Starting /dee2/code/volunteer_pipeline.sh SRR7814930 current disk space = 3001348771840 free memory = 1570052472 SRR7814930_1.fastq is conventional basespace SRR7814930_1.fastq read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814930_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 44953581 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.46373326743424 37.0 37.0 37.0 37.0 37.0 2 36.384424746940624 37.0 37.0 37.0 37.0 37.0 3 36.51783320665822 37.0 37.0 37.0 37.0 37.0 4 36.5669063605856 37.0 37.0 37.0 37.0 37.0 5 36.588821277664174 37.0 37.0 37.0 37.0 37.0 6 36.57705696460533 37.0 37.0 37.0 37.0 37.0 7 36.55583351635546 37.0 37.0 37.0 37.0 37.0 8 36.61610066170257 37.0 37.0 37.0 37.0 37.0 9 36.61270631587726 37.0 37.0 37.0 37.0 37.0 10-14 36.62042974062511 37.0 37.0 37.0 37.0 37.0 15-19 36.58639170481213 37.0 37.0 37.0 37.0 37.0 20-24 36.5693039270887 37.0 37.0 37.0 37.0 37.0 25-29 36.53812595263545 37.0 37.0 37.0 37.0 37.0 30-34 36.52706695379841 37.0 37.0 37.0 37.0 37.0 35-39 36.494497463950644 37.0 37.0 37.0 37.0 37.0 40-44 36.46735578640554 37.0 37.0 37.0 37.0 37.0 45-49 36.42764150424412 37.0 37.0 37.0 37.0 37.0 50-54 36.41327840378278 37.0 37.0 37.0 37.0 37.0 55-59 36.4004424252653 37.0 37.0 37.0 37.0 37.0 60-64 36.384225385737345 37.0 37.0 37.0 37.0 37.0 65-69 36.330081196423485 37.0 37.0 37.0 37.0 37.0 70-74 36.30555204934619 37.0 37.0 37.0 37.0 37.0 75-79 36.30345477927554 37.0 37.0 37.0 37.0 37.0 80-84 36.273204971145674 37.0 37.0 37.0 37.0 37.0 85-89 36.25184790951359 37.0 37.0 37.0 37.0 37.0 90-94 36.18792999383074 37.0 37.0 37.0 37.0 37.0 95-99 36.12687181027914 37.0 37.0 37.0 37.0 37.0 100-104 36.11426692347379 37.0 37.0 37.0 37.0 37.0 105-109 36.11197352664741 37.0 37.0 37.0 37.0 37.0 110-114 36.05488712901426 37.0 37.0 37.0 37.0 37.0 115-119 36.00046000784676 37.0 37.0 37.0 37.0 37.0 120-124 35.81858763598833 37.0 37.0 37.0 37.0 37.0 125-129 35.81364674373772 37.0 37.0 37.0 37.0 37.0 130-134 35.82488785042509 37.0 37.0 37.0 37.0 37.0 135-139 35.81840836662156 37.0 37.0 37.0 37.0 37.0 140-144 35.722115891056596 37.0 37.0 37.0 37.0 37.0 145-149 35.563732246380994 37.0 37.0 37.0 37.0 37.0 150-151 34.79810315890073 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 6.0 15 31.0 16 69.0 17 175.0 18 348.0 19 734.0 20 1660.0 21 3731.0 22 7367.0 23 13560.0 24 21819.0 25 34016.0 26 52342.0 27 84338.0 28 129880.0 29 197146.0 30 279117.0 31 398902.0 32 552945.0 33 852099.0 34 1504881.0 35 4085569.0 36 3.2652444E7 37 4080402.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.79060491307364 13.210788785738215 9.426757348566936 33.5718489526212 2 24.68032348935457 17.15003070855044 33.25471810930108 24.91492769279391 3 22.10185880408504 24.065517717042386 24.61854373737211 29.21407974150046 4 26.185907191687352 30.436803243772726 20.751038721475826 22.626250843064096 5 24.751816768501715 32.45032915175322 22.242141287920976 20.55571279182408 6 21.09190366836404 33.52687297592599 23.013612641893868 22.367610713816102 7 16.69291930269137 20.212754574546576 41.954653178797926 21.13967294396413 8 20.434314231829497 20.991244279293344 27.580757137012068 30.99368435186509 9 20.532386507762308 20.217299262543733 30.886569414792564 28.3637448149014 10-14 23.185000545340316 26.148480139991513 24.66565633558759 26.000862979080573 15-19 23.288212789988854 25.283198239535132 25.375339508547718 26.053249461928296 20-24 23.18504103154763 25.414464756433976 25.388741332976345 26.01175287904205 25-29 23.252588041873683 25.469023257568736 25.18240004061078 26.0959886599468 30-34 23.295289423105135 25.39480314148944 25.20383459551309 26.10607283989233 35-39 23.3625106767362 25.269185132237727 25.098351124375224 26.269953066650846 40-44 23.47573288988924 25.263946380600917 25.050662371035582 26.209658358474268 45-49 23.509771112561644 25.249658753548466 24.913816320884425 26.326753813005467 50-54 23.507484309203306 25.103694853586862 25.012965707893215 26.375855129316616 55-59 23.68406512486736 25.13616701637184 24.864637591385655 26.315130267375142 60-64 23.71108588657264 25.014024577930734 24.83393792365507 26.440951611841555 65-69 23.659053101909723 24.989564680064085 24.917388450099224 26.433993767926967 70-74 23.821810738044274 24.97529582852711 24.834792994374443 26.36810043905417 75-79 23.909056766801292 24.834361916573453 24.746513520246584 26.510067796378667 80-84 23.808594469926657 24.808555296184302 24.8600519722778 26.522798261611243 85-89 24.05521864876571 24.70110134273841 24.80178208717121 26.441897921324664 90-94 24.077886030925992 24.642006161867283 24.76300875785624 26.517099049350485 95-99 24.088462900807077 24.570578907632694 24.857469079380753 26.483489112179477 100-104 24.12761065686847 24.632793547637508 24.700849082523593 26.53874671297043 105-109 24.214297855381087 24.481569999951727 24.720718912248614 26.583413232418568 110-114 24.136065155743655 