Starting /dee2/code/volunteer_pipeline.sh SRR7814935 current disk space = 1548197212160 free memory = 1604534484 SRR7814935 SRAfilesize d85d62e8c0d107cb65bf414d5a730062 SRR7814935.sra SRR7814935.sra file validated SRR7814935 is paired end SRR7814935 is conventional basespace SRR7814935 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814935_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.28575 37.0 37.0 37.0 37.0 37.0 2 36.2945 37.0 37.0 37.0 37.0 37.0 3 36.4145 37.0 37.0 37.0 37.0 37.0 4 36.475 37.0 37.0 37.0 37.0 37.0 5 36.498 37.0 37.0 37.0 37.0 37.0 6 36.527 37.0 37.0 37.0 37.0 37.0 7 36.404 37.0 37.0 37.0 37.0 37.0 8 36.55 37.0 37.0 37.0 37.0 37.0 9 36.484 37.0 37.0 37.0 37.0 37.0 10-14 36.4922 37.0 37.0 37.0 37.0 37.0 15-19 36.4764 37.0 37.0 37.0 37.0 37.0 20-24 36.4791 37.0 37.0 37.0 37.0 37.0 25-29 36.4265 37.0 37.0 37.0 37.0 37.0 30-34 36.4378 37.0 37.0 37.0 37.0 37.0 35-39 36.3925 37.0 37.0 37.0 37.0 37.0 40-44 36.3667 37.0 37.0 37.0 37.0 37.0 45-49 36.3039 37.0 37.0 37.0 37.0 37.0 50-54 36.2523 37.0 37.0 37.0 37.0 37.0 55-59 36.229299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2047 37.0 37.0 37.0 37.0 37.0 65-69 36.1745 37.0 37.0 37.0 37.0 37.0 70-74 36.1481 37.0 37.0 37.0 37.0 37.0 75-79 36.1777 37.0 37.0 37.0 37.0 37.0 80-84 36.0587 37.0 37.0 37.0 37.0 37.0 85-89 36.028800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9624 37.0 37.0 37.0 37.0 37.0 95-99 35.9336 37.0 37.0 37.0 37.0 37.0 100-104 35.9058 37.0 37.0 37.0 37.0 37.0 105-109 35.9034 37.0 37.0 37.0 37.0 37.0 110-114 35.8503 37.0 37.0 37.0 37.0 37.0 115-119 35.8405 37.0 37.0 37.0 37.0 37.0 120-124 35.7221 37.0 37.0 37.0 37.0 37.0 125-129 35.586400000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.4813 37.0 37.0 37.0 37.0 37.0 135-139 35.5161 37.0 37.0 37.0 37.0 37.0 140-144 35.512600000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.3589 37.0 37.0 37.0 34.6 37.0 150-151 34.5925 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 1.0 23 0.0 24 5.0 25 4.0 26 8.0 27 10.0 28 16.0 29 21.0 30 39.0 31 37.0 32 59.0 33 99.0 34 168.0 35 423.0 36 2851.0 37 256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.7940365823102 11.250313204710599 10.047607116011024 36.90804309696818 2 24.025 17.8 33.15 25.025 3 21.725 22.825 23.425 32.025 4 29.025000000000002 29.075 19.175 22.725 5 25.650000000000002 30.5 22.925 20.925 6 20.775 33.45 22.900000000000002 22.875 7 17.7 19.225 41.575 21.5 8 21.0 19.375 27.800000000000004 31.825 9 22.775000000000002 18.55 31.525 27.150000000000002 10-14 24.745 24.175 24.63 26.450000000000003 15-19 23.895 24.7 24.66 26.745 20-24 23.865 24.625 25.115 26.395000000000003 25-29 24.69 24.195 24.834999999999997 26.279999999999998 30-34 24.52 24.425 24.834999999999997 26.22 35-39 24.335 24.205 25.130000000000003 26.33 40-44 24.09 24.145 24.545 27.22 45-49 24.490000000000002 24.015 24.63 26.865 50-54 24.605 24.165 24.8 26.43 55-59 24.285 24.295 24.45 26.97 60-64 24.395 24.325 24.41 26.87 65-69 24.995 24.154999999999998 24.395 26.455000000000002 70-74 24.92 24.169999999999998 24.285 26.625 75-79 25.31 23.64 24.79 26.26 80-84 24.335 24.02 24.47 27.175 85-89 24.725 23.880000000000003 25.025 26.369999999999997 90-94 25.650000000000002 24.165 23.935000000000002 26.25 95-99 24.884999999999998 23.625 24.215 