Starting /dee2/code/volunteer_pipeline.sh SRR7814937 current disk space = 1547679715328 free memory = 1604621776 SRR7814937 SRAfilesize f3d189da3f1b3e04082f33ba7996fd64 SRR7814937.sra SRR7814937.sra file validated SRR7814937 is paired end SRR7814937 is conventional basespace SRR7814937 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814937_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2485 37.0 37.0 37.0 37.0 37.0 2 36.456 37.0 37.0 37.0 37.0 37.0 3 36.4945 37.0 37.0 37.0 37.0 37.0 4 36.562 37.0 37.0 37.0 37.0 37.0 5 36.5275 37.0 37.0 37.0 37.0 37.0 6 36.595 37.0 37.0 37.0 37.0 37.0 7 36.4525 37.0 37.0 37.0 37.0 37.0 8 36.522 37.0 37.0 37.0 37.0 37.0 9 36.587 37.0 37.0 37.0 37.0 37.0 10-14 36.545100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5244 37.0 37.0 37.0 37.0 37.0 20-24 36.462999999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.4589 37.0 37.0 37.0 37.0 37.0 30-34 36.461 37.0 37.0 37.0 37.0 37.0 35-39 36.4424 37.0 37.0 37.0 37.0 37.0 40-44 36.392199999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.364200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.311 37.0 37.0 37.0 37.0 37.0 55-59 36.3084 37.0 37.0 37.0 37.0 37.0 60-64 36.2755 37.0 37.0 37.0 37.0 37.0 65-69 36.141999999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.161199999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.1545 37.0 37.0 37.0 37.0 37.0 80-84 36.153200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.0514 37.0 37.0 37.0 37.0 37.0 90-94 36.0755 37.0 37.0 37.0 37.0 37.0 95-99 35.9764 37.0 37.0 37.0 37.0 37.0 100-104 35.9759 37.0 37.0 37.0 37.0 37.0 105-109 36.00169999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.978500000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8928 37.0 37.0 37.0 37.0 37.0 120-124 35.760799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.675599999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.62349999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.6737 37.0 37.0 37.0 37.0 37.0 140-144 35.538599999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.4702 37.0 37.0 37.0 34.6 37.0 150-151 34.73975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 1.0 24 1.0 25 4.0 26 10.0 27 7.0 28 16.0 29 17.0 30 31.0 31 31.0 32 58.0 33 88.0 34 158.0 35 421.0 36 2947.0 37 208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.822055137844615 11.954887218045112 9.448621553884712 39.774436090225564 2 22.425 17.625 34.8 25.15 3 21.525 22.675 23.474999999999998 32.324999999999996 4 28.15 28.4 20.65 22.8 5 25.575 31.175000000000004 22.5 20.75 6 20.95 33.375 23.125 22.55 7 16.5 19.900000000000002 42.875 20.724999999999998 8 21.099999999999998 18.925 28.725 31.25 9 20.075000000000003 20.599999999999998 30.425 28.9 10-14 23.655 25.365 24.72 26.26 15-19 23.27 25.509999999999998 24.855 26.365 20-24 23.945 24.645 24.855 26.555 25-29 24.065 24.865000000000002 24.834999999999997 26.235000000000003 30-34 23.7 25.095 25.380000000000003 25.825 35-39 23.825 24.474999999999998 25.53 26.169999999999998 40-44 24.025 24.44 24.955 26.58 45-49 23.985 24.795 24.305 26.915 50-54 24.075 24.59 24.985 26.35 55-59 24.425 24.29 25.014999999999997 26.27 60-64 24.310000000000002 24.965 24.575 