24.508276214969392 24.74195726476162 26.613701364525333 115-119 24.27943081998295 24.383244129093963 24.68318508374227 26.65413996718081 120-124 24.32964316599751 24.3734653471923 24.614574823406095 26.682316663404098 125-129 24.29902836884118 24.313192312754794 24.746204757302873 26.64157456110115 130-134 24.49703706585689 24.335527352092374 24.600689764848767 26.56674581720197 135-139 24.446827712762886 24.253432662046947 24.60945235583748 26.690287269352687 140-144 24.557046968071354 24.173829889102716 24.65102479822464 26.618098344601286 145-149 24.630631948426547 24.18408727905312 24.444101295379465 26.741179477140868 150-151 24.96889847329404 23.945446081370026 24.29314585638906 26.79250958894687 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 18346.0 1 11832.0 2 4353.0 3 3098.0 4 2611.5 5 2302.5 6 2132.5 7 1968.0 8 1856.5 9 1817.0 10 1749.5 11 1661.5 12 1578.5 13 1505.5 14 1460.5 15 1526.0 16 1598.5 17 1631.5 18 1718.0 19 1885.5 20 2072.5 21 2413.5 22 3003.5 23 4038.0 24 6000.5 25 8947.0 26 13487.5 27 21477.5 28 32669.5 29 48845.0 30 74251.0 31 110174.0 32 155978.5 33 220702.5 34 304059.0 35 407779.0 36 538913.5 37 696811.0 38 879945.0 39 1077653.5 40 1306999.5 41 1546907.0 42 1743861.5 43 1902942.0 44 2032038.5 45 2118152.0 46 2144930.5 47 2114201.5 48 2048074.0 49 1978073.0 50 1865116.5 51 1719543.0 52 1574895.0 53 1428780.0 54 1288293.5 55 1165333.5 56 1064138.5 57 959061.0 58 886195.0 59 840378.5 60 785759.0 61 738690.0 62 701613.5 63 702366.0 64 728528.0 65 713633.5 66 666953.0 67 623314.5 68 562379.0 69 487871.5 70 417052.0 71 344188.5 72 285816.5 73 233986.5 74 184253.5 75 131103.5 76 85473.5 77 58609.5 78 40407.5 79 27123.0 80 17493.5 81 10000.5 82 5491.0 83 3124.0 84 1620.5 85 820.5 86 429.5 87 229.5 88 114.5 89 64.0 90 41.0 91 32.0 92 30.0 93 30.5 94 29.0 95 28.5 96 34.0 97 38.5 98 91.5 99 93.0 100 26.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.01396996604119258 2 0.015162307091842138 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 5.3388405252965276E-6 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 8.764596529028467E-5 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 4.449033771080439E-6 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.06416218543301366 125-129 0.0 130-134 0.0 135-139 8.898067542160879E-7 140-144 0.0 145-149 9.787874296376968E-6 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4.4953581E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 24.807833806885537 #Duplication Level Percentage of deduplicated Percentage of total 1 54.887608613923625 13.616426725515963 2 17.231206855729837 8.549378319380251 3 8.019723545624974 5.968559066910935 4 4.709911365197161 4.673707935718903 5 3.000785273893638 3.722149118245143 6 2.11006827059558 3.140773378687052 7 1.5174837632104359 2.6351839501660215 8 1.163309155887946 2.308734416423717 9 0.9103359043363606 2.0325115640895555 >10 5.707652533630822 26.55757837962842 >50 0.4591789260096608 7.846259145549725 >100 0.2571700793123891 11.848083220724003 >500 0.01737433063609013 2.9179073421767168 >1k 0.007789641074857591 3.351628462584707 >5k 2.9126219903482685E-4 0.4816250270883905 >10k+ 1.1047873757052738E-4 0.34949394711054277 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 3.3367753283103294E-5 0.0 4.449033771080439E-6 2.2245168855402196E-6 2.2245168855402196E-6 2 3.3367753283103294E-5 0.0 1.5571618198781537E-5 6.67355065662066E-6 1.334710131324132E-5 3 4.893937148188484E-5 0.0 1.5571618198781537E-5 1.5571618198781537E-5 2.8918719512022858E-5 4 7.785809099390769E-5 0.0 1.5571618198781537E-5 2.002065196986198E-5 2.8918719512022858E-5 5 9.342970919268924E-5 0.0 3.5592270168643514E-5 3.1143236397563075E-5 4.44903377108044E-5 6 1.0677681050593055E-4 0.0 3.781678705418374E-5 3.3367753283103294E-5 4.44903377108044E-5 7 1.245729455902523E-4 8.898067542160878E-6 3.781678705418374E-5 3.5592270168643514E-5 5.56129221385055E-5 8 1.356955300179534E-4 8.898067542160878E-6 4.671485459634462E-5 3.5592270168643514E-5 7.785809099390769E-5 9 1.5126714821673496E-4 8.898067542160878E-6 7.340905722282725E-5 3.5592270168643514E-5 9.565422607822945E-5 10-11 1.8352264305706813E-4 2.3357427298172306E-5 7.78580909939077E-5 3.781678705418374E-5 1.546039235450453E-4 12-13 2.157781378974013E-4 3.225549484033319E-5 9.565422607822945E-5 3.892904549695385E-5 1.9464522748476924E-4 14-15 2.6249299249374595E-4 4.1153562382494066E-5 1.0010325984930989E-4 4.004130393972396E-5 3.003097795479297E-4 16-17 3.0920784709009055E-4 4.44903377108044E-5 1.1456261960532132E-4 4.1153562382494066E-5 4.24882725138182E-4 18-19 3.714943198852167E-4 4.44903377108044E-5 1.245729455902523E-4 4.44903377108044E-5 4.6714854596344613E-4 20-21 4.393420848941934E-4 4.44903377108044E-5 1.3903230534626372E-4 5.0051629924654945E-5 5.016285576893196E-4 22-23 5.361085694151929E-4 4.44903377108044E-5 