Starting /dee2/code/volunteer_pipeline.sh SRR7814936 current disk space = 1548197212160 free memory = 1604528688 SRR7814936 SRAfilesize d8bb7d26dbfaf2c5fe1ccb057dc17500 SRR7814936.sra SRR7814936.sra file validated SRR7814936 is paired end SRR7814936 is conventional basespace SRR7814936 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814936_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.36675 37.0 37.0 37.0 37.0 37.0 2 36.414 37.0 37.0 37.0 37.0 37.0 3 36.5745 37.0 37.0 37.0 37.0 37.0 4 36.601 37.0 37.0 37.0 37.0 37.0 5 36.502 37.0 37.0 37.0 37.0 37.0 6 36.574 37.0 37.0 37.0 37.0 37.0 7 36.4015 37.0 37.0 37.0 37.0 37.0 8 36.581 37.0 37.0 37.0 37.0 37.0 9 36.612 37.0 37.0 37.0 37.0 37.0 10-14 36.5566 37.0 37.0 37.0 37.0 37.0 15-19 36.5406 37.0 37.0 37.0 37.0 37.0 20-24 36.537 37.0 37.0 37.0 37.0 37.0 25-29 36.5097 37.0 37.0 37.0 37.0 37.0 30-34 36.5282 37.0 37.0 37.0 37.0 37.0 35-39 36.479400000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.4716 37.0 37.0 37.0 37.0 37.0 45-49 36.4166 37.0 37.0 37.0 37.0 37.0 50-54 36.3661 37.0 37.0 37.0 37.0 37.0 55-59 36.325 37.0 37.0 37.0 37.0 37.0 60-64 36.29279999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.28340000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.2805 37.0 37.0 37.0 37.0 37.0 75-79 36.2417 37.0 37.0 37.0 37.0 37.0 80-84 36.2087 37.0 37.0 37.0 37.0 37.0 85-89 36.2007 37.0 37.0 37.0 37.0 37.0 90-94 36.1649 37.0 37.0 37.0 37.0 37.0 95-99 36.1546 37.0 37.0 37.0 37.0 37.0 100-104 36.039899999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0477 37.0 37.0 37.0 37.0 37.0 110-114 35.9671 37.0 37.0 37.0 37.0 37.0 115-119 35.973299999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7907 37.0 37.0 37.0 37.0 37.0 125-129 35.7856 37.0 37.0 37.0 37.0 37.0 130-134 35.6706 37.0 37.0 37.0 37.0 37.0 135-139 35.7667 37.0 37.0 37.0 37.0 37.0 140-144 35.641 37.0 37.0 37.0 37.0 37.0 145-149 35.5544 37.0 37.0 37.0 34.6 37.0 150-151 34.788 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 3.0 25 0.0 26 3.0 27 7.0 28 8.0 29 17.0 30 26.0 31 38.0 32 56.0 33 77.0 34 158.0 35 425.0 36 2921.0 37 260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.7858038625533 12.440431402056685 9.255079006772009 36.51868572861801 2 23.5 18.775 34.525 23.200000000000003 3 22.525000000000002 22.975 24.625 29.875 4 27.875 29.599999999999998 19.55 22.975 5 24.975 32.85 21.675 20.5 6 21.375 33.425 23.625 21.575 7 16.6 19.825 40.825 22.75 8 20.849999999999998 20.75 27.85 30.55 9 21.55 18.275 31.5 28.675 10-14 23.945 25.5 24.165 26.39 15-19 23.265 25.195 24.9 26.640000000000004 20-24 23.375 25.39 25.06 26.174999999999997 25-29 24.48 25.180000000000003 24.875 25.465 30-34 23.3 24.615000000000002 25.474999999999998 26.61 35-39 23.880000000000003 24.67 25.085 26.365 40-44 23.849999999999998 24.75 25.585 25.814999999999998 45-49 23.985 24.529999999999998 25.275 26.21 50-54 23.89 24.825 25.55 25.735000000000003 55-59 24.22 24.675 24.855 26.25 60-64 24.055 24.81 24.735 26.400000000000002 65-69 23.565 24.83 25.335 26.27 70-74 23.75 24.645 25.374999999999996 26.229999999999997 75-79 23.87 24.66 24.95 26.52 80-84 23.895 24.26 24.935 26.91 85-89 23.7 24.42 25.09 26.790000000000003 