0.4 5 0.027777777777777776 0.125 6 0.027777777777777776 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATCTTCATCCTCCTCTTCGTCAACATCAGATTCAGAGAAGGCGGCAG 6 0.15 No Hit GGGCACGTGTCCTTGCGCGAGAACAGGATCGGGAACGCCGTCCCCACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7875 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.2999999999999998 0.0 0.0 0.0 0.0 130-131 1.3875000000000002 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.5750000000000002 0.0 0.0 0.0 0.0 136-137 1.6749999999999998 0.0 0.0 0.0 0.0 138-139 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTCTT 10 0.006830828 145.0 5 >>END_MODULE SRR7814928 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814928_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2935 37.0 37.0 37.0 37.0 37.0 2 36.0305 37.0 37.0 37.0 37.0 37.0 3 36.084 37.0 37.0 37.0 37.0 37.0 4 36.09 37.0 37.0 37.0 37.0 37.0 5 36.201 37.0 37.0 37.0 37.0 37.0 6 36.0555 37.0 37.0 37.0 37.0 37.0 7 35.8635 37.0 37.0 37.0 37.0 37.0 8 35.961 37.0 37.0 37.0 37.0 37.0 9 36.07 37.0 37.0 37.0 37.0 37.0 10-14 36.0024 37.0 37.0 37.0 37.0 37.0 15-19 35.943599999999996 37.0 37.0 37.0 37.0 37.0 20-24 35.9079 37.0 37.0 37.0 37.0 37.0 25-29 35.8654 37.0 37.0 37.0 37.0 37.0 30-34 35.888 37.0 37.0 37.0 37.0 37.0 35-39 35.830499999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.7061 37.0 37.0 37.0 37.0 37.0 45-49 35.692400000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.545500000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.425200000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.4679 37.0 37.0 37.0 37.0 37.0 65-69 35.4168 37.0 37.0 37.0 37.0 37.0 70-74 35.305699999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.2638 37.0 37.0 37.0 32.2 37.0 80-84 35.138799999999996 37.0 37.0 37.0 29.8 37.0 85-89 35.1232 37.0 37.0 37.0 32.2 37.0 90-94 34.885000000000005 37.0 37.0 37.0 25.0 37.0 95-99 34.59349999999999 37.0 37.0 37.0 25.0 37.0 100-104 34.6069 37.0 37.0 37.0 25.0 37.0 105-109 34.4615 37.0 37.0 37.0 25.0 37.0 110-114 34.5452 37.0 37.0 37.0 25.0 37.0 115-119 34.6392 37.0 37.0 37.0 25.0 37.0 120-124 34.28869999999999 37.0 37.0 37.0 25.0 37.0 125-129 34.325599999999994 37.0 37.0 37.0 25.0 37.0 130-134 33.916 37.0 37.0 37.0 25.0 37.0 135-139 33.886900000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.0416 37.0 37.0 37.0 25.0 37.0 145-149 33.772400000000005 37.0 37.0 37.0 25.0 37.0 150-151 33.301249999999996 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 9.0 15 8.0 16 4.0 17 2.0 18 5.0 19 4.0 20 2.0 21 8.0 22 11.0 23 11.0 24 9.0 25 15.0 26 15.0 27 17.0 28 20.0 29 27.0 30 41.0 31 100.0 32 98.0 33 202.0 34 399.0 35 997.0 36 1939.0 37 51.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.65 15.125 9.2 28.025 2 29.875 20.349999999999998 25.4 24.375 3 27.500000000000004 22.55 25.15 24.8 4 29.975 31.35 16.075 22.6 5 28.249999999999996 32.75 16.425 22.575 6 23.65 33.775 17.424999999999997 25.15 7 22.725 16.875 35.525 24.875 8 23.225 20.075000000000003 21.975 34.725 9 24.5 20.875 24.125 30.5 10-14 26.85 24.709999999999997 21.915000000000003 26.525 15-19 26.865 23.95 22.605 26.58 20-24 26.450000000000003 24.855 22.485 26.21 25-29 26.845000000000002 24.5 22.58 26.075 30-34 26.88 24.59 22.43 26.1 35-39 26.805 24.64 22.485 26.07 40-44 26.805 24.36 22.775000000000002 26.06 45-49 27.334999999999997 24.285 22.425 25.955000000000002 50-54 27.150000000000002 24.645 22.720000000000002 25.485000000000003 55-59 27.49 24.515 22.34 25.655 60-64 27.27 23.855 22.74 26.135 65-69 26.715 24.135 23.0 26.150000000000002 70-74 27.36 24.575 22.405 25.66 75-79 27.215 23.825 23.11 25.85 80-84 27.250000000000004 23.52 22.98 26.25 85-89 27.35 24.385 22.345000000000002 25.919999999999998 90-94 26.950000000000003 24.565 23.115 25.369999999999997 95-99 27.625 24.5 22.36 25.515 100-104 27.07 24.310000000000002 22.49 26.13 105-109 27.575 24.72 22.435 25.27 110-114 27.52 24.315 22.645 25.52 115-119 27.584999999999997 24.43 21.905 26.08 120-124 27.139999999999997 24.4 