1.534916651022752E-4 5.894969746681582E-5 6.0729310975248E-4 24-25 6.37324087707273E-4 4.44903377108044E-5 1.6572650797274638E-4 6.0061955909585936E-5 7.363150891138128E-4 26-27 7.830299437101573E-4 4.44903377108044E-5 2.0243103658416E-4 6.117421435235604E-5 7.730196177252264E-4 28-29 8.987048217582489E-4 5.338840525296528E-5 2.135536210118611E-4 6.562324812343649E-5 7.897034943667781E-4 30-31 0.0010310635764478918 5.338840525296528E-5 2.1800265478294154E-4 6.673550656620659E-5 8.141731801077205E-4 32-33 0.0011734326571224661 5.672518058127561E-5 2.2022717166848176E-4 7.118454033728703E-5 8.319693151920423E-4 34-35 0.001366965626164465 5.7837439024045717E-5 2.2578846388233233E-4 7.67458325511376E-5 8.486531918335939E-4 36-37 0.0015237940665950506 6.0061955909585936E-5 2.6805428470759647E-4 7.89703494366778E-5 8.831332035594673E-4 38-39 0.001699530900552728 6.339873123789626E-5 2.7472783536421715E-4 9.231745074991912E-5 9.00929338643789E-4 40-41 0.0018886148358236467 6.451098968066638E-5 2.780646106925275E-4 1.0232777673485012E-4 9.120519230714901E-4 42-43 0.002073249737323485 6.451098968066638E-5 2.847381613491481E-4 1.0900132739147077E-4 9.376338672552027E-4 44-45 0.0022912523921064265 6.451098968066638E-5 2.9474848733407913E-4 1.1567487804809143E-4 9.787874296376966E-4 46-47 0.0025348369910730803 6.562324812343649E-5 3.2255494840333185E-4 1.1901165337640176E-4 0.0010521964868605242 48-49 0.002801779017337907 7.007228189451691E-5 3.33677532831033E-4 1.3013423780410286E-4 0.0010666558466165352 50-51 0.003108762347542457 7.340905722282725E-5 3.815046458701477E-4 1.4014456378903386E-4 0.0010989113414568686 52-53 0.0034324295543885592 7.340905722282725E-5 4.115356238249407E-4 1.7017554174382683E-4 0.0011244932856405811 54-55 0.003786127739189454 7.452131566559737E-5 4.24882725138182E-4 1.779613508432176E-4 0.0011578610389236844 56-57 0.004164295609731292 7.67458325511376E-5 4.3489305112311296E-4 1.7907360928598768E-4 0.0012101371857338797 58-59 0.004609198986839335 8.230712476498813E-5 4.4824015243635426E-4 1.8241038461429802E-4 0.001235719129917592 60-61 0.00506411268993231 9.342970919268924E-5 4.649240290779059E-4 1.8463490149983825E-4 0.00131802625468258 62-63 0.005554618663193929 9.454196763545935E-5 4.905059732616185E-4 1.8685941838537847E-4 0.0013469449741946031 64-65 0.00617637113270242 1.1789939493363165E-4 5.628027720416756E-4 1.901961937136888E-4 0.0013536185248512237 66-67 0.0068937778282891415 1.3347101313241318E-4 5.694763226982962E-4 1.913084521564589E-4 0.0013747514352638558 68-69 0.007736869727908885 1.4014456378903386E-4 5.750376149121468E-4 1.9353296904199913E-4 0.0013903230534626373 70-71 0.008852464946007305 1.4014456378903386E-4 6.295382786078822E-4 1.9798200281307955E-4 0.0014147927392035799 72-73 0.01003034663690085 1.5015488977396485E-4 6.406608630355832E-4 2.1355362101186108E-4 0.001445935975601143 74-75 0.011468496803402603 1.6016521575889584E-4 6.551202227915948E-4 2.2912523921064267E-4 0.0014715179197848554 76-77 0.013158017377970399 1.6016521575889584E-4 6.729163578759165E-4 2.491458911805046E-4 0.0014915385717547175 78-79 0.01528799229587516 1.6016521575889584E-4 7.151821787011807E-4 2.6249299249374595E-4 0.001529355358808901 80-81 0.017959637075408964 1.6016521575889584E-4 7.518867073125943E-4 2.6805428470759647E-4 0.0015527127861070735 82-83 0.021295300145276523 1.6238973264443604E-4 7.941525281378584E-4 2.7472783536421715E-4 0.0015805192471763261 84-85 0.02548962673296261 1.6461424952997626E-4 7.952647865806285E-4 2.814013860208378E-4 0.0015938663484895675 86-87 0.03045474842148838 1.679510248582866E-4 8.041628541227894E-4 2.9586074577684924E-4 0.001627234101772671 88-89 0.03654325113721196 1.7017554174382683E-4 8.163976969932607E-4 2.9808526266238947E-4 0.0016761734732545558 90-91 0.04389639170236516 1.7128780018659692E-4 8.186222138788009E-4 2.9808526266238947E-4 0.0017028676758810383 92-93 0.052675447591149636 1.7128780018659692E-4 8.230712476498814E-4 3.025342964334699E-4 0.001729561878507521 94-95 0.06344544609249261 1.7351231707213714E-4 8.230712476498814E-4 3.025342964334699E-4 0.0017518070473629232 96-97 0.07611073298031584 1.7573683395767737E-4 8.230712476498814E-4 3.025342964334699E-4 0.0018685941838537845 98-99 0.09097940384326669 1.7573683395767737E-4 8.252957645354216E-4 3.047588133190101E-4 0.0019197580722212096 100-101 0.10824610390882985 1.7573683395767737E-4 8.252957645354216E-4 3.047588133190101E-4 0.001972034219031405 102-103 0.12851145273610126 1.801858677287578E-4 8.29744798306502E-4 3.047588133190101E-4 0.0019998406801006573 104-105 0.152278191141213 1.812981261715279E-4 8.964803048727085E-4 3.0920784709009055E-4 0.0020231981073988298 106-107 0.17988333343232432 1.8241038461429802E-4 9.910222725081678E-4 3.1143236397563077E-4 0.002076586512651795 108-109 0.21036588831488195 1.8241038461429802E-4 0.001023277767348501 