Starting /dee2/code/volunteer_pipeline.sh SRR7814933 current disk space = 1548198924288 free memory = 1604538728 SRR7814933 SRAfilesize 01ee2ae8bf95aea03c522b6ab42cb98e SRR7814933.sra SRR7814933.sra file validated SRR7814933 is paired end SRR7814933 is conventional basespace SRR7814933 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814933_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2555 37.0 37.0 37.0 37.0 37.0 2 36.3385 37.0 37.0 37.0 37.0 37.0 3 36.431 37.0 37.0 37.0 37.0 37.0 4 36.563 37.0 37.0 37.0 37.0 37.0 5 36.4965 37.0 37.0 37.0 37.0 37.0 6 36.4815 37.0 37.0 37.0 37.0 37.0 7 36.467 37.0 37.0 37.0 37.0 37.0 8 36.507 37.0 37.0 37.0 37.0 37.0 9 36.4465 37.0 37.0 37.0 37.0 37.0 10-14 36.5374 37.0 37.0 37.0 37.0 37.0 15-19 36.4692 37.0 37.0 37.0 37.0 37.0 20-24 36.4748 37.0 37.0 37.0 37.0 37.0 25-29 36.408300000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.420399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.445299999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3635 37.0 37.0 37.0 37.0 37.0 45-49 36.3333 37.0 37.0 37.0 37.0 37.0 50-54 36.3041 37.0 37.0 37.0 37.0 37.0 55-59 36.2906 37.0 37.0 37.0 37.0 37.0 60-64 36.215700000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.1786 37.0 37.0 37.0 37.0 37.0 70-74 36.152 37.0 37.0 37.0 37.0 37.0 75-79 36.127700000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.119299999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.03489999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.0344 37.0 37.0 37.0 37.0 37.0 95-99 35.9759 37.0 37.0 37.0 37.0 37.0 100-104 35.93820000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.9119 37.0 37.0 37.0 37.0 37.0 110-114 35.959399999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7923 37.0 37.0 37.0 37.0 37.0 120-124 35.69 37.0 37.0 37.0 37.0 37.0 125-129 35.6586 37.0 37.0 37.0 37.0 37.0 130-134 35.6118 37.0 37.0 37.0 37.0 37.0 135-139 35.618100000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.5059 37.0 37.0 37.0 37.0 37.0 145-149 35.393899999999995 37.0 37.0 37.0 34.6 37.0 150-151 34.79375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 3.0 24 3.0 25 4.0 26 3.0 27 5.0 28 13.0 29 19.0 30 27.0 31 52.0 32 71.0 33 81.0 34 182.0 35 428.0 36 2867.0 37 240.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.8421052631579 11.854636591478696 8.947368421052632 32.35588972431078 2 24.925 17.424999999999997 33.6 24.05 3 23.275000000000002 23.525 23.775 29.425 4 28.050000000000004 28.499999999999996 20.200000000000003 23.25 5 26.224999999999998 32.45 21.224999999999998 20.1 6 20.925 33.050000000000004 22.55 23.474999999999998 7 17.95 19.950000000000003 40.825 21.275 8 20.775 20.05 27.900000000000002 31.275 9 21.6 18.85 30.4 29.15 10-14 24.02 26.025 23.880000000000003 26.075 15-19 23.669999999999998 24.62 24.975 26.735 20-24 23.84 25.11 24.8 26.25 25-29 24.84 24.64 24.36 26.16 30-34 24.15 24.775 24.33 26.745 35-39 24.0 24.535 25.0 26.465 40-44 24.45 24.575 24.26 26.715 45-49 24.435000000000002 24.52 24.215 26.83 50-54 24.54 24.59 24.09 26.779999999999998 55-59 24.87 24.6 24.395 26.135 60-64 24.2 24.735 24.279999999999998 26.784999999999997 65-69 24.565 24.959999999999997 24.11 26.365 70-74 24.5 24.36 24.515 26.625 75-79 25.009999999999998 24.2 24.19 26.6 80-84 