90-94 24.73 24.310000000000002 24.515 26.445 95-99 24.16 24.435000000000002 25.35 26.055 100-104 24.435000000000002 24.279999999999998 24.695 26.590000000000003 105-109 24.4 24.6 24.47 26.529999999999998 110-114 24.279999999999998 24.265 25.03 26.424999999999997 115-119 24.08 24.865000000000002 24.435000000000002 26.619999999999997 120-124 24.205 24.935 24.5 26.36 125-129 24.560000000000002 24.435000000000002 24.37 26.634999999999998 130-134 24.535 24.21 24.605 26.650000000000002 135-139 24.47 24.21 24.255 27.065 140-144 24.265 24.25 24.795 26.69 145-149 25.035 24.545 24.27 26.150000000000002 150-151 24.4 24.4375 24.637500000000003 26.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.5 29 6.5 30 7.5 31 8.5 32 16.0 33 18.0 34 21.0 35 32.5 36 46.5 37 61.0 38 77.5 39 96.5 40 110.5 41 119.0 42 139.0 43 156.0 44 180.0 45 198.5 46 186.5 47 175.0 48 187.5 49 181.0 50 173.5 51 172.0 52 145.0 53 135.0 54 121.5 55 113.5 56 101.0 57 83.5 58 79.5 59 80.0 60 79.5 61 67.0 62 64.0 63 61.5 64 57.5 65 55.0 66 58.0 67 59.5 68 45.0 69 41.0 70 38.5 71 35.0 72 31.5 73 25.5 74 18.0 75 10.0 76 6.5 77 4.5 78 3.5 79 1.0 80 1.0 81 1.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.21739130434783 80.925 2 8.249721293199554 14.799999999999999 3 1.3656633221850614 3.675 4 0.16722408026755853 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9125000000000001 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.2 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138-139 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCACAT 10 0.006830828 145.0 7 ATTCTTT 10 0.006830828 145.0 5 >>END_MODULE SRR7814936 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814936_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.554 37.0 37.0 37.0 37.0 37.0 2 36.2695 37.0 37.0 37.0 37.0 37.0 3 36.443 37.0 37.0 37.0 37.0 37.0 4 36.2645 37.0 37.0 37.0 37.0 37.0 5 36.3805 37.0 37.0 37.0 37.0 37.0 6 36.297 37.0 37.0 37.0 37.0 37.0 7 36.369 37.0 37.0 37.0 37.0 37.0 8 36.3435 37.0 37.0 37.0 37.0 37.0 9 36.31 37.0 37.0 37.0 37.0 37.0 10-14 36.343999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.262 37.0 37.0 37.0 37.0 37.0 20-24 36.2745 37.0 37.0 37.0 37.0 37.0 25-29 36.2328 37.0 37.0 37.0 37.0 37.0 30-34 36.1476 37.0 37.0 37.0 37.0 37.0 35-39 36.1511 37.0 37.0 37.0 37.0 37.0 40-44 36.007099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0503 37.0 37.0 37.0 37.0 37.0 50-54 35.912 37.0 37.0 37.0 37.0 37.0 55-59 35.766000000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.781600000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.790800000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.6945 37.0 37.0 37.0 37.0 37.0 75-79 35.700900000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.541000000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.5113 37.0 37.0 37.0 34.6 37.0 90-94 35.4696 37.0 37.0 37.0 37.0 37.0 95-99 35.025800000000004 37.0 37.0 37.0 25.0 37.0 100-104 35.116 37.0 37.0 37.0 29.8 37.0 105-109 34.846 37.0 37.0 37.0 25.0 37.0 110-114 34.988800000000005 37.0 37.0 37.0 25.0 37.0 115-119 35.0043 37.0 37.0 37.0 27.4 37.0 120-124 34.6388 37.0 37.0 37.0 25.0 37.0 125-129 34.8144 37.0 37.0 37.0 25.0 37.0 130-134 34.389199999999995 37.0 37.0 37.0 25.0 37.0 135-139 34.2431 37.0 37.0 37.0 25.0 37.0 140-144 34.4003 37.0 37.0 37.0 25.0 37.0 145-149 34.2439 37.0 37.0 37.0 25.0 37.0 150-151 33.65275 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 1.0 16 3.0 17 0.0 18 1.0 19 2.0 20 2.0 21 7.0 22 7.0 23 7.0 24 9.0 25 8.0 26 11.0 27 9.0 28 22.0 29 20.0 30 28.0 31 49.0 32 69.0 33 179.0 34 376.0 35 977.0 36 2148.0 37 60.