Starting /dee2/code/volunteer_pipeline.sh SRR7814932 current disk space = 1548201828352 free memory = 1604537196 SRR7814932 SRAfilesize fe9f808622405df4e18184be6c01f962 SRR7814932.sra SRR7814932.sra file validated SRR7814932 is paired end SRR7814932 is conventional basespace SRR7814932 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814932_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.41775 37.0 37.0 37.0 37.0 37.0 2 36.3705 37.0 37.0 37.0 37.0 37.0 3 36.6455 37.0 37.0 37.0 37.0 37.0 4 36.624 37.0 37.0 37.0 37.0 37.0 5 36.6315 37.0 37.0 37.0 37.0 37.0 6 36.5935 37.0 37.0 37.0 37.0 37.0 7 36.4605 37.0 37.0 37.0 37.0 37.0 8 36.545 37.0 37.0 37.0 37.0 37.0 9 36.5815 37.0 37.0 37.0 37.0 37.0 10-14 36.627599999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.598400000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.570299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.493 37.0 37.0 37.0 37.0 37.0 30-34 36.5347 37.0 37.0 37.0 37.0 37.0 35-39 36.5146 37.0 37.0 37.0 37.0 37.0 40-44 36.51270000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4401 37.0 37.0 37.0 37.0 37.0 50-54 36.3558 37.0 37.0 37.0 37.0 37.0 55-59 36.352 37.0 37.0 37.0 37.0 37.0 60-64 36.278999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.2231 37.0 37.0 37.0 37.0 37.0 70-74 36.248900000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.2631 37.0 37.0 37.0 37.0 37.0 80-84 36.1789 37.0 37.0 37.0 37.0 37.0 85-89 36.1545 37.0 37.0 37.0 37.0 37.0 90-94 36.1226 37.0 37.0 37.0 37.0 37.0 95-99 36.0576 37.0 37.0 37.0 37.0 37.0 100-104 35.964 37.0 37.0 37.0 37.0 37.0 105-109 36.0126 37.0 37.0 37.0 37.0 37.0 110-114 35.938399999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.9604 37.0 37.0 37.0 37.0 37.0 120-124 35.7954 37.0 37.0 37.0 37.0 37.0 125-129 35.7488 37.0 37.0 37.0 37.0 37.0 130-134 35.6472 37.0 37.0 37.0 37.0 37.0 135-139 35.6128 37.0 37.0 37.0 37.0 37.0 140-144 35.543899999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.535900000000005 37.0 37.0 37.0 34.6 37.0 150-151 34.778999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 2.0 26 8.0 27 9.0 28 11.0 29 14.0 30 28.0 31 35.0 32 57.0 33 81.0 34 148.0 35 399.0 36 2958.0 37 247.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.53177593569455 11.655362974127105 9.21878924893243 35.59407184124591 2 22.675 16.425 35.625 25.275 3 22.425 22.425 22.975 32.175 4 27.775 29.975 18.2 24.05 5 26.275 31.0 22.1 20.625 6 22.1 32.2 22.475 23.225 7 18.65 19.2 40.8 21.349999999999998 8 22.125 19.25 28.125 30.5 9 22.475 19.375 29.925 28.225 10-14 23.73 25.264999999999997 24.4 26.605 15-19 24.57 24.65 24.375 26.405 20-24 24.205 24.245 24.8 26.75 25-29 24.435000000000002 24.349999999999998 24.255 26.96 30-34 24.925 23.955000000000002 24.525 26.595000000000002 35-39 24.525 24.16 24.345 26.97 40-44 24.560000000000002 24.035 24.11 27.295 45-49 24.93 23.835 24.29 26.945000000000004 50-54 25.124999999999996 24.295 23.880000000000003 26.700000000000003 55-59 25.180000000000003 23.705000000000002 23.830000000000002 27.284999999999997 60-64 24.610000000000003 24.099999999999998 23.74 27.55 65-69 24.55 23.69 24.25 27.51 70-74 25.019999999999996 24.355 23.674999999999997 26.950000000000003 