3.1143236397563077E-4 0.0021444342776607717 110-111 0.24451667154169543 1.8241038461429802E-4 0.0010477474530894435 3.1143236397563077E-4 0.002232302694639611 112-113 0.28326775568780604 1.8241038461429802E-4 0.0010566455206316044 3.1143236397563077E-4 0.002266782706365484 114-115 0.3270907383329484 1.8685941838537847E-4 0.0010655435881737653 3.1143236397563077E-4 0.0022790175492359553 116-117 0.37605680401745967 1.901961937136888E-4 0.0010755539141586961 3.1143236397563077E-4 0.002296813684320277 118-119 0.42919272660391616 1.913084521564589E-4 0.0010811152063725468 3.13656880861171E-4 0.0023435285389166215 120-121 0.48809459695769286 1.92420710599229E-4 0.001083339723258087 3.158813977467112E-4 0.0023557633817870927 122-123 0.5521896019807633 1.9575748592753933E-4 0.0010877887570291676 3.1810591463225145E-4 0.002443631798765932 124-125 0.6244341246140102 1.9909426125584967E-4 0.001092237790800248 3.2255494840333185E-4 0.00252705118197369 126-127 0.7057157470947643 2.0243103658416E-4 0.0010977990830140986 3.270039821744123E-4 0.0025437350586152412 128-129 0.792282821695562 2.0354329502693012E-4 0.0011100339258845696 3.281162406171824E-4 0.0025960112054254367 130-131 0.8852787500955708 2.12441362569091E-4 0.0011322790947399719 3.3034075750272264E-4 0.0026171441158380684 132-133 0.9851840279420676 2.2690072232510244E-4 0.0011411771622821328 3.359020497165732E-4 0.0026416138015790108 134-135 1.095174153089161 2.357987898672633E-4 0.0012201475117188105 3.503614094725846E-4 0.0026671957457627235 136-137 1.2158920109167721 2.3802330675280352E-4 0.0012301578377037416 3.5147366791535474E-4 0.002680542847075965 138-139 1.3448294586364544 2.3802330675280352E-4 0.001244617197459753 3.5369818480089497E-4 0.0027083493081452178 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTA 59570 0.0 15.819219 4 CGGGACT 16260 0.0 14.136277 1 TTTTTAA 35310 0.0 13.610846 5 TTTTTTT 502405 0.0 12.804539 1 GTCGGTT 14875 0.0 12.089018 1 GGCGATT 19385 0.0 11.258927 1 GGGAAAT 38715 0.0 10.46957 1 GTCGATT 31480 0.0 10.272981 1 GTCGCAT 16425 0.0 9.7121105 1 GCCAAAT 47025 0.0 9.652546 1 GTCGGAT 19090 0.0 9.647707 1 CTCACAT 42185 0.0 9.522435 1 GTCGAAT 23210 0.0 9.434701 1 GTCAATT 30660 0.0 9.1051035 1 TTTTTAG 32435 0.0 8.939544 5 GCCAATT 55535 0.0 8.891534 1 GTCACGT 15530 0.0 8.87112 1 GTCGGCT 19160 0.0 8.779885 1 GTCCGAT 14015 0.0 8.640119 1 GTCACAT 31885 0.0 8.573364 1 >>END_MODULE SRR7814930 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814930_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 44953581 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41330589436245 37.0 37.0 37.0 37.0 37.0 2 36.13258781319335 37.0 37.0 37.0 37.0 37.0 3 36.176793190291114 37.0 37.0 37.0 37.0 37.0 4 36.219339478205306 37.0 37.0 37.0 37.0 37.0 5 36.24226574964072 37.0 37.0 37.0 37.0 37.0 6 36.16528523055816 37.0 37.0 37.0 37.0 37.0 7 36.106461618708416 37.0 37.0 37.0 37.0 37.0 8 36.206108496673494 37.0 37.0 37.0 37.0 37.0 9 36.21337990848827 37.0 37.0 37.0 37.0 37.0 10-14 36.18112819977567 37.0 37.0 37.0 37.0 37.0 15-19 36.12231557259031 37.0 37.0 37.0 37.0 37.0 20-24 36.099042828200936 37.0 37.0 37.0 37.0 37.0 25-29 36.05211593265507 37.0 37.0 37.0 37.0 37.0 30-34 36.00698526330973 37.0 37.0 37.0 37.0 37.0 35-39 35.960647531060985 37.0 37.0 37.0 37.0 37.0 40-44 35.9088648221373 37.0 37.0 37.0 37.0 37.0 45-49 35.87632403745543 37.0 37.0 37.0 37.0 37.0 50-54 35.788912740900436 37.0 37.0 37.0 37.0 37.0 55-59 35.72104055069606 37.0 37.0 37.0 37.0 37.0 60-64 35.68129965886366 37.0 37.0 37.0 37.0 37.0 65-69 35.661295143539284 37.0 37.0 37.0 37.0 37.0 70-74 35.55997975333712 37.0 37.0 37.0 37.0 37.0 75-79 35.52143825427389 37.0 37.0 37.0 37.0 37.0 80-84 35.44926354587858 37.0 37.0 37.0 37.0 37.0 85-89 35.41599744856811 37.0 37.0 37.0 34.6 37.0 90-94 35.33632729726248 37.0 37.0 37.0 37.0 37.0 95-99 35.143299071101815 37.0 37.0 37.0 27.4 37.0 100-104 35.149408350805246 37.0 37.0 37.0 27.4 37.0 105-109 34.95207157356385 37.0 37.0 37.0 25.0 37.0 110-114 34.92922583408872 37.0 37.0 37.0 25.0 37.0 115-119 34.88560008155969 37.0 37.0 37.0 25.0 37.0 120-124 34.712242448493704 37.0 37.0 37.0 25.0 37.0 125-129 34.7458659500341 37.0 37.0 37.0 25.0 37.0 130-134 34.44417323282877 37.0 37.0 37.0 25.0 37.0 135-139 34.2760797187659 37.0 37.0 37.0 25.0 37.0 140-144 34.34914737048423 37.0 37.0 37.0 25.0 37.0 145-149 34.162414482619305 37.0 37.0 37.0 25.0 37.0 150-151 33.3464927076666 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 155.0 12 9720.0 13 44684.0 14 60766.0 15 52118.0 16 38261.0 17 31601.0 18 28530.0 19 31468.0 20 40173.0 21 60229.0 22 83687.0 23 100238.0 24 105455.0 25 116345.0 26 135104.0 27 173628.0 28 225782.0 29 314320.0 30 442595.0 31 669648.0 32 1036630.0 33 1800720.0 34 3525237.0 35 9539060.0 36 2.5440431E7 37 846996.