22.830000000000002 25.629999999999995 125-129 28.065 25.055 22.13 24.75 130-134 27.650000000000002 24.545 22.41 25.395 135-139 27.805000000000003 25.28 21.955 24.959999999999997 140-144 27.725 24.765 22.384999999999998 25.124999999999996 145-149 27.905 24.755 21.84 25.5 150-151 27.037499999999998 24.8 22.825 25.337500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 2.0 15 2.0 16 1.0 17 2.5 18 3.0 19 1.0 20 0.5 21 1.5 22 1.5 23 1.5 24 2.0 25 1.5 26 1.5 27 3.0 28 4.5 29 4.5 30 6.0 31 10.0 32 8.5 33 9.0 34 12.0 35 21.5 36 28.0 37 31.5 38 47.0 39 63.5 40 89.5 41 106.5 42 112.5 43 134.5 44 137.0 45 140.0 46 162.0 47 172.0 48 150.5 49 137.5 50 130.5 51 123.5 52 130.0 53 122.5 54 108.0 55 95.5 56 99.0 57 104.5 58 105.5 59 110.0 60 109.0 61 104.0 62 110.5 63 97.0 64 77.0 65 74.5 66 80.0 67 93.0 68 91.5 69 75.0 70 61.5 71 52.0 72 45.0 73 34.5 74 35.0 75 38.0 76 27.5 77 14.5 78 9.0 79 6.5 80 1.5 81 1.5 82 4.0 83 3.5 84 0.5 85 0.0 86 1.0 87 1.0 88 0.5 89 0.5 90 1.0 91 1.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 0.5 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 90.61111111111111 81.55 2 8.055555555555555 14.499999999999998 3 1.0555555555555556 2.85 4 0.19444444444444445 0.7000000000000001 5 0.05555555555555555 0.25 6 0.027777777777777776 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGAACCACAGCCACCTGGTCCGGGAGGTGGACGTGCGCCTGTCGGCCCGC 6 0.15 No Hit GCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGG 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.38749999999999996 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.3250000000000002 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.4875 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.7000000000000002 0.0 0.0 0.0 0.0 138-139 1.9249999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAGG 10 0.006830828 145.0 145 CCTTTTT 10 0.006830828 145.0 145 >>END_MODULE Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277203 spots for SRR7814928.sra Written 3277203 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra Read 3277196 spots for SRR7814928.sra Written 3277196 spots for SRR7814928.sra SRR ids: ['SRR7814928.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g3pi5xbi SRR7814928.sra spots: 65543927 blocks: [[1, 3277196], [3277197, 6554392], [6554393, 9831588], [9831589, 13108784], [13108785, 16385980], [16385981, 19663176], [19663177, 22940372], [22940373, 26217568], [26217569, 29494764], [29494765, 32771960], [32771961, 36049156], [36049157, 39326352], [39326353, 42603548], [42603549, 45880744], [45880745, 49157940], [49157941, 52435136], [52435137, 55712332], [55712333, 58989528], [58989529, 62266724], [62266725, 65543927]] SRR7814928 file size 22188985 SRR7814928 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814928 SRR7814928_1.fastq SRR7814928_2.fastq Input file: SRR7814928_1.fastq Paired file: SRR7814928_2.fastq trimmed: SRR7814928-trimmed-pair1.fastq, SRR7814928-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 13:23:15 2024 >> started Fri Dec 6 13:24:42 2024 >> done (86.369s) 65543927 read pairs processed; of these: 232 ( 0.00%) short read pairs filtered out after trimming by size control 10156 ( 0.02%) empty read pairs filtered out after trimming by size control 65533539 (99.98%) read pairs available; of these: 1720489 ( 2.63%) trimmed read pairs available after processing 63813050 (97.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 36 0.00% 19 26 0.00% 20 26 0.00% 21 37 0.00% 22 53 0.00% 23 60 0.00% 24 63 0.00% 25 61 0.00% 26 40 0.00% 27 56 0.00% 28 73 0.00% 29 71 0.00% 30 86 0.00% 31 89 0.00% 32 102 0.00% 33 86 0.00% 34 93 0.00% 35 123 0.00% 36 91 0.00% 37 128 0.00% 38 130 0.00% 39 123 0.00% 40 100 0.00% 41 113 0.00% 42 145 0.00% 43 119 0.00% 44 136 0.00% 45 134 0.00% 46 145 0.00% 47 150 0.00% 48 183 0.00% 49 178 0.00% 50 173 0.00% 51 150 0.00% 52 196 0.00% 53 188 0.00% 54 184 0.00% 55 214 0.00% 56 265 0.00% 57 252 0.00% 58 271 0.00% 59 254 0.00% 60 303 0.00% 61 286 0.00% 62 341 