Starting /dee2/code/volunteer_pipeline.sh SRR7814931 current disk space = 1548201828352 free memory = 1604537196 SRR7814931 SRAfilesize 9ef6c3f5b992059a573b52c6ec80b326 SRR7814931.sra SRR7814931.sra file validated SRR7814931 is paired end SRR7814931 is conventional basespace SRR7814931 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814931_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.18 37.0 37.0 37.0 37.0 37.0 2 36.3485 37.0 37.0 37.0 37.0 37.0 3 36.4455 37.0 37.0 37.0 37.0 37.0 4 36.4535 37.0 37.0 37.0 37.0 37.0 5 36.627 37.0 37.0 37.0 37.0 37.0 6 36.477 37.0 37.0 37.0 37.0 37.0 7 36.4275 37.0 37.0 37.0 37.0 37.0 8 36.5615 37.0 37.0 37.0 37.0 37.0 9 36.55 37.0 37.0 37.0 37.0 37.0 10-14 36.5659 37.0 37.0 37.0 37.0 37.0 15-19 36.5099 37.0 37.0 37.0 37.0 37.0 20-24 36.50699999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5046 37.0 37.0 37.0 37.0 37.0 30-34 36.427499999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.443 37.0 37.0 37.0 37.0 37.0 40-44 36.4428 37.0 37.0 37.0 37.0 37.0 45-49 36.392500000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.2958 37.0 37.0 37.0 37.0 37.0 55-59 36.3317 37.0 37.0 37.0 37.0 37.0 60-64 36.285900000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2536 37.0 37.0 37.0 37.0 37.0 70-74 36.2277 37.0 37.0 37.0 37.0 37.0 75-79 36.2391 37.0 37.0 37.0 37.0 37.0 80-84 36.2167 37.0 37.0 37.0 37.0 37.0 85-89 36.1905 37.0 37.0 37.0 37.0 37.0 90-94 36.0676 37.0 37.0 37.0 37.0 37.0 95-99 36.029900000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.97249999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.0061 37.0 37.0 37.0 37.0 37.0 110-114 35.9911 37.0 37.0 37.0 37.0 37.0 115-119 35.933 37.0 37.0 37.0 37.0 37.0 120-124 35.7752 37.0 37.0 37.0 37.0 37.0 125-129 35.7152 37.0 37.0 37.0 37.0 37.0 130-134 35.6498 37.0 37.0 37.0 37.0 37.0 135-139 35.7543 37.0 37.0 37.0 37.0 37.0 140-144 35.5793 37.0 37.0 37.0 37.0 37.0 145-149 35.5473 37.0 37.0 37.0 34.6 37.0 150-151 34.66275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 3.0 24 1.0 25 5.0 26 5.0 27 7.0 28 4.0 29 22.0 30 27.0 31 30.0 32 50.0 33 94.0 34 196.0 35 417.0 36 2882.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.01856497742097 13.095835423983942 9.031610637230306 36.85398896136478 2 23.45 17.625 35.35 23.575 3 21.875 22.7 24.125 31.3 4 26.35 30.925000000000004 19.25 23.474999999999998 5 25.4 32.550000000000004 22.35 19.7 6 21.175 32.925 23.925 21.975 7 15.475 19.400000000000002 43.125 22.0 8 20.075000000000003 21.75 28.599999999999998 29.575000000000003 9 20.65 20.275000000000002 31.175000000000004 27.900000000000002 10-14 22.900000000000002 26.135 25.064999999999998 25.900000000000002 15-19 23.57 25.575 25.165 25.69 20-24 23.685000000000002 25.66 24.845 25.81 25-29 23.375 25.405 25.405 25.814999999999998 30-34 23.72 25.55 25.825 24.905 35-39 23.535 25.345000000000002 25.03 26.090000000000003 40-44 23.815 25.395 25.485000000000003 25.305 45-49 23.13 25.465 24.84 26.565 50-54 23.125 25.56 25.374999999999996 25.94 55-59 23.71 24.795 24.98 26.515 60-64 24.404999999999998 25.035 24.69 25.869999999999997 65-69 23.97 24.69 25.240000000000002 26.1 70-74 23.235 25.25 25.419999999999998 26.095000000000002 