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.843576850167906 15.564537775413022 11.190957404660244 29.40092796975883 2 29.91244679706384 20.53231532322197 27.817463529768627 21.737774349945557 3 25.246458118653553 23.73803546373758 26.43507310351983 24.58043331408904 4 28.62341711998428 31.16019611429844 17.609956368103354 22.60643039761393 5 28.144818985610957 32.80386049778771 17.829015668406928 21.222304848194405 6 23.459819585896838 34.210257910265256 18.57460921745033 23.755313286387576 7 22.30979551996091 16.28054058696681 35.87227233354335 25.537391559528928 8 23.674883653873984 20.727821438741444 22.543823594387284 33.05347131299729 9 24.805171806001393 21.409215430468155 24.53471281854053 29.25089994498992 10-14 26.5928165389268 24.962634050868054 22.284701210816653 26.15984819938849 15-19 26.69992808804264 24.433948877176213 23.11726000204522 25.748863032735926 20-24 26.484500978909782 24.773151665047553 23.19249004879055 25.549857307252115 25-29 26.643072995675247 24.69484066241575 23.147541460601325 25.51454488130768 30-34 26.519962002582176 24.751592982103027 23.307429056652907 25.42101595866189 35-39 26.63021544998308 24.687723739226247 23.097970712051175 25.584090098739498 40-44 26.805707425177093 24.72311605164447 23.090494614878402 25.38068190830003 45-49 26.859039772604543 24.691683183148413 23.200092112795197 25.249184931451847 50-54 26.892305198110915 24.783362642455558 23.14134351165483 25.182988647778693 55-59 26.987763221799838 24.656063328970387 23.063789734570868 25.292383714658907 60-64 26.935504693899397 24.749238665095422 23.19733823327805 25.11791840772713 65-69 26.983056144070034 24.747550590018623 23.18491957292568 25.08447369298566 70-74 27.017673186036056 24.667614355350246 23.190103142172365 25.124609316441333 75-79 26.939368412051536 24.726040401542203 23.26868998489798 25.065901201508282 80-84 26.98314334513195 24.846803194610903 23.20086668957474 24.969186770682406 85-89 27.09259138789252 24.746168928454225 23.183892172737167 24.977347510916086 90-94 26.94895785944172 24.861396915186802 23.296612565748656 24.893032659622826 95-99 27.117742188325327 24.91565421673526 23.170945157850717 24.795658437088694 100-104 27.111014359456703 24.81690880199288 23.184244209599232 24.887832628951184 105-109 26.903607523502966 24.854925795566764 23.361136457627257 24.88033022330301 110-114 27.15994650229339 25.047129311237626 23.087840807208984 24.705083379259996 115-119 27.13576922826237 25.04357861946527 23.105056747314524 24.71559540495784 120-124 27.081727259948433 25.0314874803856 23.183877164313117 24.70290809535285 125-129 26.982788312237016 25.08070002254103 23.258651185096912 24.677860480125045 130-134 27.08561171133396 24.97021227296664 23.358452355553165 24.58572366014623 135-139 26.99884035906381 25.21464524397061 23.46782958505854 24.31868481190704 140-144 27.044818965590306 25.18424638962578 23.425696386679405 24.34523825810451 145-149 27.058189646782534 25.229956652396613 23.33668901705517 24.375164683765682 150-151 27.44080833070896 25.103455050666597 23.23993054079496 24.215806077829484 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 5375.0 1 3902.0 2 2260.0 3 2258.0 4 2665.5 5 3288.0 6 4013.0 7 4649.5 8 5218.0 9 5726.5 10 6209.0 11 6676.5 12 7044.0 13 7358.0 14 7710.0 15 7953.5 16 7987.5 17 8127.0 18 8340.5 19 8425.5 20 8653.0 21 9105.5 22 9437.0 23 9966.5 24 10962.5 25 12748.0 26 15625.5 27 19742.0 28 25746.5 29 33698.5 30 47002.5 31 65946.5 32 89065.0 33 120496.5 34 169003.0 35 237132.0 36 329059.0 37 453426.5 38 611820.5 39 807265.0 40 1030553.0 41 1254034.0 42 1449168.0 43 1614391.0 44 1767876.5 45 1883854.0 46 1932856.0 47 1933901.5 48 1894661.5 49 1822990.0 50 1710215.5 51 1612838.5 52 1511696.0 53 1369024.0 54 1262420.5 55 1172069.0 56 1089404.0 57 1093216.0 58 1166446.5 59 1122674.0 60 1011863.0 61 963023.0 62 963528.5 63 962503.0 64 915939.0 65 889623.5 66 869081.5 67 852995.5 68 817970.0 69 728929.0 70 631952.0 71 541998.0 72 462766.0 73 386586.5 74 292214.5 75 204006.0 76 147159.0 77 104780.0 78 71880.0 79 48304.0 80 32136.0 81 21539.5 82 14885.5 83 10221.0 84 7433.5 85 5875.5 86 5045.5 87 4686.5 88 4450.5 89 4231.5 90 4091.5 91 3931.5 92 3837.0 93 3934.0 94 3978.0 95 3986.5 96 4196.0 97 4529.0 98 5017.0 99 6464.5 100 21559.