26.150000000000002 65-69 24.295 24.42 24.45 26.834999999999997 70-74 24.834999999999997 24.305 24.55 26.31 75-79 23.95 24.695 24.615000000000002 26.740000000000002 80-84 23.985 24.44 24.525 27.05 85-89 24.115000000000002 24.34 24.575 26.97 90-94 24.995 24.035 24.63 26.340000000000003 95-99 24.48 24.42 24.39 26.71 100-104 24.415 24.555 24.435000000000002 26.595000000000002 105-109 24.98 23.919999999999998 24.45 26.650000000000002 110-114 25.025 23.724999999999998 24.785 26.465 115-119 24.740000000000002 23.669999999999998 24.18 27.41 120-124 24.75 24.48 24.560000000000002 26.21 125-129 25.16 23.21 25.025 26.605 130-134 25.445 23.755000000000003 24.22 26.58 135-139 25.330000000000002 23.555 24.305 26.810000000000002 140-144 25.355 23.849999999999998 24.65 26.145000000000003 145-149 25.259999999999998 23.53 24.615000000000002 26.595000000000002 150-151 26.0 22.6375 24.625 26.737499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 1.5 27 2.5 28 3.0 29 6.5 30 6.5 31 5.5 32 9.5 33 16.0 34 24.5 35 33.0 36 43.0 37 55.0 38 66.5 39 76.0 40 104.5 41 129.5 42 152.5 43 181.0 44 185.0 45 187.5 46 187.5 47 181.0 48 183.0 49 174.5 50 148.5 51 136.5 52 129.5 53 120.0 54 113.5 55 112.0 56 107.0 57 91.0 58 93.0 59 93.0 60 73.0 61 72.0 62 87.5 63 78.5 64 58.5 65 69.0 66 66.5 67 56.0 68 57.0 69 52.0 70 42.0 71 29.0 72 25.5 73 24.5 74 20.5 75 13.5 76 7.5 77 3.0 78 2.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.07168069508552 84.775 2 7.30382840076025 13.450000000000001 3 0.5701873472712462 1.575 4 0.054303556882975834 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.48750000000000004 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.175 0.0 0.0 0.0 0.0 138-139 1.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGCGT 10 0.006830828 145.0 9 >>END_MODULE SRR7814937 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814937_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.408 37.0 37.0 37.0 37.0 37.0 2 36.188 37.0 37.0 37.0 37.0 37.0 3 36.2045 37.0 37.0 37.0 37.0 37.0 4 36.1855 37.0 37.0 37.0 37.0 37.0 5 36.172 37.0 37.0 37.0 37.0 37.0 6 36.2095 37.0 37.0 37.0 37.0 37.0 7 36.1915 37.0 37.0 37.0 37.0 37.0 8 36.204 37.0 37.0 37.0 37.0 37.0 9 36.1835 37.0 37.0 37.0 37.0 37.0 10-14 36.165499999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.1539 37.0 37.0 37.0 37.0 37.0 20-24 36.1726 37.0 37.0 37.0 37.0 37.0 25-29 36.087900000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.1409 37.0 37.0 37.0 37.0 37.0 35-39 36.088300000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.9879 37.0 37.0 37.0 37.0 37.0 45-49 35.9105 37.0 37.0 37.0 37.0 37.0 50-54 35.757 37.0 37.0 37.0 37.0 37.0 55-59 35.7094 37.0 37.0 37.0 37.0 37.0 60-64 35.6809 37.0 37.0 37.0 37.0 37.0 65-69 35.6399 37.0 37.0 37.0 37.0 37.0 70-74 35.6035 37.0 37.0 37.0 37.0 37.0 75-79 35.5375 37.0 37.0 37.0 37.0 37.0 80-84 35.3914 37.0 37.0 37.0 37.0 37.0 85-89 35.4476 37.0 37.0 37.0 34.6 37.0 90-94 35.279999999999994 37.0 37.0 37.0 32.2 37.0 95-99 34.9491 37.0 37.0 37.0 25.0 37.0 100-104 34.971500000000006 37.0 37.0 37.0 25.0 37.0 105-109 34.7748 37.0 37.0 37.0 25.0 37.0 110-114 34.832100000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.830499999999994 37.0 37.0 37.0 25.0 