Starting /dee2/code/volunteer_pipeline.sh SRR7814938 current disk space = 1547671982080 free memory = 1604616032 SRR7814938 SRAfilesize e729b3d9d7b93be08265654bc762d2c6 SRR7814938.sra SRR7814938.sra file validated SRR7814938 is paired end SRR7814938 is conventional basespace SRR7814938 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814938_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3075 37.0 37.0 37.0 37.0 37.0 2 36.258 37.0 37.0 37.0 37.0 37.0 3 36.409 37.0 37.0 37.0 37.0 37.0 4 36.4295 37.0 37.0 37.0 37.0 37.0 5 36.523 37.0 37.0 37.0 37.0 37.0 6 36.523 37.0 37.0 37.0 37.0 37.0 7 36.401 37.0 37.0 37.0 37.0 37.0 8 36.5405 37.0 37.0 37.0 37.0 37.0 9 36.549 37.0 37.0 37.0 37.0 37.0 10-14 36.532000000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.499700000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4736 37.0 37.0 37.0 37.0 37.0 25-29 36.4315 37.0 37.0 37.0 37.0 37.0 30-34 36.424 37.0 37.0 37.0 37.0 37.0 35-39 36.39110000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4114 37.0 37.0 37.0 37.0 37.0 45-49 36.3163 37.0 37.0 37.0 37.0 37.0 50-54 36.3233 37.0 37.0 37.0 37.0 37.0 55-59 36.3132 37.0 37.0 37.0 37.0 37.0 60-64 36.2651 37.0 37.0 37.0 37.0 37.0 65-69 36.1601 37.0 37.0 37.0 37.0 37.0 70-74 36.131 37.0 37.0 37.0 37.0 37.0 75-79 36.1941 37.0 37.0 37.0 37.0 37.0 80-84 36.1061 37.0 37.0 37.0 37.0 37.0 85-89 36.098699999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.097899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9936 37.0 37.0 37.0 37.0 37.0 100-104 35.95290000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.9228 37.0 37.0 37.0 37.0 37.0 110-114 35.9578 37.0 37.0 37.0 37.0 37.0 115-119 35.88439999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.763600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6569 37.0 37.0 37.0 37.0 37.0 130-134 35.6244 37.0 37.0 37.0 37.0 37.0 135-139 35.634699999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.5449 37.0 37.0 37.0 37.0 37.0 145-149 35.4095 37.0 37.0 37.0 34.6 37.0 150-151 34.63125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 4.0 26 4.0 27 12.0 28 11.0 29 18.0 30 23.0 31 47.0 32 65.0 33 89.0 34 171.0 35 453.0 36 2877.0 37 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.16507777220271 14.30005017561465 7.501254390366283 31.033617661816358 2 24.2 17.875 33.85 24.075 3 22.375 25.6 24.5 27.525 4 26.650000000000002 32.0 20.25 21.099999999999998 5 24.775 34.449999999999996 20.724999999999998 20.05 6 22.775000000000002 33.125 21.55 22.55 7 17.75 20.549999999999997 41.175 20.525 8 20.75 20.424999999999997 27.05 31.775 9 21.425 18.725 31.025000000000002 28.825 10-14 23.535 26.345000000000002 24.279999999999998 25.840000000000003 15-19 24.0 25.540000000000003 25.185000000000002 25.275 20-24 23.29 25.564999999999998 24.69 26.455000000000002 25-29 23.325000000000003 25.624999999999996 25.259999999999998 25.790000000000003 30-34 23.755000000000003 25.53 24.92 25.795 35-39 23.974999999999998 25.0 25.064999999999998 25.96 40-44 24.425 25.47 24.404999999999998 25.7 45-49 23.635 25.124999999999996 25.34 25.900000000000002 50-54 23.244999999999997 25.240000000000002 24.575 26.939999999999998 55-59 24.275 25.105 24.925 25.695 60-64 24.169999999999998 24.565 24.84 26.424999999999997 65-69 22.86 25.624999999999996 25.335 26.179999999999996 70-74 24.05 25.224999999999998 24.69 26.035000000000004 75-79 24.29 25.045 24.845 25.82 80-84 23.825 25.21 24.385 26.58 85-89 24.104999999999997 24.625 25.0 26.27 90-94 24.11 25.615 24.345 25.929999999999996 95-99 24.13 24.855 24.745 26.27 100-104 24.2 25.615 23.965 26.22 105-109 24.305 25.165 24.779999999999998 25.75 110-114 25.09 24.73 24.154999999999998 26.025 115-119 24.005000000000003 24.990000000000002 24.41 26.595000000000002 120-124 24.79 24.43 24.65 26.13 125-129 24.265 24.34 25.135 26.26 130-134 24.5 24.445 24.57 26.484999999999996 135-139 24.55 24.355 24.255 26.840000000000003 140-144 24.345 24.27 25.15 26.235000000000003 145-149 24.87 24.245 24.325 26.56 150-151 26.200000000000003 23.825 23.674999999999997 26.