75-79 25.835 23.68 23.635 26.85 80-84 24.985 23.51 23.919999999999998 27.584999999999997 85-89 24.895 23.785 23.615 27.705000000000002 90-94 25.395 23.815 23.685000000000002 27.105 95-99 25.485000000000003 23.724999999999998 23.715 27.075 100-104 26.005 23.635 23.474999999999998 26.884999999999998 105-109 25.145 22.975 24.0 27.88 110-114 25.575 23.395 24.15 26.88 115-119 25.595000000000002 23.27 23.78 27.355 120-124 26.090000000000003 23.1 24.065 26.745 125-129 25.615 23.435 23.919999999999998 27.029999999999998 130-134 25.374999999999996 23.685000000000002 23.244999999999997 27.694999999999997 135-139 25.665 23.5 24.01 26.825 140-144 26.3 23.215 23.575 26.91 145-149 25.77 23.32 23.87 27.04 150-151 26.924999999999997 22.2125 23.4125 27.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 2.0 27 2.5 28 4.5 29 3.0 30 1.0 31 4.0 32 13.0 33 17.5 34 17.0 35 21.5 36 35.0 37 56.5 38 68.0 39 75.0 40 94.5 41 112.0 42 125.5 43 130.5 44 153.5 45 181.0 46 166.5 47 160.5 48 170.5 49 173.5 50 161.5 51 126.5 52 116.5 53 122.5 54 129.0 55 123.0 56 107.0 57 95.5 58 90.5 59 95.5 60 87.5 61 84.5 62 93.5 63 92.5 64 77.0 65 75.5 66 74.5 67 73.0 68 71.0 69 66.5 70 56.0 71 40.5 72 39.0 73 33.0 74 26.5 75 18.0 76 11.5 77 9.0 78 4.0 79 1.5 80 0.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.375 #Duplication Level Percentage of deduplicated Percentage of total 1 90.29045643153528 81.6 2 8.824343015214385 15.950000000000001 3 0.8298755186721992 2.25 4 0.05532503457814661 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.8625 0.0 0.0 0.0 0.0 118-119 0.9125000000000001 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0625 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGA 10 0.006830828 145.0 145 CACACCC 10 0.006830828 145.0 3 ACACCCA 10 0.006830828 145.0 4 >>END_MODULE SRR7814932 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814932_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.434 37.0 37.0 37.0 37.0 37.0 2 36.2675 37.0 37.0 37.0 37.0 37.0 3 36.252 37.0 37.0 37.0 37.0 37.0 4 36.2815 37.0 37.0 37.0 37.0 37.0 5 36.35 37.0 37.0 37.0 37.0 37.0 6 36.204 37.0 37.0 37.0 37.0 37.0 7 36.2435 37.0 37.0 37.0 37.0 37.0 8 36.2735 37.0 37.0 37.0 37.0 37.0 9 36.2305 37.0 37.0 37.0 37.0 37.0 10-14 36.2393 37.0 37.0 37.0 37.0 37.0 15-19 36.25169999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.2025 37.0 37.0 37.0 37.0 37.0 25-29 36.1269 37.0 37.0 37.0 37.0 37.0 30-34 36.12499999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.03679999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.9995 37.0 37.0 37.0 37.0 37.0 45-49 35.977500000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.8797 37.0 37.0 37.0 37.0 37.0 55-59 35.717 37.0 37.0 37.0 37.0 37.0 60-64 35.6365 37.0 37.0 37.0 37.0 37.0 65-69 35.6652 37.0 37.0 37.0 37.0 37.0 70-74 35.5911 37.0 37.0 37.0 37.0 37.0 75-79 35.6316 37.0 37.0 37.0 37.0 37.0 80-84 35.3935 37.0 37.0 37.0 37.0 37.0 85-89 35.41609999999999 37.0 37.0 37.0 34.6 37.0 90-94 35.2722 37.0 37.0 37.0 32.2 37.0 95-99 34.89200000000001 37.0 37.0 37.0 25.0 37.0 100-104 35.0157 37.0 37.0 37.0 25.0 37.0 105-109 34.8052 37.0 37.0 37.0 25.0 37.0 110-114 34.8634 37.0 37.0 37.0 25.0 37.0 115-119 