75-79 23.7 25.16 24.72 26.419999999999998 80-84 23.669999999999998 24.92 24.895 26.515 85-89 24.185000000000002 25.115 24.415 26.284999999999997 90-94 23.799999999999997 25.240000000000002 24.575 26.384999999999998 95-99 23.945 24.7 24.705 26.650000000000002 100-104 23.16 24.48 25.430000000000003 26.93 105-109 23.775 25.345000000000002 24.18 26.700000000000003 110-114 24.305 25.03 24.525 26.14 115-119 24.05 25.255 24.565 26.13 120-124 23.97 24.335 25.245 26.450000000000003 125-129 24.445 24.465 24.965 26.125 130-134 24.099999999999998 24.895 25.205 25.8 135-139 24.295 24.805 24.345 26.555 140-144 24.38 24.5 24.91 26.21 145-149 24.195 24.32 24.205 27.279999999999998 150-151 25.137500000000003 24.337500000000002 24.0 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 3.0 28 4.5 29 4.5 30 7.0 31 9.0 32 12.0 33 17.0 34 21.0 35 30.0 36 53.5 37 66.0 38 66.0 39 90.5 40 114.0 41 124.5 42 149.5 43 180.0 44 192.0 45 197.5 46 200.5 47 202.5 48 194.5 49 185.0 50 179.0 51 161.5 52 152.0 53 131.5 54 111.5 55 109.5 56 107.5 57 95.0 58 87.5 59 81.5 60 60.5 61 54.0 62 53.5 63 52.0 64 55.5 65 54.5 66 54.0 67 50.0 68 42.0 69 35.5 70 27.0 71 22.5 72 23.5 73 22.0 74 19.5 75 13.0 76 6.5 77 3.5 78 3.5 79 2.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5925925925926 85.625 2 6.677480400108138 12.35 3 0.7299270072992701 2.025 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.1125 0.0 0.0 0.0 0.0 130-131 1.2374999999999998 0.0 0.0 0.0 0.0 132-133 1.3624999999999998 0.0 0.0 0.0 0.0 134-135 1.5625 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138-139 1.7000000000000002 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814931 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814931_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.556 37.0 37.0 37.0 37.0 37.0 2 36.281 37.0 37.0 37.0 37.0 37.0 3 36.3185 37.0 37.0 37.0 37.0 37.0 4 36.359 37.0 37.0 37.0 37.0 37.0 5 36.3315 37.0 37.0 37.0 37.0 37.0 6 36.336 37.0 37.0 37.0 37.0 37.0 7 36.264 37.0 37.0 37.0 37.0 37.0 8 36.3805 37.0 37.0 37.0 37.0 37.0 9 36.343 37.0 37.0 37.0 37.0 37.0 10-14 36.3249 37.0 37.0 37.0 37.0 37.0 15-19 36.2522 37.0 37.0 37.0 37.0 37.0 20-24 36.1791 37.0 37.0 37.0 37.0 37.0 25-29 36.1742 37.0 37.0 37.0 37.0 37.0 30-34 36.1706 37.0 37.0 37.0 37.0 37.0 35-39 36.0989 37.0 37.0 37.0 37.0 37.0 40-44 36.0612 37.0 37.0 37.0 37.0 37.0 45-49 36.0253 37.0 37.0 37.0 37.0 37.0 50-54 35.90599999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.806900000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.7991 37.0 37.0 37.0 37.0 37.0 65-69 35.7416 37.0 37.0 37.0 37.0 37.0 70-74 35.726200000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.6857 37.0 37.0 37.0 37.0 37.0 80-84 35.5937 37.0 37.0 37.0 37.0 37.0 85-89 35.511300000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.3785 37.0 37.0 37.0 37.0 37.0 95-99 35.110499999999995 37.0 37.0 37.0 25.0 37.0 100-104 35.15169999999999 37.0 37.0 37.0 27.4 37.0 105-109 34.949799999999996 37.0 37.0 37.0 27.4 37.0 110-114 34.9998 37.0 37.0 37.0 27.4 37.0 115-119 34.997299999999996 37.0 37.0 37.0 25.0 37.0 120-124 34.7753 37.0 37.0 37.0 25.0 37.0 125-129 34.89490000000001 37.0 37.0 37.0 25.0 37.0 130-134 34.4411 37.0 37.0 37.0 25.0 37.0 135-139 34.3947 37.0 37.0 37.0 25.0 37.0 140-144 34.579899999999995 37.0 37.0 37.0 25.0 37.0 145-149 34.2854 37.0 37.0 37.0 25.0 37.0 150-151 33.74025 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 5.0 15 8.0 16 1.0 17 1.0 18 3.0 19 2.0 20 2.0 21 2.0 22 9.0 23 6.0 24 3.0 25 10.0 26 8.0 27 8.0 28 17.0 29 22.0 30 38.0 31 52.0 32 77.0 33 139.0 34 311.0 35 931.0 36 2274.0 37 66.