24.365000000000002 24.22 24.42 26.995 85-89 25.31 24.295 23.755000000000003 26.640000000000004 90-94 25.11 23.995 24.169999999999998 26.724999999999998 95-99 24.535 24.345 24.13 26.99 100-104 25.014999999999997 24.535 23.77 26.68 105-109 25.174999999999997 23.735 24.41 26.68 110-114 24.95 24.285 23.505000000000003 27.26 115-119 24.759999999999998 24.325 24.015 26.900000000000002 120-124 25.569999999999997 23.885 24.195 26.35 125-129 25.085 23.95 24.145 26.82 130-134 25.72 23.549999999999997 23.785 26.945000000000004 135-139 25.52 23.794999999999998 24.224999999999998 26.46 140-144 25.405 23.41 24.425 26.76 145-149 25.16 23.465 24.6 26.775 150-151 25.7 23.5375 23.4125 27.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.5 28 2.0 29 5.5 30 10.0 31 9.0 32 8.5 33 13.0 34 26.0 35 35.5 36 43.5 37 61.5 38 71.5 39 86.0 40 103.5 41 120.5 42 130.5 43 137.0 44 170.0 45 199.5 46 182.0 47 166.0 48 170.5 49 165.0 50 158.5 51 150.0 52 135.5 53 119.5 54 103.5 55 105.0 56 109.5 57 89.5 58 81.5 59 83.0 60 86.5 61 75.5 62 63.0 63 73.5 64 75.5 65 66.5 66 67.5 67 70.0 68 67.5 69 63.5 70 50.5 71 37.0 72 34.5 73 34.5 74 27.5 75 16.0 76 9.5 77 7.0 78 5.5 79 4.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.0946021146355 80.95 2 8.681135225375627 15.6 3 1.05731775180857 2.85 4 0.1669449081803005 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0499999999999998 0.0 0.0 0.0 0.0 124-125 1.1875 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.4375 0.0 0.0 0.0 0.0 134-135 1.475 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138-139 1.6375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTGCG 10 0.006830828 145.0 4 TCTGCGC 10 0.006830828 145.0 5 CTGCGCC 10 0.006830828 145.0 6 CTTCTGC 10 0.006830828 145.0 3 >>END_MODULE SRR7814933 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814933_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3455 37.0 37.0 37.0 37.0 37.0 2 36.0545 37.0 37.0 37.0 37.0 37.0 3 36.1055 37.0 37.0 37.0 37.0 37.0 4 36.231 37.0 37.0 37.0 37.0 37.0 5 36.2515 37.0 37.0 37.0 37.0 37.0 6 36.2035 37.0 37.0 37.0 37.0 37.0 7 36.0135 37.0 37.0 37.0 37.0 37.0 8 36.074 37.0 37.0 37.0 37.0 37.0 9 36.165 37.0 37.0 37.0 37.0 37.0 10-14 36.12570000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.0924 37.0 37.0 37.0 37.0 37.0 20-24 36.1041 37.0 37.0 37.0 37.0 37.0 25-29 35.96659999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.9605 37.0 37.0 37.0 37.0 37.0 35-39 35.9011 37.0 37.0 37.0 37.0 37.0 40-44 35.836000000000006 37.0 37.0 37.0 37.0 37.0 45-49 35.8173 37.0 37.0 37.0 37.0 37.0 50-54 35.641 37.0 37.0 37.0 37.0 37.0 55-59 35.59009999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.5436 37.0 37.0 37.0 37.0 37.0 65-69 35.5339 37.0 37.0 37.0 37.0 37.0 70-74 35.4769 37.0 37.0 37.0 37.0 37.0 75-79 35.4251 37.0 37.0 37.0 37.0 37.0 80-84 35.28830000000001 37.0 37.0 37.0 34.6 37.0 85-89 35.2968 37.0 37.0 37.0 34.6 37.0 90-94 35.1265 37.0 37.0 37.0 25.0 37.0 95-99 34.79 37.0 37.0 37.0 25.0 37.0 100-104 34.9218 37.0 37.0 37.0 25.0 37.0 105-109 34.6705 37.0 37.0 37.0 25.0 37.0 110-114 34.6599 37.0 37.0 37.0 25.0 37.0 115-119 34.67909999999999 37.0 37.0 37.0 25.0 37.0 120-124 34.4077 37.0 37.0 37.0 25.0 37.0 125-129 34.4582 37.0 37.0 37.0 25.0 37.0 130-134 33.977 37.0 37.0 37.0 25.0 37.0 135-139 33.9299 37.0 37.0 37.0 25.0 37.0 140-144 34.2337 37.0 37.0 37.0 25.0 37.0 145-149 33.9072 37.0 37.0 37.0 25.0 37.0 150-151 33.321 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 4.0 15 6.0 16 6.0 17 3.0 18 3.0 19 2.0 20 3.0 21 4.0 22 7.0 23 11.0 24 7.0 25 6.0 26 9.0 27 15.0 28 19.0 29 36.0 30 48.0 31 63.0 32 105.0 33 190.0 34 382.0 35 1029.0 36 1980.0 37 54.