27.275 100-104 25.729999999999997 23.775 23.674999999999997 26.82 105-109 25.635 23.830000000000002 24.525 26.009999999999998 110-114 25.130000000000003 23.43 24.43 27.01 115-119 25.53 23.655 24.03 26.784999999999997 120-124 25.545 24.64 23.465 26.35 125-129 25.305 23.380000000000003 24.27 27.045 130-134 25.655 23.549999999999997 24.325 26.47 135-139 25.365 23.635 23.995 27.005000000000003 140-144 25.735000000000003 23.325000000000003 24.04 26.900000000000002 145-149 25.259999999999998 24.22 23.24 27.279999999999998 150-151 26.075 23.849999999999998 23.025000000000002 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 3.0 29 5.0 30 8.0 31 10.0 32 10.5 33 12.5 34 17.5 35 25.0 36 39.0 37 55.0 38 77.0 39 88.5 40 100.0 41 135.5 42 143.5 43 148.5 44 164.5 45 171.0 46 177.0 47 168.5 48 147.0 49 137.0 50 146.5 51 148.0 52 130.0 53 116.5 54 118.5 55 125.0 56 122.0 57 98.5 58 90.5 59 93.0 60 90.5 61 95.5 62 89.5 63 76.5 64 79.5 65 80.5 66 66.0 67 63.5 68 55.0 69 43.0 70 42.0 71 35.5 72 26.0 73 20.0 74 22.0 75 19.0 76 14.0 77 14.0 78 10.5 79 4.5 80 2.0 81 1.0 82 3.0 83 3.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.0344827586207 82.5 2 7.751724137931035 14.05 3 1.103448275862069 3.0 4 0.05517241379310345 0.2 5 0.05517241379310345 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCACAGCCGCGGCCCCTGCCTCGGCGCCGCCGGCACCACCGCTACCAC 5 0.125 No Hit GCATCATCCCCGTGCAGCATAACGACGACGTCAAGCATGCTCGGCCGGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.525 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.8125 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.2999999999999998 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.5375 0.0 0.0 0.0 0.0 136-137 1.6875 0.0 0.0 0.0 0.0 138-139 1.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGATCTT 10 0.006830828 145.0 3 >>END_MODULE SRR7814935 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814935_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4855 37.0 37.0 37.0 37.0 37.0 2 36.2755 37.0 37.0 37.0 37.0 37.0 3 36.1475 37.0 37.0 37.0 37.0 37.0 4 36.326 37.0 37.0 37.0 37.0 37.0 5 36.33 37.0 37.0 37.0 37.0 37.0 6 36.267 37.0 37.0 37.0 37.0 37.0 7 36.1735 37.0 37.0 37.0 37.0 37.0 8 36.1985 37.0 37.0 37.0 37.0 37.0 9 36.162 37.0 37.0 37.0 37.0 37.0 10-14 36.2364 37.0 37.0 37.0 37.0 37.0 15-19 36.161 37.0 37.0 37.0 37.0 37.0 20-24 36.1954 37.0 37.0 37.0 37.0 37.0 25-29 36.132999999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.060199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.018299999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.943 37.0 37.0 37.0 37.0 37.0 45-49 35.8555 37.0 37.0 37.0 37.0 37.0 50-54 35.753 37.0 37.0 37.0 37.0 37.0 55-59 35.67659999999999 37.0 37.0 37.0 37.0 37.0 60-64 35.6574 37.0 37.0 37.0 37.0 37.0 65-69 35.6471 37.0 37.0 37.0 37.0 37.0 70-74 35.599900000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.5399 37.0 37.0 37.0 37.0 37.0 80-84 35.382600000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.4053 37.0 37.0 37.0 34.6 37.0 90-94 35.24929999999999 37.0 37.0 37.0 32.2 37.0 95-99 34.9544 37.0 37.0 37.0 25.0 37.0 100-104 35.028800000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.798 37.0 37.0 37.0 25.0 37.0 110-114 34.8609 37.0 37.0 37.0 25.0 37.0 115-119 34.8951 37.0 37.0 37.0 25.0 37.0 