Starting /dee2/code/volunteer_pipeline.sh SRR7814929 current disk space = 1548195106816 free memory = 1604499448 SRR7814929 SRAfilesize 8a07acfbffc240bb34478342c73bc165 SRR7814929.sra SRR7814929.sra file validated SRR7814929 is paired end SRR7814929 is conventional basespace SRR7814929 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814929_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32875 37.0 37.0 37.0 37.0 37.0 2 36.2675 37.0 37.0 37.0 37.0 37.0 3 36.463 37.0 37.0 37.0 37.0 37.0 4 36.499 37.0 37.0 37.0 37.0 37.0 5 36.4555 37.0 37.0 37.0 37.0 37.0 6 36.459 37.0 37.0 37.0 37.0 37.0 7 36.5005 37.0 37.0 37.0 37.0 37.0 8 36.48 37.0 37.0 37.0 37.0 37.0 9 36.451 37.0 37.0 37.0 37.0 37.0 10-14 36.4996 37.0 37.0 37.0 37.0 37.0 15-19 36.469 37.0 37.0 37.0 37.0 37.0 20-24 36.43599999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4198 37.0 37.0 37.0 37.0 37.0 30-34 36.435500000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.415200000000006 37.0 37.0 37.0 37.0 37.0 40-44 36.419200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.310500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.268100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.252700000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2315 37.0 37.0 37.0 37.0 37.0 65-69 36.2124 37.0 37.0 37.0 37.0 37.0 70-74 36.1309 37.0 37.0 37.0 37.0 37.0 75-79 36.138400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.130399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.0601 37.0 37.0 37.0 37.0 37.0 90-94 36.03189999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.0235 37.0 37.0 37.0 37.0 37.0 100-104 35.9573 37.0 37.0 37.0 37.0 37.0 105-109 35.939800000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.8532 37.0 37.0 37.0 37.0 37.0 115-119 35.8223 37.0 37.0 37.0 37.0 37.0 120-124 35.6893 37.0 37.0 37.0 37.0 37.0 125-129 35.619099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5581 37.0 37.0 37.0 37.0 37.0 135-139 35.591300000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.5399 37.0 37.0 37.0 37.0 37.0 145-149 35.4263 37.0 37.0 37.0 34.6 37.0 150-151 34.57775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 1.0 24 4.0 25 5.0 26 5.0 27 7.0 28 12.0 29 21.0 30 31.0 31 45.0 32 67.0 33 102.0 34 165.0 35 452.0 36 2833.0 37 249.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.466750313676286 12.823086574654956 8.782936010037641 33.92722710163112 2 26.275 16.375 31.8 25.55 3 24.575 23.575 22.95 28.9 4 28.549999999999997 29.2 20.225 22.025 5 26.5 31.225 21.775 20.5 6 23.775 32.75 22.25 21.224999999999998 7 17.349999999999998 19.125 40.175 23.35 8 23.375 20.25 25.3 31.075000000000003 9 21.075 20.025000000000002 30.975 27.925 10-14 24.79 25.205 23.785 26.22 15-19 25.025 23.794999999999998 24.135 27.045 20-24 25.31 24.525 23.89 26.275 25-29 25.540000000000003 24.154999999999998 24.345 25.96 30-34 24.87 24.08 24.315 26.735 35-39 24.6 24.115000000000002 24.575 26.71 40-44 25.47 23.96 23.799999999999997 26.77 45-49 25.314999999999998 23.785 23.97 26.93 50-54 25.019999999999996 23.544999999999998 24.385 27.05 55-59 24.990000000000002 23.65 23.830000000000002 27.529999999999998 60-64 25.53 23.235 23.830000000000002 27.405 65-69 25.53 23.51 23.724999999999998 27.235 70-74 