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0018307773967996008 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 1.9175335553356696E-4 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 4.404543433369635E-5 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 8.853577204450075E-5 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 4.938427485899288E-5 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 6.184156941801811E-5 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 2.4469685740942416E-5 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4.4953581E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 26.977432860311364 #Duplication Level Percentage of deduplicated Percentage of total 1 57.75760483801066 15.581519066898275 2 15.780695614835885 8.5144531287649 3 7.919620178989035 6.409530649735314 4 4.531222322296597 4.889629838996024 5 2.845565369879265 3.838302435777248 6 2.025948238661183 3.2792929552168872 7 1.4729376027173224 2.781525269931418 8 1.1098940273120448 2.395367328309702 9 0.8695517876018481 2.1112447471733327 >10 5.074591418305635 25.186034050469434 >50 0.3818708173600345 7.0497789907278205 >100 0.20931672555593786 10.498893943123253 >500 0.014057804802118079 2.579793252410235 >1k 0.006628125589248858 3.0258767279244747 >5k 2.8424020750249506E-4 0.5379671222963045 >10k+ 2.1088787558565253E-4 1.3207904922454845 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 67166 0.1494119011341944 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 58509 0.13015425845607273 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 3.1143236397563075E-5 0.0 4.449033771080439E-6 0.0 4.449033771080439E-6 2 3.3367753283103294E-5 0.0 4.449033771080439E-6 0.0 4.449033771080439E-6 3 4.893937148188484E-5 0.0 4.449033771080439E-6 0.0 2.002065196986198E-5 4 7.785809099390769E-5 0.0 6.67355065662066E-6 0.0 2.669420262648264E-5 5 8.89806754216088E-5 0.0 1.334710131324132E-5 0.0 2.669420262648264E-5 6 9.787874296376968E-5 0.0 1.334710131324132E-5 0.0 2.8918719512022858E-5 7 1.0900132739147077E-4 0.0 1.334710131324132E-5 0.0 3.1143236397563075E-5 8 1.1567487804809143E-4 0.0 1.5571618198781537E-5 0.0 4.44903377108044E-5 9 1.245729455902523E-4 0.0 1.7796135084321757E-5 0.0 4.44903377108044E-5 10-11 1.557161819878154E-4 0.0 2.002065196986198E-5 2.2245168855402196E-6 5.227614681019517E-5 12-13 1.8574715994260836E-4 0.0 2.002065196986198E-5 4.449033771080439E-6 6.228647279512615E-5 14-15 2.3023749765341275E-4 0.0 2.002065196986198E-5 4.449033771080439E-6 7.785809099390769E-5 16-17 2.713910600359068E-4 0.0 3.1143236397563075E-5 4.449033771080439E-6 8.230712476498813E-5 18-19 3.470246341442743E-4 1.1122584427701098E-6 3.781678705418374E-5 4.449033771080439E-6 8.341938320775825E-5 20-21 4.1264788226771075E-4 3.3367753283103294E-6 6.0061955909585936E-5 4.449033771080439E-6 8.786841697883868E-5 22-23 5.149756590025608E-4 4.449033771080439E-6 6.78477650089767E-5 4.449033771080439E-6 9.565422607822946E-5 24-25 6.284260201651121E-4 4.449033771080439E-6 7.118454033728703E-5 4.449033771080439E-6 1.0344003517762023E-4 26-27 8.030505956800193E-4 4.449033771080439E-6 8.89806754216088E-5 5.561292213850549E-6 1.1567487804809142E-4 28-29 9.62103552996145E-4 4.449033771080439E-6 9.231745074991912E-5 6.67355065662066E-6 1.3903230534626372E-4 30-31 0.0011589732973664546 4.449033771080439E-6 1.0455229362039033E-4 6.67355065662066E-6 1.6127747420166592E-4 32-33 0.0013436081988662928 4.449033771080439E-6 1.11225844277011E-4 6.67355065662066E-6 1.7017554174382683E-4 34-35 0.0015927540900467973 4.449033771080439E-6 1.1345036116255122E-4 6.67355065662066E-6 1.8463490149983825E-4 36-37 0.0018263283630285203 4.449033771080439E-6 1.223484287047121E-4 6.67355065662066E-6 1.9019619371368881E-4 38-39 0.0020832600633084158 4.449033771080439E-6 1.379200469034936E-4 6.67355065662066E-6 1.9353296904199913E-4 40-41 0.002350202089573242 4.449033771080439E-6 1.468181144456545E-4 1.334710131324132E-5 2.0020651969861978E-4 42-43 0.002620480891166379 4.449033771080439E-6 1.546039235450453E-4 1.334710131324132E-5 2.1132910412632088E-4 44-45 0.0029519339071118716 4.449033771080439E-6 1.6238973264443604E-4 1.334710131324132E-5 2.22451688554022E-4 46-47 0.003301183058141686 4.449033771080439E-6 1.6906328330105672E-4 1.334710131324132E-5 2.369110483100334E-4 48-49 0.0036826877040118337 4.449033771080439E-6 1.7573683395767737E-4 1.334710131324132E-5 2.4136008208111386E-4 50-51 0.004088662035622925 4.449033771080439E-6 1.801858677287578E-4 1.334710131324132E-5 2.5470718339435516E-4 52-53 0.004522442828303267 4.449033771080439E-6 1.8463490149983825E-4 1.334710131324132E-5 2.7472783536421715E-4 54-55 0.0049662339469685405 4.449033771080439E-6 1.9019619371368881E-4 1.5571618198781537E-5 2.9697300421961935E-4 56-57 0.005476760572200021 4.449033771080439E-6 1.9798200281307955E-4 1.5571618198781537E-5 3.1921817307502156E-4 58-59 0.006088502715723582 4.449033771080439E-6 1.9798200281307955E-4 1.5571618198781537E-5 3.4257560037319383E-4 60-61 0.006698020342361602 4.449033771080439E-6 1.9798200281307955E-4 1.5571618198781537E-5 3.6148399390028576E-4 62-63 0.007320885070312863 4.449033771080439E-6 2.013187781413899E-4 1.5571618198781537E-5 3.7260657832798684E-4 64-65 0.008115037598450722 4.449033771080439E-6 2.0243103658416E-4 1.5571618198781537E-5 3.815046458701477E-4 66-67 0.008970364340940937 4.449033771080439E-6 2.0354329502693012E-4 1.5571618198781537E-5 3.9707626406892927E-4 68-69 0.009972509197876806 4.449033771080439E-6 2.1021684568355077E-4 1.7796135084321757E-5 4.460156355508141E-4 