Starting /dee2/code/volunteer_pipeline.sh SRR7814934 current disk space = 1548198924288 free memory = 1604539236 SRR7814934 SRAfilesize db8b228a92d4c181882a7dedf64ec9ac SRR7814934.sra SRR7814934.sra file validated SRR7814934 is paired end SRR7814934 is conventional basespace SRR7814934 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814934_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.142 37.0 37.0 37.0 37.0 37.0 2 36.298 37.0 37.0 37.0 37.0 37.0 3 36.4145 37.0 37.0 37.0 37.0 37.0 4 36.5845 37.0 37.0 37.0 37.0 37.0 5 36.531 37.0 37.0 37.0 37.0 37.0 6 36.5095 37.0 37.0 37.0 37.0 37.0 7 36.4295 37.0 37.0 37.0 37.0 37.0 8 36.496 37.0 37.0 37.0 37.0 37.0 9 36.5215 37.0 37.0 37.0 37.0 37.0 10-14 36.56699999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.514100000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5034 37.0 37.0 37.0 37.0 37.0 25-29 36.4562 37.0 37.0 37.0 37.0 37.0 30-34 36.486799999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.417899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.4098 37.0 37.0 37.0 37.0 37.0 45-49 36.3779 37.0 37.0 37.0 37.0 37.0 50-54 36.33630000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.28410000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.2119 37.0 37.0 37.0 37.0 37.0 65-69 36.1818 37.0 37.0 37.0 37.0 37.0 70-74 36.10770000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.172399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.191500000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.09259999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.0283 37.0 37.0 37.0 37.0 37.0 95-99 36.0697 37.0 37.0 37.0 37.0 37.0 100-104 35.9736 37.0 37.0 37.0 37.0 37.0 105-109 35.9884 37.0 37.0 37.0 37.0 37.0 110-114 35.9392 37.0 37.0 37.0 37.0 37.0 115-119 35.9182 37.0 37.0 37.0 37.0 37.0 120-124 35.772800000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6629 37.0 37.0 37.0 37.0 37.0 130-134 35.614700000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.6452 37.0 37.0 37.0 37.0 37.0 140-144 35.5904 37.0 37.0 37.0 37.0 37.0 145-149 35.49309999999999 37.0 37.0 37.0 37.0 37.0 150-151 34.731750000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 3.0 25 5.0 26 4.0 27 11.0 28 14.0 29 20.0 30 21.0 31 42.0 32 46.0 33 88.0 34 177.0 35 444.0 36 2895.0 37 228.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.40220661985958 12.512537612838514 9.578736208625878 35.50651955867603 2 24.6 18.525 34.125 22.75 3 22.15 23.724999999999998 24.099999999999998 30.025000000000002 4 27.725 30.325000000000003 19.175 22.775000000000002 5 24.5 33.225 21.775 20.5 6 21.45 31.95 23.1 23.5 7 16.3 19.725 42.925000000000004 21.05 8 21.425 20.3 27.625 30.65 9 21.5 20.925 29.5 28.075 10-14 23.919999999999998 26.040000000000003 25.025 25.014999999999997 15-19 22.994999999999997 25.395 25.369999999999997 26.240000000000002 20-24 23.119999999999997 25.6 25.230000000000004 26.05 25-29 23.26 25.509999999999998 25.135 26.095000000000002 30-34 23.294999999999998 25.52 24.895 26.290000000000003 35-39 23.285 25.0 25.040000000000003 26.674999999999997 40-44 23.91 25.040000000000003 24.474999999999998 26.575 45-49 23.724999999999998 24.825 25.019999999999996 26.43 50-54 23.82 24.77 24.95 26.46 55-59 24.205 24.545 24.6 