37.0 120-124 34.5228 37.0 37.0 37.0 25.0 37.0 125-129 34.6486 37.0 37.0 37.0 25.0 37.0 130-134 34.2572 37.0 37.0 37.0 25.0 37.0 135-139 34.144999999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.399699999999996 37.0 37.0 37.0 25.0 37.0 145-149 34.1331 37.0 37.0 37.0 25.0 37.0 150-151 33.527 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 3.0 15 3.0 16 3.0 17 2.0 18 1.0 19 2.0 20 5.0 21 5.0 22 10.0 23 9.0 24 14.0 25 12.0 26 20.0 27 14.0 28 19.0 29 20.0 30 27.0 31 76.0 32 75.0 33 181.0 34 341.0 35 937.0 36 2157.0 37 62.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.1 14.7 11.125 36.075 2 28.999999999999996 20.8 29.299999999999997 20.9 3 24.8 23.9 25.074999999999996 26.224999999999998 4 28.449999999999996 30.4 16.675 24.474999999999998 5 27.975 31.674999999999997 19.0 21.349999999999998 6 21.05 35.05 19.075 24.825 7 21.8 15.875 34.949999999999996 27.375 8 24.75 20.5 22.225 32.525 9 23.775 21.3 24.95 29.975 10-14 26.179999999999996 25.615 21.995 26.21 15-19 26.924999999999997 23.919999999999998 22.79 26.365 20-24 26.43 25.385 22.73 25.455 25-29 26.729999999999997 25.1 22.185 25.985000000000003 30-34 26.619999999999997 24.83 22.415 26.135 35-39 26.46 24.66 22.485 26.395000000000003 40-44 25.81 25.16 22.68 26.35 45-49 26.165 24.34 23.18 26.314999999999998 50-54 26.450000000000003 24.265 23.035 26.25 55-59 27.11 24.560000000000002 22.125 26.205000000000002 60-64 27.08 24.465 22.52 25.935000000000002 65-69 26.355 24.95 22.855 25.840000000000003 70-74 27.07 24.185000000000002 22.36 26.384999999999998 75-79 26.895000000000003 25.36 22.03 25.715 80-84 26.974999999999998 24.785 22.53 25.71 85-89 26.900000000000002 24.815 22.564999999999998 25.72 90-94 26.900000000000002 24.25 22.86 25.990000000000002 95-99 26.545 25.09 23.325000000000003 25.040000000000003 100-104 28.044999999999998 24.695 22.125 25.135 105-109 26.44 24.79 22.845 25.924999999999997 110-114 27.07 25.45 22.61 24.87 115-119 26.51 25.195 23.200000000000003 25.095 120-124 27.095000000000002 25.180000000000003 22.945 24.779999999999998 125-129 27.065 24.895 23.244999999999997 24.795 130-134 27.650000000000002 24.525 22.869999999999997 24.955 135-139 27.195000000000004 24.83 22.63 25.345000000000002 140-144 26.77 25.3 22.994999999999997 24.935 145-149 27.325 25.395 22.400000000000002 24.88 150-151 27.474999999999998 25.3 22.7 24.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 2.5 9 2.0 10 1.5 11 1.5 12 0.0 13 1.5 14 1.5 15 0.0 16 1.5 17 2.5 18 2.0 19 1.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 1.5 26 2.0 27 1.5 28 0.5 29 1.5 30 6.0 31 6.5 32 5.0 33 7.5 34 16.0 35 21.5 36 26.0 37 42.0 38 56.0 39 62.0 40 73.0 41 95.0 42 119.5 43 136.0 44 156.5 45 162.5 46 174.0 47 182.5 48 150.5 49 135.0 50 147.0 51 134.0 52 115.5 53 103.5 54 107.0 55 115.5 56 110.0 57 114.5 58 108.5 59 103.5 60 100.0 61 105.5 62 99.5 63 89.0 64 101.5 65 93.5 66 74.0 67 79.5 68 78.5 69 69.5 70 62.5 71 53.5 72 46.5 73 31.0 74 25.0 75 23.0 76 13.0 77 7.0 78 6.0 79 4.5 80 2.5 81 2.0 82 2.