70-71 0.011263841249932903 4.449033771080439E-6 2.3023749765341275E-4 1.7796135084321757E-5 4.7604661350560704E-4 72-73 0.012645266235853379 5.561292213850549E-6 2.3468653142449318E-4 2.002065196986198E-5 4.927304901471587E-4 74-75 0.014343684877963336 8.89806754216088E-6 2.4469685740942414E-4 2.002065196986198E-5 5.016285576893195E-4 76-77 0.016230075196901443 1.11225844277011E-5 2.558194418371253E-4 2.002065196986198E-5 5.172001758881012E-4 78-79 0.018540235982534962 1.11225844277011E-5 2.580439587226655E-4 2.002065196986198E-5 5.249859849874919E-4 80-81 0.02144545503505049 1.334710131324132E-5 2.6138073405097584E-4 2.002065196986198E-5 5.383330863007333E-4 82-83 0.024950181388219105 1.5571618198781537E-5 2.791768691352976E-4 2.002065196986198E-5 5.494556707284343E-4 84-85 0.029356949338474284 1.7796135084321757E-5 2.925239704485389E-4 2.113291041263209E-5 5.639150304844458E-4 86-87 0.03449780786095773 1.7796135084321757E-5 2.9808526266238947E-4 2.22451688554022E-5 5.661395473699859E-4 88-89 0.04079763968080763 1.7796135084321757E-5 3.0364655487624E-4 2.22451688554022E-5 5.783743902404571E-4 90-91 0.048364333866972684 1.7796135084321757E-5 3.0809558864732043E-4 2.22451688554022E-5 5.87272457782618E-4 92-93 0.057427015658663545 1.7796135084321757E-5 3.1699365618948134E-4 2.22451688554022E-5 6.0729310975248E-4 94-95 0.0683616284095365 1.890839352709187E-5 3.23667206846102E-4 2.22451688554022E-5 6.195279526229512E-4 96-97 0.0812182237495162 2.22451688554022E-5 3.3478979127380304E-4 2.22451688554022E-5 6.239769863940316E-4 98-99 0.096251508861997 2.22451688554022E-5 3.403510834876536E-4 2.22451688554022E-5 6.317627954934224E-4 100-101 0.11363277154716551 2.22451688554022E-5 3.4591237570150417E-4 2.335742729817231E-5 6.517834474632845E-4 102-103 0.13407941850060845 2.22451688554022E-5 3.6815754455690633E-4 2.446968574094242E-5 6.640182903337557E-4 104-105 0.15795404597466883 2.22451688554022E-5 3.84841421198458E-4 2.446968574094242E-5 6.77365391646997E-4 106-107 0.1856225869970181 2.558194418371253E-5 3.904027134123086E-4 2.446968574094242E-5 6.951615267313186E-4 108-109 0.21610402962113295 2.780646106925275E-5 3.9373948874061893E-4 2.446968574094242E-5 7.051718527162497E-4 110-111 0.2501991999258079 3.0030977954792968E-5 3.9373948874061893E-4 2.446968574094242E-5 7.140699202584106E-4 112-113 0.2889580698810179 3.1143236397563075E-5 3.959640056261591E-4 2.446968574094242E-5 7.218557293578013E-4 114-115 0.332946779034133 3.1143236397563075E-5 4.104233653821705E-4 2.446968574094242E-5 7.463254150987437E-4 116-117 0.38197401893299665 3.1143236397563075E-5 4.2710724202372216E-4 2.446968574094242E-5 7.69682842396916E-4 118-119 0.43525008608324217 3.3367753283103294E-5 4.3600530956588307E-4 2.446968574094242E-5 7.841422021529275E-4 120-121 0.4940818841551244 3.5592270168643514E-5 4.382298264514233E-4 2.446968574094242E-5 8.130609216649503E-4 122-123 0.5580812349521165 3.670452861141363E-5 4.504646693218945E-4 2.446968574094242E-5 8.386428658486629E-4 124-125 0.6297585057795507 3.781678705418374E-5 4.538014446502048E-4 2.446968574094242E-5 8.542144840474444E-4 126-127 0.710168117641173 4.671485459634462E-5 4.5713821997851517E-4 2.446968574094242E-5 8.575512593757548E-4 128-129 0.7956129234732157 4.671485459634462E-5 4.6381177063513585E-4 2.669420262648264E-5 8.786841697883868E-4 130-131 0.8868381364323346 4.671485459634462E-5 4.7604661350560704E-4 2.669420262648264E-5 9.398583841407429E-4 132-133 0.985341968640941 5.0051629924654945E-5 4.7827113039114726E-4 2.669420262648264E-5 9.654403283244554E-4 134-135 1.0935825112575568 5.338840525296528E-5 4.8494468104776794E-4 3.1143236397563075E-5 9.988080816075587E-4 136-137 1.2121681696503779 5.338840525296528E-5 4.882814563760782E-4 3.1143236397563075E-5 0.001003257115378639 138-139 1.3385796784465291 5.338840525296528E-5 4.893937148188484E-4 3.1143236397563075E-5 0.0010166042166918805 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGCT 50830 0.0 25.560194 1 CACACAC 55005 0.0 18.90137 1 TTGGCTT 69420 0.0 18.328611 2 CTCACAC 27830 0.0 17.636505 7 AGCCTAG 28125 0.0 16.626945 9 TTAATAC 15855 0.0 16.095835 3 TCACACT 32475 0.0 15.873246 8 TGGCTTC 82080 0.0 15.642937 3 TAATACC 15805 0.0 15.596296 4 CACACTC 32650 0.0 15.144204 9 CCTCACA 33790 0.0 15.083571 6 GCTTCTC 86020 0.0 14.53874 5 GGCTTCT 87890 0.0 14.138665 4 ACACACA 68215 0.0 14.135424 2 GCACACA 42100 0.0 13.036195 2 AAGCCTA 37925 0.0 12.789272 8 AGCCTCA 42170 0.0 12.722288 4 GCCTCAC 44220 0.0 12.329237 5 AGCACAC 48620 0.0 11.9891205 1 TTTAATA 22135 0.0 11.758501 2 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814930 SRR7814930_1.fastq SRR7814930_2.fastq Input file: SRR7814930_1.fastq Paired file: SRR7814930_2.fastq trimmed: SRR7814930-trimmed-pair1.fastq, SRR7814930-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Mar 12 09:54:57 2025 >> started Wed Mar 12 09:56:24 2025 >> done (86.424s) 44953581 read pairs processed; of these: 155 ( 0.00%) short read pairs filtered out after trimming by size control 3260 ( 0.01%) empty read pairs filtered out after trimming by size control 44950166 (99.99%) read pairs available; of these: 1114998 ( 2.48%) trimmed read pairs available after processing 43835168 (97.