26.650000000000002 60-64 24.135 24.64 24.709999999999997 26.515 65-69 23.599999999999998 24.94 24.915000000000003 26.545 70-74 23.674999999999997 24.775 25.3 26.25 75-79 24.21 24.495 24.6 26.695 80-84 24.015 24.279999999999998 24.955 26.75 85-89 24.67 24.63 24.535 26.165 90-94 24.46 24.02 25.06 26.46 95-99 24.12 24.315 25.165 26.400000000000002 100-104 24.365000000000002 24.75 24.4 26.484999999999996 105-109 24.34 23.925 25.230000000000004 26.505000000000003 110-114 23.895 24.18 25.61 26.314999999999998 115-119 24.560000000000002 23.95 24.715 26.775 120-124 24.735 24.825 23.810000000000002 26.63 125-129 24.91 23.915 25.055 26.119999999999997 130-134 24.490000000000002 24.04 24.779999999999998 26.69 135-139 25.080000000000002 24.08 24.87 25.97 140-144 24.845 23.845 24.905 26.405 145-149 25.080000000000002 24.285 23.849999999999998 26.784999999999997 150-151 25.0125 25.124999999999996 23.200000000000003 26.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 1.0 27 1.0 28 1.5 29 4.0 30 5.5 31 8.5 32 12.5 33 16.0 34 27.5 35 34.0 36 41.5 37 60.5 38 82.0 39 102.0 40 119.0 41 142.0 42 152.0 43 159.5 44 177.5 45 184.0 46 186.5 47 192.0 48 177.0 49 165.5 50 162.0 51 144.0 52 134.5 53 133.5 54 132.0 55 105.0 56 80.5 57 83.5 58 84.0 59 84.5 60 89.0 61 87.5 62 70.5 63 57.5 64 61.5 65 62.0 66 52.0 67 47.0 68 47.0 69 46.5 70 43.0 71 33.5 72 28.5 73 25.5 74 16.0 75 8.5 76 8.0 77 6.5 78 4.5 79 2.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.11742321282958 84.725 2 7.175863006251698 13.200000000000001 3 0.5708072845882034 1.575 4 0.1359064963305246 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.75 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 0.9625 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138-139 1.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGTCG 10 0.006830828 145.0 4 AAAATTT 10 0.006830828 145.0 9 >>END_MODULE SRR7814934 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814934_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4245 37.0 37.0 37.0 37.0 37.0 2 36.0685 37.0 37.0 37.0 37.0 37.0 3 36.091 37.0 37.0 37.0 37.0 37.0 4 36.16 37.0 37.0 37.0 37.0 37.0 5 36.1965 37.0 37.0 37.0 37.0 37.0 6 36.145 37.0 37.0 37.0 37.0 37.0 7 36.028 37.0 37.0 37.0 37.0 37.0 8 36.037 37.0 37.0 37.0 37.0 37.0 9 36.076 37.0 37.0 37.0 37.0 37.0 10-14 36.025 37.0 37.0 37.0 37.0 37.0 15-19 36.0089 37.0 37.0 37.0 37.0 37.0 20-24 35.9854 37.0 37.0 37.0 37.0 37.0 25-29 35.917500000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.924299999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.8721 37.0 37.0 37.0 37.0 37.0 40-44 35.767700000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.778800000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.6499 37.0 37.0 37.0 37.0 37.0 55-59 35.501099999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.5159 37.0 37.0 37.0 37.0 37.0 65-69 35.471199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.3995 37.0 37.0 37.0 37.0 37.0 75-79 35.37179999999999 37.0 37.0 37.0 34.6 37.0 80-84 35.211 37.0 37.0 37.0 29.8 37.0 85-89 35.1973 37.0 37.0 37.0 32.2 37.0 90-94 35.04749999999999 37.0 37.0 37.0 25.0 37.0 95-99 34.7545 37.0 37.0 37.0 25.0 37.0 100-104 34.7753 37.0 37.0 37.0 25.0 37.0 105-109 34.5721 37.0 37.0 37.0 25.0 37.0 