120-124 34.544399999999996 37.0 37.0 37.0 25.0 37.0 125-129 34.613600000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.28489999999999 37.0 37.0 37.0 25.0 37.0 135-139 34.0421 37.0 37.0 37.0 25.0 37.0 140-144 34.3233 37.0 37.0 37.0 25.0 37.0 145-149 34.1228 37.0 37.0 37.0 25.0 37.0 150-151 33.452 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 4.0 16 3.0 17 3.0 18 3.0 19 3.0 20 5.0 21 8.0 22 5.0 23 7.0 24 8.0 25 4.0 26 20.0 27 13.0 28 26.0 29 30.0 30 34.0 31 61.0 32 86.0 33 185.0 34 337.0 35 960.0 36 2122.0 37 68.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.925 13.55 11.675 33.85 2 28.65 21.775 28.249999999999996 21.325 3 26.474999999999998 23.200000000000003 25.05 25.275 4 29.125 30.075000000000003 16.2 24.6 5 28.175 31.225 18.6 22.0 6 24.375 33.5 18.575 23.549999999999997 7 22.95 16.75 34.725 25.575 8 24.15 20.95 22.525000000000002 32.375 9 26.224999999999998 19.75 24.175 29.849999999999998 10-14 26.345000000000002 24.279999999999998 22.0 27.375 15-19 26.450000000000003 23.91 23.015 26.625 20-24 26.700000000000003 24.38 22.505 26.415 25-29 26.284999999999997 24.224999999999998 22.335 27.155 30-34 26.99 24.285 22.45 26.275 35-39 26.91 24.4 22.1 26.590000000000003 40-44 27.55 24.025 22.375 26.05 45-49 27.355 24.63 22.345000000000002 25.669999999999998 50-54 26.700000000000003 24.455 22.575 26.27 55-59 26.995 23.974999999999998 22.34 26.69 60-64 27.055 23.985 22.475 26.484999999999996 65-69 27.35 23.830000000000002 22.665 26.155 70-74 27.43 23.625 22.73 26.215 75-79 27.015 24.335 22.49 26.16 80-84 27.55 23.61 22.415 26.424999999999997 85-89 27.54 24.279999999999998 22.34 25.840000000000003 90-94 26.915 24.099999999999998 22.89 26.095000000000002 95-99 26.8 24.755 22.720000000000002 25.724999999999998 100-104 27.455000000000002 23.974999999999998 22.45 26.119999999999997 105-109 27.195000000000004 24.325 23.18 25.3 110-114 26.924999999999997 24.54 22.435 26.1 115-119 27.834999999999997 24.615000000000002 22.075 25.474999999999998 120-124 27.334999999999997 24.865000000000002 22.2 25.6 125-129 27.985 24.485 21.82 25.71 130-134 27.73 24.66 22.375 25.235000000000003 135-139 27.61 24.685000000000002 22.8 24.905 140-144 27.74 24.68 22.545 25.035 145-149 27.465 24.575 22.8 25.16 150-151 27.875 23.674999999999997 23.9375 24.5125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 1.5 24 0.5 25 1.5 26 1.5 27 1.5 28 1.5 29 2.0 30 3.0 31 3.5 32 5.5 33 9.0 34 13.5 35 18.0 36 27.5 37 43.0 38 49.0 39 60.5 40 83.5 41 101.5 42 109.5 43 132.0 44 143.0 45 138.0 46 143.0 47 145.0 48 159.5 49 149.0 50 131.0 51 130.5 52 123.0 53 133.5 54 135.0 55 109.5 56 101.0 57 106.5 58 110.0 59 118.0 60 114.5 61 100.0 62 92.5 63 98.0 64 97.5 65 88.5 66 83.5 67 82.0 68 82.0 69 76.0 70 68.5 71 59.0 72 46.0 73 35.0 74 29.5 75 29.5 76 24.5 77 11.0 78 6.5 79 8.0 80 4.5 81 1.0 82 0.5 83 2.5 84 2.