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.65 14.549999999999999 9.975000000000001 29.825000000000003 2 30.375000000000004 20.4 27.025 22.2 3 25.724999999999998 22.725 26.3 25.25 4 29.95 30.425 17.575 22.05 5 28.325 33.625 17.424999999999997 20.625 6 22.825 33.975 19.400000000000002 23.799999999999997 7 22.5 15.45 35.175 26.875 8 23.75 20.549999999999997 22.400000000000002 33.300000000000004 9 24.925 20.575 24.45 30.049999999999997 10-14 27.27 24.775 21.38 26.575 15-19 26.735 24.099999999999998 22.945 26.22 20-24 26.655 24.45 22.884999999999998 26.009999999999998 25-29 27.11 23.865 23.27 25.755 30-34 26.939999999999998 24.44 22.650000000000002 25.97 35-39 27.38 24.68 22.715 25.224999999999998 40-44 27.6 24.08 22.515 25.805 45-49 26.99 23.84 23.02 26.150000000000002 50-54 26.875 24.355 22.61 26.16 55-59 26.884999999999998 24.255 22.745 26.115 60-64 26.884999999999998 24.0 22.88 26.235000000000003 65-69 27.07 23.68 23.24 26.009999999999998 70-74 27.58 24.39 22.495 25.535000000000004 75-79 27.185 24.035 22.49 26.290000000000003 80-84 27.515 24.02 22.830000000000002 25.635 85-89 26.695 23.94 23.244999999999997 26.119999999999997 90-94 26.8 24.310000000000002 22.985 25.905 95-99 27.405 23.990000000000002 22.475 26.13 100-104 27.810000000000002 24.245 22.625 25.319999999999997 105-109 27.400000000000002 23.849999999999998 22.994999999999997 25.755 110-114 27.405 24.21 22.835 25.55 115-119 27.05 24.51 22.830000000000002 25.61 120-124 26.76 24.695 22.900000000000002 25.645 125-129 27.045 24.675 23.125 25.155 130-134 27.134999999999998 24.779999999999998 22.765 25.319999999999997 135-139 27.495000000000005 23.72 23.485 25.3 140-144 27.589999999999996 25.169999999999998 22.63 24.610000000000003 145-149 27.200000000000003 24.94 23.145 24.715 150-151 27.8125 24.474999999999998 22.5625 25.15 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 2.0 21 1.5 22 0.5 23 1.0 24 0.5 25 0.0 26 0.0 27 0.0 28 2.5 29 4.0 30 2.5 31 2.5 32 6.0 33 7.0 34 10.5 35 19.5 36 24.0 37 33.5 38 43.5 39 65.5 40 85.5 41 99.5 42 115.0 43 137.5 44 168.5 45 165.0 46 151.5 47 153.5 48 157.5 49 160.5 50 145.5 51 136.5 52 137.0 53 121.5 54 117.0 55 108.5 56 97.0 57 93.5 58 93.5 59 104.5 60 103.0 61 97.5 62 98.0 63 97.0 64 85.5 65 77.5 66 85.0 67 87.0 68 87.0 69 86.0 70 67.0 71 54.5 72 48.5 73 31.0 74 27.5 75 26.0 76 15.5 77 9.0 78 7.0 79 4.5 80 4.0 81 3.0 82 2.5 83 2.5 84 1.5 85 2.5 86 2.5 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 1.0 99 1.