110-114 34.6158 37.0 37.0 37.0 25.0 37.0 115-119 34.6124 37.0 37.0 37.0 25.0 37.0 120-124 34.2561 37.0 37.0 37.0 25.0 37.0 125-129 34.3741 37.0 37.0 37.0 25.0 37.0 130-134 33.8798 37.0 37.0 37.0 25.0 37.0 135-139 33.8986 37.0 37.0 37.0 25.0 37.0 140-144 34.1838 37.0 37.0 37.0 25.0 37.0 145-149 33.9009 37.0 37.0 37.0 25.0 37.0 150-151 33.41575 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 8.0 15 6.0 16 2.0 17 3.0 18 2.0 19 4.0 20 1.0 21 9.0 22 13.0 23 13.0 24 7.0 25 11.0 26 11.0 27 19.0 28 19.0 29 26.0 30 54.0 31 62.0 32 107.0 33 176.0 34 396.0 35 1090.0 36 1920.0 37 37.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.575 14.025000000000002 12.825000000000001 30.575000000000003 2 29.275000000000002 19.7 29.975 21.05 3 25.174999999999997 23.0 26.900000000000002 24.925 4 28.499999999999996 30.349999999999998 18.05 23.1 5 27.975 32.525 18.099999999999998 21.4 6 22.85 34.55 19.6 23.0 7 20.525 16.475 36.449999999999996 26.55 8 23.95 21.15 23.1 31.8 9 25.275 21.625 24.625 28.475 10-14 26.755000000000003 24.925 22.185 26.135 15-19 26.895000000000003 24.69 22.865 25.55 20-24 26.76 24.945 23.1 25.195 25-29 26.545 24.52 23.325000000000003 25.61 30-34 26.19 25.465 22.634999999999998 25.71 35-39 26.384999999999998 25.195 23.165 25.255 40-44 26.355 24.685000000000002 22.775000000000002 26.185000000000002 45-49 26.745 25.695 22.470000000000002 25.09 50-54 26.805 25.14 22.900000000000002 25.155 55-59 26.87 24.295 22.695 26.14 60-64 26.855 24.255 23.06 25.83 65-69 26.715 24.695 22.93 25.66 70-74 26.39 24.5 23.465 25.645 75-79 26.825 25.355 23.119999999999997 24.7 80-84 27.485 24.735 22.89 24.89 85-89 27.169999999999998 24.485 22.88 25.465 90-94 27.215 25.669999999999998 22.425 24.69 95-99 26.88 25.055 23.105 24.959999999999997 100-104 27.495000000000005 25.490000000000002 22.27 24.745 105-109 27.744999999999997 24.445 23.395 24.415 110-114 27.61 25.009999999999998 23.105 24.275 115-119 26.83 25.124999999999996 23.005 25.040000000000003 120-124 27.189999999999998 24.795 23.285 24.73 125-129 26.735 25.355 23.07 24.84 130-134 26.695 25.174999999999997 23.48 24.65 135-139 27.485 25.89 22.82 23.805 140-144 27.72 25.285000000000004 22.895 24.099999999999998 145-149 26.834999999999997 25.419999999999998 22.955000000000002 24.79 150-151 27.5875 26.987499999999997 23.0125 22.412499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.5 19 2.5 20 1.5 21 0.5 22 1.5 23 2.5 24 1.0 25 1.0 26 1.5 27 2.5 28 3.5 29 3.0 30 4.5 31 7.5 32 11.0 33 14.5 34 21.5 35 28.0 36 34.5 37 44.0 38 56.5 39 78.0 40 95.0 41 111.5 42 122.0 43 128.5 44 143.5 45 154.0 46 163.0 47 159.0 48 162.0 49 173.5 50 147.5 51 135.5 52 142.5 53 129.0 54 116.5 55 106.0 56 101.0 57 99.5 58 94.5 59 96.5 60 90.0 61 85.5 62 96.5 63 90.5 64 84.0 65 89.0 66 75.5 67 63.0 68 67.5 69 69.0 70 60.5 71 48.5 72 42.0 73 36.5 74 29.0 75 23.5 76 17.5 77 8.5 78 3.0 79 2.0 80 2.0 81 1.0 82 0.5 83 1.0 84 1.5 85 0.5 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 92.39782016348774 84.775 2 6.730245231607629 12.35 3 0.5994550408719346 1.6500000000000001 4 0.16348773841961853 0.6 5 0.027247956403269755 0.125 6 0.05449591280653951 0.3 7 0.0 0.0 8 0.027247956403269755 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 8 0.2 No Hit CACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTTAA 6 0.15 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 6 0.15 No Hit GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.1375 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.5125 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.7749999999999999 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.1875 0.0 0.0 0.0 0.0 138-139 1.