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.199999999999996 14.799999999999999 11.025 31.974999999999998 2 29.225 21.25 28.4 21.125 3 24.3 25.474999999999998 24.75 25.474999999999998 4 28.325 31.75 17.45 22.475 5 27.025 32.95 17.825 22.2 6 22.6 34.075 19.275000000000002 24.05 7 22.575 15.9 36.4 25.124999999999996 8 22.3 21.224999999999998 22.400000000000002 34.075 9 24.775 21.349999999999998 23.95 29.925 10-14 25.96 25.169999999999998 22.305 26.565 15-19 26.279999999999998 24.925 23.169999999999998 25.624999999999996 20-24 26.855 23.98 23.51 25.655 25-29 26.46 24.62 22.814999999999998 26.105 30-34 26.405 24.355 23.405 25.835 35-39 26.085 24.66 23.645 25.61 40-44 26.61 24.745 22.869999999999997 25.775 45-49 26.534999999999997 24.205 23.255 26.005 50-54 26.400000000000002 24.54 22.89 26.169999999999998 55-59 26.640000000000004 24.740000000000002 22.765 25.855 60-64 26.8 24.75 23.315 25.135 65-69 26.179999999999996 24.245 23.794999999999998 25.779999999999998 70-74 26.88 23.765 23.485 25.869999999999997 75-79 26.905 24.43 23.165 25.5 80-84 26.840000000000003 25.124999999999996 22.86 25.174999999999997 85-89 27.250000000000004 24.13 23.29 25.330000000000002 90-94 26.505000000000003 24.755 23.169999999999998 25.569999999999997 95-99 26.415 25.05 23.59 24.945 100-104 26.834999999999997 25.06 23.14 24.965 105-109 27.025 24.39 23.9 24.685000000000002 110-114 27.125 25.240000000000002 22.775000000000002 24.86 115-119 26.674999999999997 24.955 23.25 25.119999999999997 120-124 27.169999999999998 25.095 23.135 24.6 125-129 27.16 25.295 22.55 24.995 130-134 26.840000000000003 24.605 23.22 25.335 135-139 26.83 24.759999999999998 23.89 24.52 140-144 27.439999999999998 24.965 23.400000000000002 24.195 145-149 27.275 25.44 22.900000000000002 24.385 150-151 27.5875 25.55 22.9875 23.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 2.0 27 2.5 28 1.0 29 2.5 30 3.0 31 4.0 32 7.5 33 9.5 34 18.0 35 27.0 36 33.5 37 47.0 38 60.0 39 70.0 40 93.0 41 112.0 42 116.0 43 147.5 44 167.0 45 159.5 46 161.5 47 164.5 48 165.5 49 156.5 50 147.0 51 140.5 52 144.0 53 134.5 54 101.5 55 91.0 56 93.0 57 100.5 58 108.5 59 100.5 60 94.0 61 93.5 62 98.0 63 88.5 64 81.5 65 78.5 66 78.5 67 85.0 68 71.5 69 60.0 70 55.5 71 52.5 72 46.5 73 33.0 74 23.0 75 18.0 76 14.0 77 9.0 78 5.5 79 5.5 80 3.5 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.725 #Duplication Level Percentage of deduplicated Percentage of total 1 90.52660908331012 81.22500000000001 2 7.829478963499582 14.05 3 1.337419894120925 3.5999999999999996 4 0.27862914460852606 1.0 5 0.02786291446085261 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.6625 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.3875 0.0 0.0 0.0 0.0 130-131 1.4500000000000002 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.725 