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.975 15.024999999999999 11.05 30.95 2 29.525000000000002 21.325 29.599999999999998 19.55 3 23.474999999999998 23.95 27.175 25.4 4 28.999999999999996 31.35 18.875 20.775 5 28.475 32.0 18.8 20.724999999999998 6 23.0 34.699999999999996 19.875 22.425 7 21.05 15.9 38.2 24.85 8 23.9 19.55 24.65 31.900000000000002 9 25.05 22.175 25.275 27.500000000000004 10-14 27.084999999999997 25.11 22.52 25.285000000000004 15-19 26.545 25.224999999999998 22.965 25.264999999999997 20-24 26.150000000000002 25.619999999999997 23.369999999999997 24.86 25-29 26.590000000000003 24.985 23.305 25.119999999999997 30-34 26.575 24.75 23.515 25.16 35-39 26.090000000000003 25.195 23.335 25.380000000000003 40-44 26.43 25.564999999999998 23.24 24.765 45-49 26.625 25.319999999999997 23.64 24.415 50-54 26.5 25.495 23.525 24.48 55-59 26.669999999999998 24.44 23.715 25.174999999999997 60-64 26.979999999999997 25.724999999999998 23.375 23.919999999999998 65-69 26.834999999999997 25.0 23.555 24.610000000000003 70-74 26.424999999999997 24.945 24.3 24.33 75-79 26.834999999999997 24.72 24.13 24.315 80-84 27.12 25.119999999999997 23.405 24.355 85-89 26.93 25.21 23.735 24.125 90-94 26.669999999999998 25.16 23.745 24.425 95-99 27.255000000000003 24.865000000000002 23.965 23.915 100-104 27.07 25.7 23.52 23.71 105-109 27.089999999999996 24.52 23.905 24.485 110-114 27.29 25.185000000000002 24.115000000000002 23.41 115-119 26.955000000000002 25.509999999999998 23.47 24.065 120-124 27.029999999999998 24.995 24.205 23.77 125-129 27.025 24.58 24.11 24.285 130-134 26.795 25.974999999999998 23.080000000000002 24.15 135-139 27.965 25.09 23.415 23.53 140-144 26.825 24.990000000000002 24.474999999999998 23.71 145-149 27.310000000000002 24.505 24.23 23.955000000000002 150-151 27.487499999999997 25.587500000000002 23.724999999999998 23.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 3.0 30 6.0 31 6.5 32 9.5 33 13.0 34 15.0 35 20.0 36 31.0 37 42.5 38 61.5 39 75.5 40 90.5 41 135.0 42 151.5 43 148.0 44 161.5 45 185.5 46 212.0 47 193.0 48 161.0 49 161.5 50 152.0 51 149.0 52 139.0 53 120.5 54 122.5 55 109.5 56 102.0 57 108.5 58 97.5 59 84.5 60 77.5 61 74.5 62 79.0 63 80.0 64 70.5 65 59.0 66 61.5 67 72.5 68 69.0 69 55.5 70 42.5 71 34.0 72 30.5 73 25.0 74 21.5 75 20.0 76 14.5 77 5.5 78 5.0 79 4.5 80 1.5 81 2.0 82 2.5 83 1.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.35 #Duplication Level Percentage of deduplicated Percentage of total 1 92.66377910124525 85.575 2 6.551164049810504 12.1 3 0.7309149972929074 2.025 4 0.02707092582566324 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02707092582566324 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.3875000000000002 0.0 0.0 0.0 0.0 134-135 1.5875 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138-139 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661229 spots for SRR7814931.sra Written 2661229 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra Read 2661217 spots for SRR7814931.sra Written 2661217 spots for SRR7814931.sra SRR ids: ['SRR7814931.