34.8867 37.0 37.0 37.0 25.0 37.0 120-124 34.582499999999996 37.0 37.0 37.0 25.0 37.0 125-129 34.643800000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.2684 37.0 37.0 37.0 25.0 37.0 135-139 34.1409 37.0 37.0 37.0 25.0 37.0 140-144 34.3051 37.0 37.0 37.0 25.0 37.0 145-149 34.0486 37.0 37.0 37.0 25.0 37.0 150-151 33.57325 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 5.0 15 5.0 16 5.0 17 4.0 18 4.0 19 2.0 20 1.0 21 6.0 22 8.0 23 3.0 24 9.0 25 9.0 26 13.0 27 15.0 28 10.0 29 19.0 30 38.0 31 51.0 32 76.0 33 186.0 34 382.0 35 923.0 36 2163.0 37 59.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.175000000000004 14.025000000000002 10.7 33.1 2 27.825 19.75 29.375 23.05 3 26.200000000000003 23.25 24.775 25.775 4 29.775000000000002 30.55 15.425 24.25 5 28.999999999999996 32.75 17.9 20.349999999999998 6 24.15 33.525 18.825 23.5 7 21.875 15.35 35.55 27.224999999999998 8 23.200000000000003 19.525000000000002 24.099999999999998 33.175 9 24.4 21.25 24.625 29.725 10-14 28.050000000000004 24.12 21.044999999999998 26.784999999999997 15-19 27.095000000000002 23.655 22.45 26.8 20-24 27.235 24.23 22.13 26.405 25-29 26.715 24.23 22.075 26.979999999999997 30-34 27.07 24.13 22.305 26.495 35-39 27.279999999999998 24.305 21.975 26.44 40-44 27.800000000000004 23.955000000000002 21.85 26.395000000000003 45-49 27.450000000000003 23.794999999999998 22.295 26.46 50-54 27.83 23.86 22.55 25.759999999999998 55-59 28.23 23.465 22.655 25.650000000000002 60-64 27.365000000000002 24.240000000000002 22.245 26.150000000000002 65-69 27.139999999999997 23.89 23.32 25.650000000000002 70-74 27.534999999999997 23.265 22.795 26.405 75-79 27.750000000000004 23.48 22.67 26.1 80-84 26.895000000000003 24.224999999999998 22.7 26.179999999999996 85-89 27.944999999999997 23.330000000000002 22.869999999999997 25.855 90-94 27.794999999999998 23.51 22.770000000000003 25.924999999999997 95-99 27.075 24.08 22.705000000000002 26.14 100-104 27.92 23.56 22.245 26.275 105-109 27.18 23.615 23.04 26.165 110-114 27.779999999999998 24.265 22.37 25.585 115-119 27.575 23.95 22.52 25.955000000000002 120-124 27.785 23.995 22.225 25.995 125-129 28.299999999999997 24.64 21.725 25.335 130-134 27.650000000000002 24.11 22.61 25.629999999999995 135-139 27.875 23.805 23.07 25.25 140-144 28.57 23.375 22.58 25.474999999999998 145-149 28.444999999999997 24.565 22.264999999999997 24.725 150-151 28.237499999999997 24.425 22.412499999999998 24.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 2.0 25 1.5 26 2.0 27 2.0 28 0.0 29 1.0 30 3.5 31 5.0 32 4.5 33 8.0 34 14.5 35 20.5 36 23.0 37 36.0 38 53.5 39 56.0 40 65.0 41 90.5 42 109.0 43 120.5 44 133.5 45 145.0 46 144.0 47 156.5 48 151.5 49 137.0 50 142.5 51 140.5 52 134.5 53 124.5 54 123.0 55 112.5 56 105.5 57 107.0 58 120.5 59 115.5 60 101.5 61 96.5 62 105.5 63 117.5 64 94.0 65 84.0 66 89.0 67 93.0 68 90.0 69 75.0 70 61.0 71 55.0 72 48.5 73 39.0 74 39.5 75 35.5 76 21.0 77 11.0 78 5.5 79 2.5 80 3.0 81 2.5 82 1.5 83 1.5 84 1.