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.0 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.62995594713657 83.2 2 7.10352422907489 12.9 3 1.0187224669603523 2.775 4 0.08259911894273128 0.3 5 0.11013215859030838 0.5 6 0.027533039647577095 0.15 7 0.027533039647577095 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTC 6 0.15 No Hit CGGAAGGAAGTGAGATGCTGCTGCGGAGCGCGTCCTCGCCGCTGCTCAAC 5 0.125 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 5 0.125 No Hit GGGAAGGAAAAGCACAGACTTCTTTGAGTCAGCGGTCGACGAATCCAGCA 5 0.125 No Hit GTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.44999999999999996 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.7124999999999999 0.0 0.0 0.0 0.0 124-125 0.775 0.0 0.0 0.0 0.0 126-127 0.8999999999999999 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.3125 0.0 0.0 0.0 0.0 134-135 1.3875 0.0 0.0 0.0 0.0 136-137 1.525 0.0 0.0 0.0 0.0 138-139 1.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGGCG 10 0.006830828 145.0 9 >>END_MODULE Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024374 spots for SRR7814935.sra Written 2024374 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra Read 2024372 spots for SRR7814935.sra Written 2024372 spots for SRR7814935.sra SRR ids: ['SRR7814935.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p8ux4_37 SRR7814935.sra spots: 40487442 blocks: [[1, 2024372], [2024373, 4048744], [4048745, 6073116], [6073117, 8097488], [8097489, 10121860], [10121861, 12146232], [12146233, 14170604], [14170605, 16194976], [16194977, 18219348], [18219349, 20243720], [20243721, 22268092], [22268093, 24292464], [24292465, 26316836], [26316837, 28341208], [28341209, 30365580], [30365581, 32389952], [32389953, 34414324], [34414325, 36438696], [36438697, 38463068], [38463069, 40487442]] SRR7814935 file size 13698165 SRR7814935 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814935 SRR7814935_1.fastq SRR7814935_2.fastq Input file: SRR7814935_1.fastq Paired file: SRR7814935_2.fastq trimmed: SRR7814935-trimmed-pair1.fastq, SRR7814935-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:08:55 2024 >> started Sat Dec 7 01:10:33 2024 >> done (97.976s) 40487442 read pairs processed; of these: 115 ( 0.00%) short read pairs filtered out after trimming by size control 3282 ( 0.01%) empty read pairs filtered out after trimming by size control 40484045 (99.99%) read pairs available; of these: 1236300 ( 3.05%) trimmed read pairs available after processing 39247745 (96.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 20 0.00% 20 9 0.00% 21 15 0.00% 22 24 0.00% 23 25 0.00% 24 23 0.00% 25 28 0.00% 26 29 0.00% 27 37 0.00% 28 29 0.00% 29 31 0.00% 30 38 0.00% 31 55 0.00% 32 48 0.00% 33 40 0.00% 34 40 0.00% 35 54 0.00% 36 36 0.00% 37 46 0.00% 38 51 0.00% 39 56 0.00% 40 56 0.00% 41 40 0.00% 42 55 0.00% 43 61 0.00% 44 90 0.00% 45 79 0.00% 46 87 0.00% 47 81 0.00% 48 96 0.00% 49 82 0.00% 50 111 0.00% 51 74 0.00% 52 106 0.00% 53 87 0.00% 54 110 0.00% 55 110 0.00% 56 115 0.00% 57 141 0.00% 58 135 0.00% 59 137 0.00% 60 179 0.00% 61 163 0.00% 62 176 0.00% 63 170 0.00% 64 180 0.00% 65 181 0.00% 66 212 0.00% 67 226 0.00% 68 258 0.00% 69 263 0.00% 70 310 0.00% 71 321 0.00% 72 346 0.00% 73 430 0.00% 74 385 0.00% 75 468 0.00% 76 544 0.00% 77 575 0.00% 78 626 0.00% 79 778 0.00% 80 841 0.00% 81 856 0.00% 82 1067 0.00% 83 1072 0.00% 84 1187 0.00% 85 1391 0.00% 86 1482 0.00% 87 1535 0.00% 88 1886 0.00% 89 2013 0.00% 90 2205 0.01% 91 2512 0.01% 92 2674 0.01% 93 2887 0.01% 94 3287 0.01% 95 3429 0.01% 96 3697 0.01% 97 4106 0.01% 98 4343 0.01% 99 4726 0.01% 100 5183 0.01% 101 5490 0.01% 102 6060 0.01% 103 6394 0.02% 104 6998 0.02% 105 7340 0.02% 106 7824 0.02% 107 8217 0.02% 108 8687 0.02% 109 9499 0.02% 