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.02235885969816 80.525 2 8.440469536053662 15.1 3 1.285634432643935 3.45 4 0.22358859698155395 0.8 5 0.027948574622694244 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCGACCGCGTGTTGTACCTCGGCCCGCTCTCCGGCGAACCCCCGAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2 0.0 0.0 0.0 0.0 128-129 1.2 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.3875 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138-139 1.5750000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTCTT 10 0.006830828 145.0 4 AGCTTTT 10 0.006830828 145.0 6 CACACAC 10 0.006830828 145.0 3 CACACAA 10 0.006830828 145.0 5 CACAAGC 10 0.006830828 145.0 7 AGGGTCT 10 0.006830828 145.0 3 AAGGGTC 10 0.006830828 145.0 2 TCTTGTG 10 0.006830828 145.0 7 GTCTTGT 10 0.006830828 145.0 6 AGATGCC 10 0.006830828 145.0 4 CTTGTGC 10 0.006830828 145.0 8 AGCACAC 10 0.006830828 145.0 1 CAAGGGT 10 0.006830828 145.0 1 TTGTGCC 10 0.006830828 145.0 9 GCACACA 10 0.006830828 145.0 2 ATCTGAG 10 0.006830828 145.0 145 >>END_MODULE Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580963 spots for SRR7814933.sra Written 2580963 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra Read 2580946 spots for SRR7814933.sra Written 2580946 spots for SRR7814933.sra SRR ids: ['SRR7814933.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y4vsn3rz SRR7814933.sra spots: 51618937 blocks: [[1, 2580946], [2580947, 5161892], [5161893, 7742838], [7742839, 10323784], [10323785, 12904730], [12904731, 15485676], [15485677, 18066622], [18066623, 20647568], [20647569, 23228514], [23228515, 25809460], [25809461, 28390406], [28390407, 30971352], [30971353, 33552298], [33552299, 36133244], [36133245, 38714190], [38714191, 41295136], [41295137, 43876082], [43876083, 46457028], [46457029, 49037974], [49037975, 51618937]] SRR7814933 file size 17470263 SRR7814933 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814933 SRR7814933_1.fastq SRR7814933_2.fastq Input file: SRR7814933_1.fastq Paired file: SRR7814933_2.fastq trimmed: SRR7814933-trimmed-pair1.fastq, SRR7814933-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 02:22:42 2024 >> started Sat Dec 7 02:34:31 2024 >> done (708.833s) 51618937 read pairs processed; of these: 172 ( 0.00%) short read pairs filtered out after trimming by size control 4771 ( 0.01%) empty read pairs filtered out after trimming by size control 51613994 (99.99%) read pairs available; of these: 1359391 ( 2.63%) trimmed read pairs available after processing 50254603 (97.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 21 0.00% 20 20 0.00% 21 26 0.00% 22 31 0.00% 23 34 0.00% 24 21 0.00% 25 26 0.00% 26 30 0.00% 27 45 0.00% 28 48 0.00% 29 43 0.00% 30 51 0.00% 31 58 0.00% 32 61 0.00% 33 48 0.00% 34 46 0.00% 35 68 0.00% 36 62 0.00% 37 66 0.00% 38 97 0.00% 39 77 0.00% 40 70 0.00% 41 57 0.00% 42 87 0.00% 43 86 0.00% 44 82 0.00% 45 97 0.00% 46 100 0.00% 47 84 0.00% 48 108 0.00% 49 123 0.00% 50 122 0.00% 51 139 0.00% 52 110 0.00% 53 129 0.00% 54 141 0.00% 55 172 0.00% 56 171 0.00% 57 168 0.00% 58 186 0.00% 59 173 0.00% 60 190 0.00% 61 237 0.00% 62 207 0.00% 63 248 0.00% 64 248 0.00% 65 260 0.00% 66 294 0.00% 67 334 0.00% 68 332 0.00% 69 343 0.00% 70 355 0.00% 71 413 0.00% 72 503 0.00% 73 548 0.00% 74 567 0.00% 75 607 0.00% 76 679 0.00% 77 815 0.00% 78 840 0.00% 79 963 0.00% 80 962 0.00% 81 1067 0.00% 82 1232 0.00% 83 1427 0.00% 84 1438 0.00% 85 1642 0.00% 86 1843 0.00% 87 1972 0.00% 88 2128 0.00% 89 2325 0.00% 90 2594 0.01% 91 2956 0.01% 92 3289 0.01% 93 3609 0.01% 94 3958 0.01% 95 4021 0.01% 96 4550 0.01% 97 4870 0.01% 98 4952 0.01% 99 5435 0.01% 100 5641 0.01% 101 6394 0.01% 102 6760 0.01% 103 7334 0.01% 104 7696 0.01% 105 