25.619999999999997 22.705000000000002 24.14 27.534999999999997 75-79 26.169999999999998 23.72 23.0 27.11 80-84 26.484999999999996 23.905 23.015 26.595000000000002 85-89 25.915 23.3 23.645 27.139999999999997 90-94 25.740000000000002 23.305 23.515 27.439999999999998 95-99 26.19 23.119999999999997 23.13 27.560000000000002 100-104 26.284999999999997 23.235 23.599999999999998 26.88 105-109 26.115 22.84 23.580000000000002 27.465 110-114 26.119999999999997 22.994999999999997 23.555 27.33 115-119 26.795 22.95 23.285 26.97 120-124 26.665 22.945 23.189999999999998 27.200000000000003 125-129 26.340000000000003 23.200000000000003 23.02 27.439999999999998 130-134 26.72 23.244999999999997 23.02 27.015 135-139 26.784999999999997 23.525 23.064999999999998 26.625 140-144 26.69 22.3 23.03 27.98 145-149 26.735 22.62 22.715 27.93 150-151 26.737499999999997 22.225 23.575 27.462500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 3.5 29 4.0 30 4.0 31 8.0 32 9.0 33 15.5 34 25.0 35 26.5 36 34.0 37 49.5 38 65.0 39 85.0 40 89.0 41 103.0 42 135.0 43 139.5 44 145.0 45 154.5 46 159.5 47 166.0 48 164.5 49 141.0 50 130.0 51 131.0 52 124.5 53 118.0 54 100.5 55 86.0 56 89.0 57 98.0 58 103.0 59 101.5 60 107.0 61 110.0 62 96.0 63 92.5 64 95.0 65 103.5 66 97.0 67 88.0 68 82.5 69 66.5 70 60.0 71 49.0 72 33.5 73 22.5 74 22.0 75 21.0 76 12.5 77 11.5 78 7.0 79 3.5 80 3.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.225 #Duplication Level Percentage of deduplicated Percentage of total 1 90.30202272097534 81.475 2 8.672762538099196 15.65 3 0.914380714879468 2.475 4 0.11083402604599613 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7749999999999999 0.0 0.0 0.0 0.0 128-129 0.9 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.225 0.0 0.0 0.0 0.0 136-137 1.275 0.0 0.0 0.0 0.0 138-139 1.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAATC 10 0.006830828 145.0 2 >>END_MODULE SRR7814929 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814929_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4765 37.0 37.0 37.0 37.0 37.0 2 36.1245 37.0 37.0 37.0 37.0 37.0 3 36.064 37.0 37.0 37.0 37.0 37.0 4 36.1765 37.0 37.0 37.0 37.0 37.0 5 36.253 37.0 37.0 37.0 37.0 37.0 6 36.104 37.0 37.0 37.0 37.0 37.0 7 36.0525 37.0 37.0 37.0 37.0 37.0 8 36.281 37.0 37.0 37.0 37.0 37.0 9 36.155 37.0 37.0 37.0 37.0 37.0 10-14 36.1362 37.0 37.0 37.0 37.0 37.0 15-19 36.10770000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.0563 37.0 37.0 37.0 37.0 37.0 25-29 35.993399999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.010000000000005 37.0 37.0 37.0 37.0 37.0 35-39 35.966300000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.8738 37.0 37.0 37.0 37.0 37.0 45-49 35.8322 37.0 37.0 37.0 37.0 37.0 50-54 35.7378 37.0 37.0 37.0 37.0 37.0 55-59 35.6565 37.0 37.0 37.0 37.0 37.0 60-64 35.587900000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.580999999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.5526 37.0 37.0 37.0 37.0 37.0 75-79 35.459300000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.260299999999994 37.0 37.0 37.0 34.6 37.0 85-89 35.2715 37.0 37.0 37.0 34.6 37.0 90-94 35.142399999999995 37.0 37.0 37.0 27.4 37.0 95-99 34.8249 37.0 37.0 37.0 25.0 37.0 100-104 34.8406 37.0 37.0 37.0 