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 2.0 28 4.0 29 4.0 30 6.5 31 10.5 32 14.5 33 19.5 34 31.0 35 42.5 36 57.5 37 70.5 38 77.5 39 85.5 40 105.5 41 137.5 42 160.5 43 166.5 44 175.5 45 182.0 46 185.5 47 203.0 48 189.5 49 168.5 50 163.5 51 153.0 52 145.0 53 134.0 54 116.0 55 93.0 56 76.0 57 81.0 58 98.0 59 85.5 60 63.5 61 60.5 62 66.5 63 69.0 64 67.5 65 65.5 66 57.5 67 58.0 68 46.5 69 34.0 70 38.0 71 29.5 72 16.0 73 15.0 74 19.0 75 18.5 76 12.5 77 6.0 78 3.5 79 3.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 91.95966203325156 84.35000000000001 2 7.222676478604524 13.25 3 0.7631507222676479 2.1 4 0.0 0.0 5 0.027255382938130283 0.125 6 0.0 0.0 7 0.027255382938130283 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGATTTCACCATAGCCACCAAATATCCGACGAAGATCGTCATTTGTTA 7 0.17500000000000002 No Hit AAAGAAACAAGATTTTACAAAATATGAAAACTAAGAAAGCTACCTGTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0 0.025 0.0 0.0 0.0 76-77 0.0 0.025 0.0 0.0 0.0 78-79 0.0 0.025 0.0 0.0 0.0 80-81 0.0 0.025 0.0 0.0 0.0 82-83 0.0 0.025 0.0 0.0 0.0 84-85 0.0 0.025 0.0 0.0 0.0 86-87 0.0 0.025 0.0 0.0 0.0 88-89 0.0 0.025 0.0 0.0 0.0 90-91 0.0 0.025 0.0 0.0 0.0 92-93 0.0125 0.025 0.0 0.0 0.0 94-95 0.025 0.025 0.0 0.0 0.0 96-97 0.05 0.025 0.0 0.0 0.0 98-99 0.05 0.025 0.0 0.0 0.0 100-101 0.05 0.025 0.0 0.0 0.0 102-103 0.0875 0.025 0.0 0.0 0.0 104-105 0.1125 0.025 0.0 0.0 0.0 106-107 0.15 0.025 0.0 0.0 0.0 108-109 0.1875 0.025 0.0 0.0 0.0 110-111 0.3375 0.025 0.0 0.0 0.0 112-113 0.425 0.025 0.0 0.0 0.0 114-115 0.425 0.025 0.0 0.0 0.0 116-117 0.425 0.025 0.0 0.0 0.0 118-119 0.4375 0.025 0.0 0.0 0.0 120-121 0.4875 0.025 0.0 0.0 0.0 122-123 0.5875 0.025 0.0 0.0 0.0 124-125 0.75 0.025 0.0 0.0 0.0 126-127 0.825 0.025 0.0 0.0 0.0 128-129 0.9 0.025 0.0 0.0 0.0 130-131 0.925 0.025 0.0 0.0 0.0 132-133 0.95 0.025 0.0 0.0 0.0 134-135 1.0375 0.025 0.0 0.0 0.0 136-137 1.075 0.025 0.0 0.0 0.0 138-139 1.2374999999999998 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAACAG 10 0.006830828 145.0 1 CCTCTGT 10 0.006830828 145.0 145 TCACCAT 10 0.006830828 145.0 9 GTAATGC 10 0.006830828 145.0 5 >>END_MODULE SRR7814938 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814938_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.215 37.0 37.0 37.0 37.0 37.0 2 35.8365 37.0 37.0 37.0 37.0 37.0 3 35.927 37.0 37.0 37.0 37.0 37.0 4 36.138 37.0 37.0 37.0 37.0 37.0 5 36.0605 37.0 37.0 37.0 37.0 37.0 6 35.965 37.0 37.0 37.0 37.0 37.0 7 35.9845 37.0 37.0 37.0 37.0 37.0 8 36.0135 37.0 37.0 37.0 37.0 37.0 9 35.968 37.0 37.0 37.0 37.0 37.0 10-14 36.033 37.0 37.0 37.0 37.0 37.0 15-19 35.9508 37.0 37.0 37.0 37.0 37.0 20-24 35.9611 37.0 37.0 37.0 37.0 37.0 25-29 35.944500000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.8882 37.0 37.0 37.0 37.0 37.0 35-39 35.8226 37.0 37.0 37.0 37.0 37.0 40-44 35.6796 37.0 37.0 37.0 37.0 37.0 45-49 35.6189 37.0 37.0 37.0 37.0 37.0 50-54 35.5521 37.0 37.0 37.0 37.0 37.0 55-59 35.3519 37.0 37.0 37.0 37.0 37.0 60-64 35.4383 37.0 37.0 37.0 37.0 37.0 65-69 35.3366 37.0 37.0 37.0 34.6 37.0 70-74 35.3387 37.0 37.0 37.0 34.6 37.0 75-79 35.2919 37.0 37.0 37.0 34.6 37.0 80-84 35.0637 37.0 37.0 37.0 25.0 37.0 85-89 35.1512 37.0 37.0 37.0 27.4 37.0 90-94 34.958099999999995 37.0 37.0 37.0 25.0 37.0 95-99 34.668099999999995 37.0 37.0 37.0 25.0 37.0 100-104 34.5828 37.0 37.0 37.0 25.0 37.0 105-109 34.543400000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.5018 37.0 37.0 37.0 25.0 37.0 115-119 34.5435 37.0 37.0 37.0 25.0 37.0 120-124 34.1533 37.0 37.0 37.0 25.0 37.0 125-129 34.296299999999995 37.0 37.0 37.0 25.0 37.0 130-134 33.847300000000004 37.0 37.0 37.0 25.0 37.0 135-139 33.7585 37.0 37.0 37.0 25.0 37.0 140-144 34.01610000000001 37.0 37.0 37.0 25.0 37.0 145-149 33.795500000000004 37.0 37.0 37.0 25.0 37.0 150-151 33.0745 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 2.0 15 6.0 16 8.0 17 4.0 18 3.0 19 2.0 20 3.0 21 3.0 22 9.0 23 7.0 24 9.0 25 19.0 26 16.0 27 13.0 28 32.0 29 25.0 30 46.0 31 90.0 32 114.0 33 212.0 34 433.0 35 1111.0 36 1785.0 37 42.