8571 0.02% 106 8701 0.02% 107 9167 0.02% 108 9603 0.02% 109 10298 0.02% 110 10615 0.02% 111 11465 0.02% 112 12176 0.02% 113 12589 0.02% 114 13849 0.03% 115 14660 0.03% 116 15021 0.03% 117 15612 0.03% 118 16084 0.03% 119 17169 0.03% 120 17906 0.03% 121 18159 0.04% 122 19479 0.04% 123 21026 0.04% 124 22147 0.04% 125 22532 0.04% 126 24059 0.05% 127 25142 0.05% 128 24888 0.05% 129 25981 0.05% 130 26761 0.05% 131 27715 0.05% 132 29281 0.06% 133 30620 0.06% 134 31904 0.06% 135 33588 0.07% 136 35128 0.07% 137 35873 0.07% 138 36637 0.07% 139 38057 0.07% 140 39171 0.08% 141 40162 0.08% 142 42125 0.08% 143 43951 0.09% 144 46406 0.09% 145 48337 0.09% 146 50048 0.10% 147 51229 0.10% 148 52531 0.10% 149 53567 0.10% 150 56925 0.11% 151 50254603 97.37% 51613994 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=30 prefix-density=0.83 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=95.63 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=5.0 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=2.3 sequence=CACCGCCGGGCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=102.53 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.8 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814933 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:37:01 Started mapping on | Dec 07 02:37:01 Finished on | Dec 07 02:41:19 Mapping speed, Million of reads per hour | 720.20 Number of input reads | 51613994 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 48356613 Uniquely mapped reads % | 93.69% Average mapped length | 300.01 Number of splices: Total | 49155264 Number of splices: Annotated (sjdb) | 46549034 Number of splices: GT/AG | 48512578 Number of splices: GC/AG | 582720 Number of splices: AT/AC | 20588 Number of splices: Non-canonical | 39378 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 638519 % of reads mapped to multiple loci | 1.24% Number of reads mapped to too many loci | 57432 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2618862 2618862 2618862 N_multimapping 638519 638519 638519 N_noFeature 1462123 46907263 1787640 N_ambiguous 1327825 7729 203673 UnstrandedReadsAssigned:45566665 PositiveStrandReadsAssigned:1441621 NegativeStrandReadsAssigned:46365300 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814933 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814933-trimmed-pair1.fastq SRR7814933-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,613,994 reads, 47,016,658 reads pseudoaligned [quant] estimated average fragment length: 312.872 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 SRR7814933.ke.tsv 35125 SRR7814933.se.tsv 88098 total ==> SRR7814933.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 624.763 0 0 PNS24247 1044 732.128 192.259 7.06617 PNS24249 1928 1616.13 185.115 3.08212 PNS24246 1044 732.128 192.259 7.06617 PNS24248 1044 732.128 192.259 7.06617 PNS24244 1471 1159.13 406.108 9.42746 PNS24243 293 71.4181 0 0 KQK14069 1603 1291.13 5085.81 105.993 KQK14071 474 195.455 60.3569 8.30929 ==> SRR7814933.se.tsv <== BRADI_1g14170v3 5354 BRADI_1g53295v3 207 BRADI_1g59795v3 1627 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 551 BRADI_1g74790v3 528 BRADI_1g09890v3 0 BRADI_1g77505v3 678 BRADI_1g48960v3 3 SRR7814933 completed mapping pipeline successfully