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.20532741398446 81.27499999999999 2 8.795782463928967 15.85 3 0.8324084350721421 2.25 4 0.13873473917869034 0.5 5 0.02774694783573807 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.5125 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.8374999999999999 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.875 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138-139 2.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACCTG 10 0.006830828 145.0 3 GCGAGAA 10 0.006830828 145.0 1 >>END_MODULE Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000758 spots for SRR7814932.sra Written 3000758 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra Read 3000750 spots for SRR7814932.sra Written 3000750 spots for SRR7814932.sra SRR ids: ['SRR7814932.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_sq1s0y53 SRR7814932.sra spots: 60015008 blocks: [[1, 3000750], [3000751, 6001500], [6001501, 9002250], [9002251, 12003000], [12003001, 15003750], [15003751, 18004500], [18004501, 21005250], [21005251, 24006000], [24006001, 27006750], [27006751, 30007500], [30007501, 33008250], [33008251, 36009000], [36009001, 39009750], [39009751, 42010500], [42010501, 45011250], [45011251, 48012000], [48012001, 51012750], [51012751, 54013500], [54013501, 57014250], [57014251, 60015008]] SRR7814932 file size 20315416 SRR7814932 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814932 SRR7814932_1.fastq SRR7814932_2.fastq Input file: SRR7814932_1.fastq Paired file: SRR7814932_2.fastq trimmed: SRR7814932-trimmed-pair1.fastq, SRR7814932-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:22:43 2024 >> started Sat Dec 7 02:31:58 2024 >> done (554.961s) 60015008 read pairs processed; of these: 138 ( 0.00%) short read pairs filtered out after trimming by size control 6650 ( 0.01%) empty read pairs filtered out after trimming by size control 60008220 (99.99%) read pairs available; of these: 2272048 ( 3.79%) trimmed read pairs available after processing 57736172 (96.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 17 0.00% 20 19 0.00% 21 34 0.00% 22 33 0.00% 23 30 0.00% 24 29 0.00% 25 33 0.00% 26 46 0.00% 27 51 0.00% 28 56 0.00% 29 55 0.00% 30 60 0.00% 31 62 0.00% 32 72 0.00% 33 60 0.00% 34 77 0.00% 35 88 0.00% 36 75 0.00% 37 92 0.00% 38 109 0.00% 39 108 0.00% 40 107 0.00% 41 83 0.00% 42 106 0.00% 43 113 0.00% 44 132 0.00% 45 126 0.00% 46 149 0.00% 47 118 0.00% 48 151 0.00% 49 147 0.00% 50 161 0.00% 51 159 0.00% 52 173 0.00% 53 208 0.00% 54 162 0.00% 55 200 0.00% 56 199 0.00% 57 228 0.00% 58 244 0.00% 59 270 0.00% 60 305 0.00% 61 330 0.00% 62 316 0.00% 63 337 0.00% 64 311 0.00% 65 370 0.00% 66 403 0.00% 67 453 0.00% 68 496 0.00% 69 533 0.00% 70 618 0.00% 71 675 0.00% 72 686 0.00% 73 866 0.00% 74 804 0.00% 75 939 0.00% 76 1061 0.00% 77 1138 0.00% 78 1318 0.00% 79 1489 0.00% 80 1550 0.00% 81 1826 0.00% 82 1939 0.00% 83 2262 0.00% 84 2350 0.00% 85 2655 0.00% 86 3014 0.01% 87 3185 0.01% 88 3547 0.01% 89 3852 0.01% 90 4339 0.01% 91 4916 0.01% 92 5355 0.01% 93 5822 0.01% 94 6431 0.01% 95 6928 0.01% 96 7423 0.01% 97 8011 0.01% 98 8622 0.01% 99 9018 0.02% 100 9932 0.02% 101 10631 0.02% 102 11306 0.02% 103 12166 0.02% 104 13264 0.02% 105 13956 0.02% 106 15130 0.03% 107 15810 0.03% 108 16563 0.03% 109 17173 0.03% 110 18668 0.03% 111 19296 0.03% 112 20875 0.03% 113 22013 0.04% 114 23114 0.04% 115 