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 18 0.00% 20 13 0.00% 21 33 0.00% 22 38 0.00% 23 29 0.00% 24 29 0.00% 25 57 0.00% 26 44 0.00% 27 43 0.00% 28 56 0.00% 29 53 0.00% 30 65 0.00% 31 42 0.00% 32 75 0.00% 33 67 0.00% 34 65 0.00% 35 66 0.00% 36 60 0.00% 37 69 0.00% 38 86 0.00% 39 74 0.00% 40 55 0.00% 41 67 0.00% 42 92 0.00% 43 90 0.00% 44 87 0.00% 45 90 0.00% 46 123 0.00% 47 88 0.00% 48 119 0.00% 49 87 0.00% 50 109 0.00% 51 113 0.00% 52 107 0.00% 53 110 0.00% 54 141 0.00% 55 141 0.00% 56 147 0.00% 57 171 0.00% 58 146 0.00% 59 178 0.00% 60 147 0.00% 61 183 0.00% 62 187 0.00% 63 199 0.00% 64 227 0.00% 65 215 0.00% 66 225 0.00% 67 240 0.00% 68 282 0.00% 69 344 0.00% 70 311 0.00% 71 325 0.00% 72 388 0.00% 73 421 0.00% 74 416 0.00% 75 448 0.00% 76 528 0.00% 77 538 0.00% 78 637 0.00% 79 714 0.00% 80 741 0.00% 81 806 0.00% 82 942 0.00% 83 1026 0.00% 84 1137 0.00% 85 1183 0.00% 86 1321 0.00% 87 1506 0.00% 88 1548 0.00% 89 1767 0.00% 90 1946 0.00% 91 2067 0.00% 92 2329 0.01% 93 2564 0.01% 94 2713 0.01% 95 3052 0.01% 96 3110 0.01% 97 3471 0.01% 98 3861 0.01% 99 3997 0.01% 100 4229 0.01% 101 4777 0.01% 102 5056 0.01% 103 5582 0.01% 104 5837 0.01% 105 6426 0.01% 106 6952 0.02% 107 6885 0.02% 108 7447 0.02% 109 7886 0.02% 110 8374 0.02% 111 9013 0.02% 112 9494 0.02% 113 10084 0.02% 114 10998 0.02% 115 11348 0.03% 116 11742 0.03% 117 12266 0.03% 118 12996 0.03% 119 13703 0.03% 120 14121 0.03% 121 14882 0.03% 122 15485 0.03% 123 16646 0.04% 124 18033 0.04% 125 18595 0.04% 126 19617 0.04% 127 19835 0.04% 128 20439 0.05% 129 21585 0.05% 130 21976 0.05% 131 22864 0.05% 132 24360 0.05% 133 25287 0.06% 134 26386 0.06% 135 28025 0.06% 136 28827 0.06% 137 29717 0.07% 138 30838 0.07% 139 32009 0.07% 140 32639 0.07% 141 33972 0.08% 142 35617 0.08% 143 36585 0.08% 144 38923 0.09% 145 40944 0.09% 146 42203 0.09% 147 42948 0.10% 148 44383 0.10% 149 45178 0.10% 150 49559 0.11% 151 43835168 97.52% 44950166 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.99 fanout-score-rank=33 prefix-density=0.80 prefix-fanout=3.1 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=91.54 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.9 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=35 prefix-density=0.82 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=97.52 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=15.9 sequence=GCCGCCGCCGCCA SRR7814930 testing PE reads STAR mapping to Ensembl genome Started job on | Mar 12 09:57:22 Started mapping on | Mar 12 09:57:22 Finished on | Mar 12 10:03:52 Mapping speed, Million of reads per hour | 414.92 Number of input reads | 44950166 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 41917322 Uniquely mapped reads % | 93.25% Average mapped length | 300.09 Number of splices: Total | 44914756 Number of splices: Annotated (sjdb) | 42415033 Number of splices: GT/AG | 44328139 Number of splices: GC/AG | 532560 Number of splices: AT/AC | 21629 Number of splices: Non-canonical | 32428 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391148 % of reads mapped to multiple loci | 0.87% Number of reads mapped to too many loci | 18381 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.54% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2641696 2641696 2641696 N_multimapping 391148 391148 391148 N_noFeature 1017561 40551857 1332282 N_ambiguous 1222921 6411 174016 UnstrandedReadsAssigned:39676840 PositiveStrandReadsAssigned:1359054 NegativeStrandReadsAssigned:40411024 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814930 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814930-trimmed-pair1.fastq SRR7814930-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,950,166 reads, 41,058,041 reads pseudoaligned [quant] estimated average fragment length: 314.871 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR7814930.ke.tsv 35125 SRR7814930.se.tsv 88098 total ==> SRR7814930.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 622.875 0 0 PNS24247 1044 730.129 191.504 7.9225 PNS24249 1928 1614.13 110.651 2.07063 PNS24246 1044 730.129 191.504 7.9225 PNS24248 1044 730.129 191.504 7.9225 PNS24244 1471 1157.13 460.838 12.0296 PNS24243 293 70.1125 0 0 KQK14069 1603 1289.13 17827.3 417.71 KQK14071 474 193.245 364.267 56.9373 ==> SRR7814930.se.tsv <== BRADI_1g14170v3 19201 BRADI_1g53295v3 426 BRADI_1g59795v3 1170 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 638 BRADI_1g74790v3 1689 BRADI_1g09890v3 0 BRADI_1g77505v3 599 BRADI_1g48960v3 0 SRR7814930 completed mapping pipeline successfully