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCGCCT 10 0.006830828 145.0 9 >>END_MODULE Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035185 spots for SRR7814934.sra Written 2035185 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra Read 2035171 spots for SRR7814934.sra Written 2035171 spots for SRR7814934.sra SRR ids: ['SRR7814934.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qj4g94mq SRR7814934.sra spots: 40703434 blocks: [[1, 2035171], [2035172, 4070342], [4070343, 6105513], [6105514, 8140684], [8140685, 10175855], [10175856, 12211026], [12211027, 14246197], [14246198, 16281368], [16281369, 18316539], [18316540, 20351710], [20351711, 22386881], [22386882, 24422052], [24422053, 26457223], [26457224, 28492394], [28492395, 30527565], [30527566, 32562736], [32562737, 34597907], [34597908, 36633078], [36633079, 38668249], [38668250, 40703434]] SRR7814934 file size 13771357 SRR7814934 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814934 SRR7814934_1.fastq SRR7814934_2.fastq Input file: SRR7814934_1.fastq Paired file: SRR7814934_2.fastq trimmed: SRR7814934-trimmed-pair1.fastq, SRR7814934-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:06:46 2024 >> started Sat Dec 7 01:08:09 2024 >> done (83.110s) 40703434 read pairs processed; of these: 100 ( 0.00%) short read pairs filtered out after trimming by size control 5539 ( 0.01%) empty read pairs filtered out after trimming by size control 40697795 (99.99%) read pairs available; of these: 1151745 ( 2.83%) trimmed read pairs available after processing 39546050 (97.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 14 0.00% 20 17 0.00% 21 26 0.00% 22 23 0.00% 23 28 0.00% 24 26 0.00% 25 39 0.00% 26 35 0.00% 27 44 0.00% 28 35 0.00% 29 55 0.00% 30 55 0.00% 31 61 0.00% 32 74 0.00% 33 37 0.00% 34 57 0.00% 35 70 0.00% 36 64 0.00% 37 85 0.00% 38 94 0.00% 39 85 0.00% 40 64 0.00% 41 63 0.00% 42 87 0.00% 43 95 0.00% 44 81 0.00% 45 100 0.00% 46 100 0.00% 47 100 0.00% 48 94 0.00% 49 97 0.00% 50 114 0.00% 51 115 0.00% 52 110 0.00% 53 130 0.00% 54 120 0.00% 55 160 0.00% 56 148 0.00% 57 163 0.00% 58 160 0.00% 59 183 0.00% 60 186 0.00% 61 191 0.00% 62 207 0.00% 63 203 0.00% 64 213 0.00% 65 265 0.00% 66 293 0.00% 67 277 0.00% 68 295 0.00% 69 330 0.00% 70 368 0.00% 71 369 0.00% 72 416 0.00% 73 497 0.00% 74 527 0.00% 75 538 0.00% 76 588 0.00% 77 641 0.00% 78 712 0.00% 79 845 0.00% 80 856 0.00% 81 975 0.00% 82 1137 0.00% 83 1214 0.00% 84 1291 0.00% 85 1445 0.00% 86 1598 0.00% 87 1612 0.00% 88 1834 0.00% 89 1994 0.00% 90 2124 0.01% 91 2412 0.01% 92 2811 0.01% 93 3099 0.01% 94 3255 0.01% 95 3430 0.01% 96 3641 0.01% 97 3976 0.01% 98 4445 0.01% 99 4615 0.01% 100 4938 0.01% 101 5309 0.01% 102 5744 0.01% 103 6199 0.02% 104 6672 0.02% 105 7222 0.02% 106 7417 0.02% 107 7898 0.02% 108 8082 0.02% 109 8608 0.02% 110 9128 0.02% 111 9835 0.02% 112 10453 