25.0 37.0 105-109 34.74380000000001 37.0 37.0 37.0 25.0 37.0 110-114 34.7856 37.0 37.0 37.0 25.0 37.0 115-119 34.7983 37.0 37.0 37.0 25.0 37.0 120-124 34.4596 37.0 37.0 37.0 25.0 37.0 125-129 34.46469999999999 37.0 37.0 37.0 25.0 37.0 130-134 34.014300000000006 37.0 37.0 37.0 25.0 37.0 135-139 33.9182 37.0 37.0 37.0 25.0 37.0 140-144 34.2106 37.0 37.0 37.0 25.0 37.0 145-149 33.8994 37.0 37.0 37.0 25.0 37.0 150-151 33.3405 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 4.0 15 6.0 16 3.0 17 3.0 18 4.0 19 3.0 20 11.0 21 8.0 22 10.0 23 10.0 24 9.0 25 13.0 26 13.0 27 7.0 28 23.0 29 27.0 30 37.0 31 63.0 32 112.0 33 160.0 34 348.0 35 974.0 36 2106.0 37 42.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.275 14.149999999999999 11.825 32.75 2 30.675 18.875 27.275 23.175 3 26.924999999999997 21.9 25.624999999999996 25.55 4 29.325000000000003 29.25 17.7 23.724999999999998 5 28.549999999999997 30.775000000000002 18.375 22.3 6 24.65 30.725 17.9 26.724999999999998 7 23.125 15.174999999999999 34.425 27.275 8 24.775 19.3 20.775 35.15 9 24.65 21.075 23.35 30.925000000000004 10-14 27.415 23.73 20.86 27.994999999999997 15-19 27.185 23.294999999999998 21.495 28.025 20-24 27.215 23.69 21.46 27.634999999999998 25-29 27.339999999999996 23.52 21.86 27.279999999999998 30-34 27.18 24.035 21.404999999999998 27.38 35-39 27.52 24.145 21.195 27.139999999999997 40-44 27.565 23.0 21.81 27.625 45-49 28.249999999999996 23.03 21.965 26.755000000000003 50-54 27.169999999999998 23.565 21.575 27.689999999999998 55-59 28.17 23.135 21.349999999999998 27.345000000000002 60-64 27.515 23.315 21.475 27.694999999999997 65-69 26.995 23.3 21.925 27.779999999999998 70-74 27.975 22.75 21.675 27.6 75-79 28.08 23.68 20.95 27.29 80-84 27.555000000000003 23.515 21.310000000000002 27.62 85-89 27.689999999999998 23.32 21.62 27.37 90-94 27.52 23.325000000000003 21.45 27.705000000000002 95-99 27.48 24.169999999999998 21.529999999999998 26.82 100-104 27.834999999999997 23.65 21.51 27.005000000000003 105-109 27.485 23.275000000000002 21.675 27.565 110-114 27.105 23.29 21.895 27.71 115-119 27.91 23.71 21.065 27.315 120-124 28.415000000000003 23.56 21.09 26.935 125-129 27.815 23.09 21.865000000000002 27.229999999999997 130-134 27.805000000000003 23.665 22.15 26.38 135-139 28.035 23.285 21.959999999999997 26.72 140-144 27.735 24.099999999999998 21.584999999999997 26.58 145-149 28.42 23.855 21.905 25.82 150-151 29.1875 22.8875 21.4375 26.487500000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 0.5 12 0.0 13 0.0 14 2.0 15 3.0 16 2.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.5 25 2.5 26 2.0 27 2.0 28 2.0 29 2.0 30 3.0 31 5.0 32 6.0 33 6.0 34 11.0 35 16.5 36 23.5 37 35.0 38 42.0 39 56.0 40 71.5 41 86.5 42 89.0 43 97.0 44 121.5 45 119.5 46 122.5 47 124.0 48 121.5 49 130.0 50 128.5 51 120.5 52 102.5 53 106.0 54 112.5 55 102.0 56 99.0 57 108.5 58 115.0 59 117.0 60 128.5 61 117.5 62 113.5 63 123.0 64 123.0 65 121.5 66 117.5 67 117.0 68 106.0 69 92.5 70 81.5 71 73.0 72 63.5 73 54.5 74 42.5 75 27.0 76 20.0 77 13.0 78 7.0 79 3.5 80 1.5 81 3.0 82 4.0 83 2.0 84 1.5 85 1.5 86 2.5 87 2.