0.0 0.0 0.0 0.0 136-137 1.825 0.0 0.0 0.0 0.0 138-139 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACACTC 10 0.006830828 145.0 9 CCAGCCT 10 0.006830828 145.0 2 GCCAGCC 10 0.006830828 145.0 1 AAGACTT 10 0.006830828 145.0 2 CGAGAAG 10 0.006830828 145.0 1 TCACACT 10 0.006830828 145.0 8 >>END_MODULE Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009770 spots for SRR7814936.sra Written 2009770 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra Read 2009759 spots for SRR7814936.sra Written 2009759 spots for SRR7814936.sra SRR ids: ['SRR7814936.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w7_coooh SRR7814936.sra spots: 40195191 blocks: [[1, 2009759], [2009760, 4019518], [4019519, 6029277], [6029278, 8039036], [8039037, 10048795], [10048796, 12058554], [12058555, 14068313], [14068314, 16078072], [16078073, 18087831], [18087832, 20097590], [20097591, 22107349], [22107350, 24117108], [24117109, 26126867], [26126868, 28136626], [28136627, 30146385], [30146386, 32156144], [32156145, 34165903], [34165904, 36175662], [36175663, 38185421], [38185422, 40195191]] SRR7814936 file size 13599130 SRR7814936 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814936 SRR7814936_1.fastq SRR7814936_2.fastq Input file: SRR7814936_1.fastq Paired file: SRR7814936_2.fastq trimmed: SRR7814936-trimmed-pair1.fastq, SRR7814936-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:26:46 2024 >> started Sat Dec 7 01:59:17 2024 >> done (1950.873s) 40195191 read pairs processed; of these: 112 ( 0.00%) short read pairs filtered out after trimming by size control 3612 ( 0.01%) empty read pairs filtered out after trimming by size control 40191467 (99.99%) read pairs available; of these: 1102995 ( 2.74%) trimmed read pairs available after processing 39088472 (97.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 17 0.00% 20 16 0.00% 21 12 0.00% 22 21 0.00% 23 24 0.00% 24 26 0.00% 25 34 0.00% 26 34 0.00% 27 44 0.00% 28 45 0.00% 29 35 0.00% 30 40 0.00% 31 57 0.00% 32 57 0.00% 33 42 0.00% 34 44 0.00% 35 60 0.00% 36 65 0.00% 37 70 0.00% 38 74 0.00% 39 54 0.00% 40 51 0.00% 41 62 0.00% 42 74 0.00% 43 75 0.00% 44 81 0.00% 45 79 0.00% 46 99 0.00% 47 81 0.00% 48 94 0.00% 49 108 0.00% 50 90 0.00% 51 99 0.00% 52 95 0.00% 53 112 0.00% 54 155 0.00% 55 141 0.00% 56 150 0.00% 57 143 0.00% 58 165 0.00% 59 157 0.00% 60 221 0.00% 61 194 0.00% 62 208 0.00% 63 235 0.00% 64 256 0.00% 65 256 0.00% 66 268 0.00% 67 267 0.00% 68 301 0.00% 69 349 0.00% 70 361 0.00% 71 446 0.00% 72 428 0.00% 73 556 0.00% 74 483 0.00% 75 575 0.00% 76 600 0.00% 77 667 0.00% 78 733 0.00% 79 837 0.00% 80 871 0.00% 81 944 0.00% 82 1184 0.00% 83 1266 0.00% 84 1343 0.00% 85 1562 0.00% 86 1587 0.00% 87 1702 0.00% 88 1885 0.00% 89 2197 0.01% 90 2252 0.01% 91 2554 0.01% 92 2764 0.01% 93 3008 0.01% 94 3369 0.01% 95 3587 0.01% 96 3821 0.01% 97 4045 0.01% 98 4187 0.01% 99 4795 0.01% 100 4927 0.01% 101 5212 0.01% 102 5664 0.01% 103 6152 0.02% 104 6302 0.02% 105 6852 0.02% 106 7334 0.02% 107 7551 0.02% 108 8203 0.02% 109 8410 0.02% 110 9029 0.02% 111 9307 0.02% 112 9902 0.02% 113 10595 0.03% 114 11228 0.03% 115 11669 0.03% 116 12183 0.03% 117 12961 0.03% 118 13599 0.03% 