0.03% 113 11049 0.03% 114 11821 0.03% 115 12241 0.03% 116 12766 0.03% 117 13223 0.03% 118 13774 0.03% 119 14632 0.04% 120 15112 0.04% 121 15768 0.04% 122 16788 0.04% 123 17833 0.04% 124 18495 0.05% 125 19608 0.05% 126 20260 0.05% 127 20855 0.05% 128 21361 0.05% 129 22203 0.05% 130 22640 0.06% 131 23872 0.06% 132 25106 0.06% 133 26158 0.06% 134 27076 0.07% 135 28502 0.07% 136 29467 0.07% 137 29952 0.07% 138 31440 0.08% 139 32487 0.08% 140 33314 0.08% 141 34386 0.08% 142 36206 0.09% 143 36679 0.09% 144 38840 0.10% 145 40847 0.10% 146 42315 0.10% 147 43029 0.11% 148 43962 0.11% 149 44553 0.11% 150 46570 0.11% 151 39546050 97.17% 40697795 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=25 prefix-density=1.07 prefix-fanout=3.1 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.20 sequence-density-rank=5 fanout-score=25.60 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=7.4 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=30 prefix-density=0.63 prefix-fanout=2.4 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=87.72 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=14.7 sequence=GCCGCCGCCGCCA SRR7814934 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:12:43 Started mapping on | Dec 07 01:12:44 Finished on | Dec 07 01:19:28 Mapping speed, Million of reads per hour | 362.65 Number of input reads | 40697795 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 37983529 Uniquely mapped reads % | 93.33% Average mapped length | 299.92 Number of splices: Total | 41575507 Number of splices: Annotated (sjdb) | 39172624 Number of splices: GT/AG | 41030622 Number of splices: GC/AG | 495022 Number of splices: AT/AC | 18318 Number of splices: Non-canonical | 31545 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410881 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 38981 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.85% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2303385 2303385 2303385 N_multimapping 410881 410881 410881 N_noFeature 1170028 36759973 1473067 N_ambiguous 1086821 6716 167217 UnstrandedReadsAssigned:35726680 PositiveStrandReadsAssigned:1216840 NegativeStrandReadsAssigned:36343245 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814934 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814934-trimmed-pair1.fastq SRR7814934-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,697,795 reads, 36,855,642 reads pseudoaligned [quant] estimated average fragment length: 317.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,225 rounds 52973 SRR7814934.ke.tsv 35125 SRR7814934.se.tsv 88098 total ==> SRR7814934.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 620.812 0 0 PNS24247 1044 727.77 161.028 7.43504 PNS24249 1928 1611.77 115.051 2.39862 PNS24246 1044 727.77 161.028 7.43504 PNS24248 1044 727.77 161.028 7.43504 PNS24244 1471 1154.77 293.864 8.55117 PNS24243 293 72.5569 0 0 KQK14069 1603 1286.77 6939.21 181.211 KQK14071 474 195.081 70.9631 12.2234 ==> SRR7814934.se.tsv <== BRADI_1g14170v3 7260 BRADI_1g53295v3 990 BRADI_1g59795v3 1478 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 742 BRADI_1g74790v3 817 BRADI_1g09890v3 1 BRADI_1g77505v3 535 BRADI_1g48960v3 0 SRR7814934 completed mapping pipeline successfully