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.9869174161897 84.375 2 7.249931861542655 13.3 3 0.5723630417007358 1.575 4 0.1635322976287817 0.6 5 0.0 0.0 6 0.027255382938130283 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACAGGCAAAACACAGCTGATTCGTGTACTCGATCTCCCCAGCAAGTT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.425 0.0 0.0 0.0 0.0 120-121 0.48750000000000004 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.5874999999999999 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.15 0.0 0.0 0.0 0.0 138-139 1.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252162 spots for SRR7814937.sra Written 2252162 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra Read 2252156 spots for SRR7814937.sra Written 2252156 spots for SRR7814937.sra SRR ids: ['SRR7814937.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2lqfhf0c SRR7814937.sra spots: 45043126 blocks: [[1, 2252156], [2252157, 4504312], [4504313, 6756468], [6756469, 9008624], [9008625, 11260780], [11260781, 13512936], [13512937, 15765092], [15765093, 18017248], [18017249, 20269404], [20269405, 22521560], [22521561, 24773716], [24773717, 27025872], [27025873, 29278028], [29278029, 31530184], [31530185, 33782340], [33782341, 36034496], [36034497, 38286652], [38286653, 40538808], [40538809, 42790964], [42790965, 45043126]] SRR7814937 file size 15241937 SRR7814937 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814937 SRR7814937_1.fastq SRR7814937_2.fastq Input file: SRR7814937_1.fastq Paired file: SRR7814937_2.fastq trimmed: SRR7814937-trimmed-pair1.fastq, SRR7814937-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 03:16:28 2024 >> started Sat Dec 7 03:17:39 2024 >> done (71.282s) 45043126 read pairs processed; of these: 127 ( 0.00%) short read pairs filtered out after trimming by size control 1732 ( 0.00%) empty read pairs filtered out after trimming by size control 45041267 (100.00%) read pairs available; of these: 1172083 ( 2.60%) trimmed read pairs available after processing 43869184 (97.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 16 0.00% 20 25 0.00% 21 26 0.00% 22 21 0.00% 23 20 0.00% 24 41 0.00% 25 35 0.00% 26 38 0.00% 27 40 0.00% 28 44 0.00% 29 52 0.00% 30 47 0.00% 31 45 0.00% 32 80 0.00% 33 50 0.00% 34 50 0.00% 35 63 0.00% 36 70 0.00% 37 81 0.00% 38 84 0.00% 39 68 0.00% 40 92 0.00% 41 66 0.00% 42 79 0.00% 43 65 0.00% 44 92 0.00% 45 106 0.00% 46 112 0.00% 47 72 0.00% 48 100 0.00% 49 117 0.00% 50 110 0.00% 51 108 0.00% 52 122 0.00% 53 136 0.00% 54 146 0.00% 55 157 0.00% 56 148 0.00% 57 178 0.00% 58 174 0.00% 59 176 0.00% 60 201 0.00% 61 166 0.00% 62 219 0.00% 63 217 0.00% 64 214 0.00% 65 234 0.00% 66 251 0.00% 67 262 0.00% 68 293 0.00% 69 304 0.00% 70 352 0.00% 71 338 0.00% 72 442 0.00% 73 456 0.00% 74 460 0.00% 75 487 0.00% 76 527 0.00% 77 606 0.00% 78 694 0.00% 79 789 0.00% 80 795 0.00% 81 920 0.00% 82 932 0.00% 83 1098 0.00% 84 1207 0.00% 85 1301 0.00% 86 1433 0.00% 87 1553 0.00% 88 1699 0.00% 89 1919 0.00% 90 2089 0.00% 91 2264 0.01% 92 2527 0.01% 93 2871 0.01% 94 3041 0.01% 95 3253 0.01% 96 3589 0.01% 97 3789 0.01% 98 4237 0.01% 99 4456 0.01% 100 4705 0.01% 101 5073 0.01% 102 5671 0.01% 103 5997 0.01% 104 6232 0.01% 105 6932 0.02% 106 7227 0.02% 107 7810 0.02% 108 8077 0.02% 109 8371 0.02% 110 8985 0.02% 111 9534 0.02% 112 10524 0.02% 113 11024 0.02% 114 11726 0.03% 115 12398 0.03% 116 12752 0.03% 117 13089 0.03% 118 14080 0.03% 