119 14058 0.03% 120 14733 0.04% 121 15194 0.04% 122 15962 0.04% 123 16845 0.04% 124 17815 0.04% 125 18547 0.05% 126 19275 0.05% 127 19768 0.05% 128 20190 0.05% 129 21408 0.05% 130 21831 0.05% 131 22727 0.06% 132 23653 0.06% 133 24937 0.06% 134 25584 0.06% 135 26885 0.07% 136 27909 0.07% 137 28942 0.07% 138 29772 0.07% 139 30636 0.08% 140 31683 0.08% 141 32756 0.08% 142 34309 0.09% 143 35014 0.09% 144 36939 0.09% 145 38368 0.10% 146 40066 0.10% 147 40833 0.10% 148 41705 0.10% 149 42937 0.11% 150 44475 0.11% 151 39088472 97.26% 40191467 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=29 prefix-density=1.05 prefix-fanout=3.0 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=43.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.1 sequence=GCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=29 prefix-density=0.62 prefix-fanout=2.4 sequence=GCACCAGCTGCACCTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=86.30 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=15.0 sequence=GCCGCCGCCGCC SRR7814936 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 02:06:11 Started mapping on | Dec 07 02:06:12 Finished on | Dec 07 02:14:51 Mapping speed, Million of reads per hour | 278.78 Number of input reads | 40191467 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 37784476 Uniquely mapped reads % | 94.01% Average mapped length | 300.08 Number of splices: Total | 41567269 Number of splices: Annotated (sjdb) | 39104137 Number of splices: GT/AG | 41019092 Number of splices: GC/AG | 499171 Number of splices: AT/AC | 19063 Number of splices: Non-canonical | 29943 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.51 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 428086 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 46196 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.98% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1978905 1978905 1978905 N_multimapping 428086 428086 428086 N_noFeature 1264282 36602215 1562957 N_ambiguous 1052990 6778 170100 UnstrandedReadsAssigned:35467204 PositiveStrandReadsAssigned:1175483 NegativeStrandReadsAssigned:36051419 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814936 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814936-trimmed-pair1.fastq SRR7814936-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,191,467 reads, 36,478,740 reads pseudoaligned [quant] estimated average fragment length: 314.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52973 SRR7814936.ke.tsv 35125 SRR7814936.se.tsv 88098 total ==> SRR7814936.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 623.272 0 0 PNS24247 1044 730.371 144.798 6.84444 PNS24249 1928 1614.37 121.059 2.58887 PNS24246 1044 730.371 144.798 6.84444 PNS24248 1044 730.371 144.798 6.84444 PNS24244 1471 1157.37 288.546 8.60716 PNS24243 293 71.8365 0 0 KQK14069 1603 1289.37 9242.71 247.479 KQK14071 474 195.533 181.457 32.0385 ==> SRR7814936.se.tsv <== BRADI_1g14170v3 10094 BRADI_1g53295v3 1058 BRADI_1g59795v3 1682 BRADI_1g07683v3 2 BRADI_1g00485v3 4 BRADI_1g20270v3 690 BRADI_1g74790v3 659 BRADI_1g09890v3 8 BRADI_1g77505v3 527 BRADI_1g48960v3 2 SRR7814936 completed mapping pipeline successfully