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7d3io67 SRR7814931.sra spots: 53224352 blocks: [[1, 2661217], [2661218, 5322434], [5322435, 7983651], [7983652, 10644868], [10644869, 13306085], [13306086, 15967302], [15967303, 18628519], [18628520, 21289736], [21289737, 23950953], [23950954, 26612170], [26612171, 29273387], [29273388, 31934604], [31934605, 34595821], [34595822, 37257038], [37257039, 39918255], [39918256, 42579472], [42579473, 45240689], [45240690, 47901906], [47901907, 50563123], [50563124, 53224352]] SRR7814931 file size 18014286 SRR7814931 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814931 SRR7814931_1.fastq SRR7814931_2.fastq Input file: SRR7814931_1.fastq Paired file: SRR7814931_2.fastq trimmed: SRR7814931-trimmed-pair1.fastq, SRR7814931-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:08:52 2024 >> started Sat Dec 7 02:23:42 2024 >> done (890.164s) 53224352 read pairs processed; of these: 124 ( 0.00%) short read pairs filtered out after trimming by size control 2467 ( 0.00%) empty read pairs filtered out after trimming by size control 53221761 (100.00%) read pairs available; of these: 1624647 ( 3.05%) trimmed read pairs available after processing 51597114 (96.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 16 0.00% 20 12 0.00% 21 30 0.00% 22 28 0.00% 23 23 0.00% 24 29 0.00% 25 41 0.00% 26 35 0.00% 27 30 0.00% 28 42 0.00% 29 27 0.00% 30 45 0.00% 31 56 0.00% 32 59 0.00% 33 62 0.00% 34 50 0.00% 35 85 0.00% 36 79 0.00% 37 76 0.00% 38 73 0.00% 39 78 0.00% 40 82 0.00% 41 82 0.00% 42 76 0.00% 43 91 0.00% 44 109 0.00% 45 108 0.00% 46 108 0.00% 47 109 0.00% 48 115 0.00% 49 115 0.00% 50 119 0.00% 51 120 0.00% 52 144 0.00% 53 141 0.00% 54 173 0.00% 55 180 0.00% 56 181 0.00% 57 193 0.00% 58 210 0.00% 59 209 0.00% 60 237 0.00% 61 253 0.00% 62 277 0.00% 63 267 0.00% 64 305 0.00% 65 328 0.00% 66 358 0.00% 67 378 0.00% 68 396 0.00% 69 454 0.00% 70 502 0.00% 71 563 0.00% 72 618 0.00% 73 696 0.00% 74 626 0.00% 75 776 0.00% 76 857 0.00% 77 901 0.00% 78 1047 0.00% 79 1119 0.00% 80 1186 0.00% 81 1340 0.00% 82 1545 0.00% 83 1641 0.00% 84 1866 0.00% 85 2078 0.00% 86 2191 0.00% 87 2542 0.00% 88 2677 0.01% 89 2888 0.01% 90 3238 0.01% 91 3568 0.01% 92 3921 0.01% 93 4316 0.01% 94 4736 0.01% 95 5058 0.01% 96 5410 0.01% 97 5862 0.01% 98 6208 0.01% 99 6713 0.01% 100 7316 0.01% 101 7844 0.01% 102 8480 0.02% 103 9098 0.02% 104 9658 0.02% 105 10560 0.02% 106 11032 0.02% 107 11203 0.02% 108 11985 0.02% 109 12706 0.02% 110 13284 0.02% 111 14115 0.03% 112 14979 0.03% 113 15914 0.03% 114 17297 0.03% 115 18151 0.03% 116 18505 0.03% 117 19134 0.04% 118 20222 0.04% 119 20520 0.04% 120 21613 0.04% 121 22591 0.04% 122 24034 0.05% 123 25143 0.05% 124 26611 0.05% 125 27414 0.05% 126 28880 0.05% 127 30105 0.06% 128 30174 0.06% 129 31798 0.06% 130 32496 0.06% 131 33564 0.06% 132 35321 0.07% 133 36397 0.07% 134 37980 0.07% 135 40205 0.08% 136 41941 