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.32527105921602 81.22500000000001 2 8.56269113149847 15.4 3 0.8340283569641368 2.25 4 0.19460661662496526 0.7000000000000001 5 0.027800945232137893 0.125 6 0.055601890464275786 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 6 0.15 No Hit CTTCTCCTCCCCTTCCGGTTCGGTTCGGTTCGGGTCCTGGGTTCCGGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.7250000000000001 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138-139 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCGACG 10 0.006830828 145.0 1 >>END_MODULE Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618894 spots for SRR7814929.sra Written 2618894 spots for SRR7814929.sra Read 2618899 spots for SRR7814929.sra Written 2618899 spots for SRR7814929.sra SRR ids: ['SRR7814929.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pit9qkr8 SRR7814929.sra spots: 52377885 blocks: [[1, 2618894], [2618895, 5237788], [5237789, 7856682], [7856683, 10475576], [10475577, 13094470], [13094471, 15713364], [15713365, 18332258], [18332259, 20951152], [20951153, 23570046], [23570047, 26188940], [26188941, 28807834], [28807835, 31426728], [31426729, 34045622], [34045623, 36664516], [36664517, 39283410], [39283411, 41902304], [41902305, 44521198], [44521199, 47140092], [47140093, 49758986], [49758987, 52377885]] SRR7814929 file size 17727446 SRR7814929 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814929 SRR7814929_1.fastq SRR7814929_2.fastq Input file: SRR7814929_1.fastq Paired file: SRR7814929_2.fastq trimmed: SRR7814929-trimmed-pair1.fastq, SRR7814929-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:06:10 2024 >> started Sat Dec 7 02:20:48 2024 >> done (877.909s) 52377885 read pairs processed; of these: 155 ( 0.00%) short read pairs filtered out after trimming by size control 45563 ( 0.09%) empty read pairs filtered out after trimming by size control 52332167 (99.91%) read pairs available; of these: 1434295 ( 2.74%) trimmed read pairs available after processing 50897872 (97.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 21 0.00% 20 16 0.00% 21 23 0.00% 22 36 0.00% 23 38 0.00% 24 38 0.00% 25 27 0.00% 26 45 0.00% 27 46 0.00% 28 52 0.00% 29 40 0.00% 30 49 0.00% 31 46 0.00% 32 63 0.00% 33 50 0.00% 34 51 0.00% 35 69 0.00% 36 80 0.00% 37 77 0.00% 38 88 0.00% 39 75 0.00% 40 78 0.00% 41 66 0.00% 42 95 0.00% 43 109 0.00% 44 97 0.00% 45 109 0.00% 46 86 0.00% 47 99 0.00% 48 98 0.00% 49 124 0.00% 50 108 0.00% 51 106 0.00% 52 123 0.00% 53 141 0.00% 54 151 0.00% 55 172 0.00% 56 162 0.00% 57 161 0.00% 58 166 0.00% 59 163 0.00% 60 193 0.00% 61 214 0.00% 62 205 0.00% 63 238 0.00% 64 261 0.00% 65 278 0.00% 66 264 0.00% 67 293 0.00% 68 323 0.00% 69 322 0.00% 70 402 0.00% 71 457 0.00% 72 454 0.00% 73 621 0.00% 74 574 0.00% 75 625 0.00% 76 691 0.00% 77 752 0.00% 78 781 0.00% 79 884 0.00% 80 1057 0.00% 81 1126 0.00% 82 1267 0.00% 83 1405 0.00% 84 1464 0.00% 85 1766 0.00% 86 1770 0.00% 87 1975 0.00% 88 2194 0.00% 89 2330 0.00% 90 2656 0.01% 91 2914 0.01% 92 3360 0.01% 93 3613 0.01% 94 3911 0.01% 95 4216 0.01% 96 4381 0.01% 97 4879 0.01% 98 5146 0.01% 99 5495 0.01% 100 6001 0.01% 101 6496 0.01% 102 7063 0.01% 103 7472 0.01% 104 7820 0.01% 105 8559 0.02% 106 9008 0.02% 107 9452 0.02% 108 9989 0.02% 109 10483 0.02% 110 10782 0.02% 111 11736 0.02% 112 12535 0.02% 113 13454 0.03% 114 14349 0.03% 115 14973 0.03% 