110 9789 0.02% 111 10654 0.03% 112 11157 0.03% 113 11624 0.03% 114 12462 0.03% 115 13163 0.03% 116 13781 0.03% 117 14804 0.04% 118 15093 0.04% 119 15526 0.04% 120 16533 0.04% 121 17040 0.04% 122 17833 0.04% 123 19011 0.05% 124 20532 0.05% 125 20867 0.05% 126 22099 0.05% 127 22469 0.06% 128 23381 0.06% 129 24062 0.06% 130 24687 0.06% 131 25667 0.06% 132 27040 0.07% 133 28636 0.07% 134 29420 0.07% 135 31090 0.08% 136 31887 0.08% 137 32840 0.08% 138 34033 0.08% 139 34921 0.09% 140 36103 0.09% 141 37234 0.09% 142 38985 0.10% 143 40054 0.10% 144 42195 0.10% 145 43491 0.11% 146 44656 0.11% 147 45563 0.11% 148 47752 0.12% 149 48265 0.12% 150 51628 0.13% 151 39247745 96.95% 40484045 reads passed initial QC criterion=sequence-density sequence-density=1.31 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=14 prefix-density=1.35 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=44.78 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=13 prefix-density=1.07 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=20.29 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.8 sequence=CGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAG SRR7814935 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:15:00 Started mapping on | Dec 07 01:15:00 Finished on | Dec 07 01:22:22 Mapping speed, Million of reads per hour | 329.73 Number of input reads | 40484045 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 37324783 Uniquely mapped reads % | 92.20% Average mapped length | 299.93 Number of splices: Total | 39112424 Number of splices: Annotated (sjdb) | 37085652 Number of splices: GT/AG | 38605535 Number of splices: GC/AG | 462674 Number of splices: AT/AC | 13729 Number of splices: Non-canonical | 30486 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 551308 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 77733 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.81% % of reads unmapped: other | 1.44% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2607954 2607954 2607954 N_multimapping 551308 551308 551308 N_noFeature 1261793 36274306 1527308 N_ambiguous 964658 5982 180524 UnstrandedReadsAssigned:35098332 PositiveStrandReadsAssigned:1044495 NegativeStrandReadsAssigned:35616951 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814935 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814935-trimmed-pair1.fastq SRR7814935-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,484,045 reads, 36,152,420 reads pseudoaligned [quant] estimated average fragment length: 305.067 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR7814935.ke.tsv 35125 SRR7814935.se.tsv 88098 total ==> SRR7814935.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 632.549 0 0 PNS24247 1044 739.933 104.049 5.0383 PNS24249 1928 1623.93 181.809 4.01128 PNS24246 1044 739.933 104.049 5.0383 PNS24248 1044 739.933 104.049 5.0383 PNS24244 1471 1166.93 197.043 6.04994 PNS24243 293 72.8172 0 0 KQK14069 1603 1298.93 8551.4 235.878 KQK14071 474 200.14 26.022 4.65847 ==> SRR7814935.se.tsv <== BRADI_1g14170v3 8642 BRADI_1g53295v3 156 BRADI_1g59795v3 433 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 413 BRADI_1g74790v3 1737 BRADI_1g09890v3 0 BRADI_1g77505v3 392 BRADI_1g48960v3 0 SRR7814935 completed mapping pipeline successfully