0.08% 137 42599 0.08% 138 43726 0.08% 139 45557 0.09% 140 45948 0.09% 141 47617 0.09% 142 50101 0.09% 143 51058 0.10% 144 53505 0.10% 145 56681 0.11% 146 58035 0.11% 147 59370 0.11% 148 61047 0.11% 149 61777 0.12% 150 65754 0.12% 151 51597114 96.95% 53221761 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.46 fanout-score-rank=30 prefix-density=0.64 prefix-fanout=2.8 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=310.77 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=24.2 sequence=ATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAACGAAGTTGGTGGCAAAGGCCCACGCGTTGTTGTTGACGGGGTCGGCAAGGTGGTCAGCGAGGTTCTCAAGGGGACCCTTGCCGGTGACGATGGCCTGAACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGCCAAGCCAAGGGGGTCGAAGCTGCCGCCGGGGTAGAGAGGGTCGACGATCTCACCGAGCGGACCACCAGCAACACGGTACCCCTCGACGGCGCCCATGAGCACGACCTGGCAAGCCCAGATGGCGAGGATGCTCTGGGCATGGACGAGGCTCGGGTTGCCAAGGTAGTCGAGGCCGCCCTCGCTGAAGATCTGGGAGCCGGCCTTGAACCAGACGGC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=34 prefix-density=0.58 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=125.74 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=16.4 sequence=CCGCCGCCGCCA SRR7814931 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:27:26 Started mapping on | Dec 07 02:27:26 Finished on | Dec 07 02:36:52 Mapping speed, Million of reads per hour | 338.51 Number of input reads | 53221761 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 50716769 Uniquely mapped reads % | 95.29% Average mapped length | 299.96 Number of splices: Total | 54220524 Number of splices: Annotated (sjdb) | 51284467 Number of splices: GT/AG | 53540902 Number of splices: GC/AG | 616749 Number of splices: AT/AC | 25152 Number of splices: Non-canonical | 37721 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 543449 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 53481 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1961543 1961543 1961543 N_multimapping 543449 543449 543449 N_noFeature 1465726 49181703 1838751 N_ambiguous 1363490 8455 202421 UnstrandedReadsAssigned:47887553 PositiveStrandReadsAssigned:1526611 NegativeStrandReadsAssigned:48675597 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814931 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814931-trimmed-pair1.fastq SRR7814931-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 53,221,761 reads, 49,325,831 reads pseudoaligned [quant] estimated average fragment length: 307.791 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR7814931.ke.tsv 35125 SRR7814931.se.tsv 88098 total ==> SRR7814931.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 630.168 0 0 PNS24247 1044 737.209 242.173 8.68915 PNS24249 1928 1621.21 138.217 2.2551 PNS24246 1044 737.209 242.173 8.68915 PNS24248 1044 737.209 242.173 8.68915 PNS24244 1471 1164.21 572.264 13.0019 PNS24243 293 72.7529 0 0 KQK14069 1603 1296.21 19525.8 398.451 KQK14071 474 198.812 267.887 35.6412 ==> SRR7814931.se.tsv <== BRADI_1g14170v3 20697 BRADI_1g53295v3 518 BRADI_1g59795v3 1599 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 747 BRADI_1g74790v3 3246 BRADI_1g09890v3 0 BRADI_1g77505v3 723 BRADI_1g48960v3 0 SRR7814931 completed mapping pipeline successfully