24910 0.04% 116 25589 0.04% 117 26533 0.04% 118 27820 0.05% 119 28787 0.05% 120 30626 0.05% 121 31389 0.05% 122 33134 0.06% 123 35046 0.06% 124 37163 0.06% 125 38345 0.06% 126 40700 0.07% 127 41506 0.07% 128 42566 0.07% 129 44481 0.07% 130 45943 0.08% 131 47936 0.08% 132 49796 0.08% 133 52075 0.09% 134 54056 0.09% 135 55775 0.09% 136 58166 0.10% 137 59576 0.10% 138 61771 0.10% 139 64829 0.11% 140 65742 0.11% 141 68013 0.11% 142 70831 0.12% 143 72326 0.12% 144 76400 0.13% 145 79114 0.13% 146 81215 0.14% 147 83402 0.14% 148 85889 0.14% 149 87080 0.15% 150 92666 0.15% 151 57736172 96.21% 60008220 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=26 prefix-density=0.72 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=29 fanout-score=12.83 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.35 fanout-score-rank=38 prefix-density=0.67 prefix-fanout=1.2 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=151.64 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=7.0 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814932 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:36:12 Started mapping on | Dec 07 02:36:12 Finished on | Dec 07 02:44:56 Mapping speed, Million of reads per hour | 412.27 Number of input reads | 60008220 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 55652740 Uniquely mapped reads % | 92.74% Average mapped length | 299.65 Number of splices: Total | 54156380 Number of splices: Annotated (sjdb) | 51434158 Number of splices: GT/AG | 53435414 Number of splices: GC/AG | 660037 Number of splices: AT/AC | 16337 Number of splices: Non-canonical | 44592 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 696588 % of reads mapped to multiple loci | 1.16% Number of reads mapped to too many loci | 77622 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.99% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3658892 3658892 3658892 N_multimapping 696588 696588 696588 N_noFeature 1487562 53838229 1982025 N_ambiguous 1536059 7155 218351 UnstrandedReadsAssigned:52629119 PositiveStrandReadsAssigned:1807356 NegativeStrandReadsAssigned:53452364 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814932 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814932-trimmed-pair1.fastq SRR7814932-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,008,220 reads, 54,024,505 reads pseudoaligned [quant] estimated average fragment length: 291.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52973 SRR7814932.ke.tsv 35125 SRR7814932.se.tsv 88098 total ==> SRR7814932.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 645.848 5.77329e-05 2.00489e-06 PNS24247 1044 753.391 126.183 3.75645 PNS24249 1928 1637.39 75.7288 1.0373 PNS24246 1044 753.391 126.183 3.75645 PNS24248 1044 753.391 126.183 3.75645 PNS24244 1471 1180.39 336.721 6.39795 PNS24243 293 76.0309 0 0 KQK14069 1603 1312.39 3479.59 59.465 KQK14071 474 207.393 20.2285 2.1876 ==> SRR7814932.se.tsv <== BRADI_1g14170v3 3559 BRADI_1g53295v3 277 BRADI_1g59795v3 1096 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 699 BRADI_1g74790v3 826 BRADI_1g09890v3 0 BRADI_1g77505v3 879 BRADI_1g48960v3 0 SRR7814932 completed mapping pipeline successfully