0.00% 63 355 0.00% 64 388 0.00% 65 342 0.00% 66 403 0.00% 67 431 0.00% 68 481 0.00% 69 578 0.00% 70 540 0.00% 71 613 0.00% 72 706 0.00% 73 755 0.00% 74 811 0.00% 75 863 0.00% 76 924 0.00% 77 1024 0.00% 78 1112 0.00% 79 1261 0.00% 80 1396 0.00% 81 1583 0.00% 82 1771 0.00% 83 1849 0.00% 84 2137 0.00% 85 2254 0.00% 86 2458 0.00% 87 2737 0.00% 88 3004 0.00% 89 3140 0.00% 90 3558 0.01% 91 3886 0.01% 92 4118 0.01% 93 4751 0.01% 94 5160 0.01% 95 5451 0.01% 96 5940 0.01% 97 6182 0.01% 98 6483 0.01% 99 7130 0.01% 100 7552 0.01% 101 8178 0.01% 102 8922 0.01% 103 9546 0.01% 104 10115 0.02% 105 10841 0.02% 106 11324 0.02% 107 11658 0.02% 108 12256 0.02% 109 13227 0.02% 110 13663 0.02% 111 14970 0.02% 112 15734 0.02% 113 16761 0.03% 114 17901 0.03% 115 18444 0.03% 116 19026 0.03% 117 20219 0.03% 118 20365 0.03% 119 21419 0.03% 120 22724 0.03% 121 23377 0.04% 122 24518 0.04% 123 26474 0.04% 124 28003 0.04% 125 28872 0.04% 126 30295 0.05% 127 30769 0.05% 128 31544 0.05% 129 33028 0.05% 130 33708 0.05% 131 34727 0.05% 132 36379 0.06% 133 38581 0.06% 134 40425 0.06% 135 42847 0.07% 136 43797 0.07% 137 44684 0.07% 138 46687 0.07% 139 47676 0.07% 140 49064 0.07% 141 50657 0.08% 142 52824 0.08% 143 54598 0.08% 144 57998 0.09% 145 60173 0.09% 146 62559 0.10% 147 63875 0.10% 148 65127 0.10% 149 66063 0.10% 150 73607 0.11% 151 63813050 97.37% 65533539 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=21 prefix-density=0.92 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=71.76 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=5.2 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=4.19 fanout-score-rank=17 prefix-density=0.77 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=121.44 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=5.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814928 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 13:25:48 Started mapping on | Dec 06 13:25:48 Finished on | Dec 06 13:31:44 Mapping speed, Million of reads per hour | 662.70 Number of input reads | 65533539 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 60834683 Uniquely mapped reads % | 92.83% Average mapped length | 299.86 Number of splices: Total | 62489225 Number of splices: Annotated (sjdb) | 59131044 Number of splices: GT/AG | 61654378 Number of splices: GC/AG | 753665 Number of splices: AT/AC | 21423 Number of splices: Non-canonical | 59759 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 779338 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 100999 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.69% % of reads unmapped: other | 1.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3919518 3919518 3919518 N_multimapping 779338 779338 779338 N_noFeature 2120157 59007266 2653605 N_ambiguous 1611728 11463 319361 UnstrandedReadsAssigned:57102798 PositiveStrandReadsAssigned:1815954 NegativeStrandReadsAssigned:57861717 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814928 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814928-trimmed-pair1.fastq SRR7814928-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 65,533,539 reads, 58,930,941 reads pseudoaligned [quant] estimated average fragment length: 322.085 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,302 rounds 52973 SRR7814928.ke.tsv 35125 SRR7814928.se.tsv 88098 total ==> SRR7814928.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 615.786 0 0 PNS24247 1044 722.915 220.646 6.74888 PNS24249 1928 1606.91 278.205 3.82819 PNS24246 1044 722.915 220.646 6.74888 PNS24248 1044 722.915 220.646 6.74888 PNS24244 1471 1149.91 314.856 6.05436 PNS24243 293 71.6469 0 0 KQK14069 1603 1281.91 16445.3 283.665 KQK14071 474 192.472 104.379 11.9913 ==> SRR7814928.se.tsv <== BRADI_1g14170v3 16707 BRADI_1g53295v3 404 BRADI_1g59795v3 913 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 517 BRADI_1g74790v3 3369 BRADI_1g09890v3 0 BRADI_1g77505v3 639 BRADI_1g48960v3 0 SRR7814928 completed mapping pipeline successfully