116 15681 0.03% 117 16317 0.03% 118 16801 0.03% 119 17604 0.03% 120 18588 0.04% 121 19083 0.04% 122 20497 0.04% 123 21316 0.04% 124 23159 0.04% 125 23851 0.05% 126 25208 0.05% 127 25532 0.05% 128 26239 0.05% 129 27921 0.05% 130 28263 0.05% 131 29410 0.06% 132 31519 0.06% 133 32995 0.06% 134 33963 0.06% 135 36197 0.07% 136 37180 0.07% 137 37769 0.07% 138 39733 0.08% 139 40624 0.08% 140 42070 0.08% 141 43382 0.08% 142 45730 0.09% 143 46596 0.09% 144 49340 0.09% 145 51824 0.10% 146 53031 0.10% 147 54891 0.10% 148 55705 0.11% 149 56596 0.11% 150 60294 0.12% 151 50897872 97.26% 52332167 reads passed initial QC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=18 prefix-density=0.99 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=65.57 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.4 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=14 prefix-density=0.83 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTGGACAATGTGGAAGCTGCCCATGTTCGGGTGCACCGACGCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=92.26 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.0 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814929 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:25:28 Started mapping on | Dec 07 02:25:28 Finished on | Dec 07 02:31:32 Mapping speed, Million of reads per hour | 517.57 Number of input reads | 52332167 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 48965436 Uniquely mapped reads % | 93.57% Average mapped length | 300.01 Number of splices: Total | 49717121 Number of splices: Annotated (sjdb) | 47251465 Number of splices: GT/AG | 49043045 Number of splices: GC/AG | 620182 Number of splices: AT/AC | 15673 Number of splices: Non-canonical | 38221 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 566476 % of reads mapped to multiple loci | 1.08% Number of reads mapped to too many loci | 60775 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2800255 2800255 2800255 N_multimapping 566476 566476 566476 N_noFeature 1293987 47491599 1620691 N_ambiguous 1359709 6524 213373 UnstrandedReadsAssigned:46311740 PositiveStrandReadsAssigned:1467313 NegativeStrandReadsAssigned:47131372 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814929 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814929-trimmed-pair1.fastq SRR7814929-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,332,167 reads, 47,667,137 reads pseudoaligned [quant] estimated average fragment length: 308.331 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,254 rounds 52973 SRR7814929.ke.tsv 35125 SRR7814929.se.tsv 88098 total ==> SRR7814929.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 629.194 0 0 PNS24247 1044 736.669 87.9051 3.02369 PNS24249 1928 1620.67 176.933 2.76637 PNS24246 1044 736.669 87.9051 3.02369 PNS24248 1044 736.669 87.9051 3.02369 PNS24244 1471 1163.67 199.352 4.34097 PNS24243 293 72.4258 0 0 KQK14069 1603 1295.67 2954.22 57.7756 KQK14071 474 197.667 20.9126 2.68084 ==> SRR7814929.se.tsv <== BRADI_1g14170v3 2998 BRADI_1g53295v3 276 BRADI_1g59795v3 1117 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 932 BRADI_1g74790v3 392 BRADI_1g09890v3 5 BRADI_1g77505v3 686 BRADI_1g48960v3 0 SRR7814929 completed mapping pipeline successfully