119 14575 0.03% 120 15364 0.03% 121 16344 0.04% 122 16931 0.04% 123 17876 0.04% 124 18800 0.04% 125 19652 0.04% 126 20613 0.05% 127 20919 0.05% 128 21720 0.05% 129 22796 0.05% 130 23344 0.05% 131 24116 0.05% 132 25669 0.06% 133 26487 0.06% 134 27682 0.06% 135 28939 0.06% 136 30328 0.07% 137 31305 0.07% 138 32304 0.07% 139 33658 0.07% 140 34133 0.08% 141 35838 0.08% 142 37208 0.08% 143 38036 0.08% 144 40072 0.09% 145 42129 0.09% 146 43477 0.10% 147 44628 0.10% 148 45351 0.10% 149 46783 0.10% 150 48948 0.11% 151 43869184 97.40% 45041267 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=4.71 fanout-score-rank=23 prefix-density=1.00 prefix-fanout=3.4 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=16.28 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=CACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGG criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=30 prefix-density=0.68 prefix-fanout=2.8 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=79.91 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.9 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7814937 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 03:22:31 Started mapping on | Dec 07 03:22:31 Finished on | Dec 07 03:26:17 Mapping speed, Million of reads per hour | 717.47 Number of input reads | 45041267 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 42967407 Uniquely mapped reads % | 95.40% Average mapped length | 300.21 Number of splices: Total | 47455286 Number of splices: Annotated (sjdb) | 44810768 Number of splices: GT/AG | 46823223 Number of splices: GC/AG | 577361 Number of splices: AT/AC | 20296 Number of splices: Non-canonical | 34406 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471255 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 57408 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.49% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1602605 1602605 1602605 N_multimapping 471255 471255 471255 N_noFeature 1275556 41619683 1566166 N_ambiguous 1251422 6969 195976 UnstrandedReadsAssigned:40440429 PositiveStrandReadsAssigned:1340755 NegativeStrandReadsAssigned:41205265 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814937 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814937-trimmed-pair1.fastq SRR7814937-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,041,267 reads, 41,601,132 reads pseudoaligned [quant] estimated average fragment length: 311.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52973 SRR7814937.ke.tsv 35125 SRR7814937.se.tsv 88098 total ==> SRR7814937.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 626.337 0 0 PNS24247 1044 733.565 119.455 4.79914 PNS24249 1928 1617.57 177.486 3.23368 PNS24246 1044 733.565 119.455 4.79914 PNS24248 1044 733.565 119.455 4.79914 PNS24244 1471 1160.57 297.148 7.54571 PNS24243 293 71.2848 0 0 KQK14069 1603 1292.57 6633.26 151.242 KQK14071 474 194.972 78.3666 11.8455 ==> SRR7814937.se.tsv <== BRADI_1g14170v3 6924 BRADI_1g53295v3 1127 BRADI_1g59795v3 1605 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 929 BRADI_1g74790v3 622 BRADI_1g09890v3 0 BRADI_1g77505v3 786 BRADI_1g48960v3 0 SRR7814937 completed mapping pipeline successfully