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.150000000000006 16.175 9.375 28.299999999999997 2 28.65 22.05 28.849999999999998 20.45 3 25.525 23.525 26.6 24.349999999999998 4 26.450000000000003 33.525 17.075000000000003 22.95 5 26.6 32.925 18.275 22.2 6 23.05 34.025 19.3 23.625 7 23.025000000000002 16.225 35.125 25.624999999999996 8 22.85 21.05 22.8 33.300000000000004 9 24.45 21.125 25.45 28.975 10-14 26.56 24.91 22.27 26.26 15-19 26.735 24.529999999999998 23.21 25.525 20-24 26.565 24.63 23.575 25.230000000000004 25-29 26.195 24.745 23.035 26.025 30-34 26.229999999999997 25.245 23.45 25.074999999999996 35-39 26.06 24.525 23.32 26.095000000000002 40-44 26.605 24.0 23.810000000000002 25.585 45-49 26.555 23.985 23.43 26.029999999999998 50-54 25.965 24.47 23.225 26.340000000000003 55-59 26.11 25.245 23.595 25.05 60-64 26.279999999999998 24.955 23.425 25.34 65-69 26.195 24.965 23.71 25.130000000000003 70-74 26.790000000000003 25.03 23.125 25.055 75-79 26.365 24.005000000000003 23.46 26.169999999999998 80-84 26.314999999999998 24.79 23.580000000000002 25.314999999999998 85-89 26.87 24.805 22.93 25.395 90-94 26.924999999999997 24.610000000000003 23.57 24.895 95-99 26.13 25.4 23.21 25.259999999999998 100-104 26.650000000000002 24.445 23.71 25.195 105-109 26.705000000000002 24.625 23.43 25.240000000000002 110-114 26.765 25.169999999999998 23.375 24.69 115-119 26.3 24.62 23.849999999999998 25.230000000000004 120-124 27.41 24.865000000000002 23.41 24.315 125-129 26.77 25.52 23.400000000000002 24.310000000000002 130-134 27.034999999999997 24.725 23.3 24.94 135-139 27.005000000000003 24.975 23.474999999999998 24.545 140-144 26.295 24.85 23.82 25.035 145-149 27.07 25.629999999999995 23.14 24.16 150-151 26.7125 25.35 22.925 25.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.0 23 0.0 24 1.0 25 1.5 26 1.0 27 2.0 28 2.0 29 3.5 30 7.5 31 9.5 32 11.5 33 13.0 34 22.0 35 34.5 36 43.5 37 54.0 38 60.0 39 76.0 40 98.0 41 124.0 42 143.5 43 149.0 44 155.5 45 163.0 46 164.0 47 164.0 48 170.0 49 161.0 50 146.0 51 126.5 52 107.0 53 99.5 54 100.5 55 92.5 56 87.5 57 97.5 58 100.5 59 96.5 60 88.5 61 83.0 62 92.5 63 92.0 64 82.0 65 86.0 66 80.5 67 86.0 68 80.5 69 61.5 70 57.5 71 50.5 72 42.5 73 28.5 74 22.5 75 19.0 76 10.5 77 8.5 78 7.0 79 3.5 80 1.5 81 2.0 82 2.0 83 0.5 84 0.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.5 90 1.5 91 2.0 92 1.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 2.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.90593382554006 84.025 2 7.1916871752802844 13.15 3 0.7383100902378998 2.025 4 0.027344818156959255 0.1 5 0.08203445447087777 0.375 6 0.027344818156959255 0.15 7 0.027344818156959255 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCACCCTTTACACTGCATGCAAACATCGAGGTTTTGTGATGATATCTTAC 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 5 0.125 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 5 0.125 No Hit TCGGGTTCTTACATTATCATCTCAGACCCTTACTTTCTTTTCTGTTTATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.0875 0.0 0.0 0.0 0.0 104-105 0.1125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.425 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.425 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.5875 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.075 0.0 0.0 0.0 0.0 138-139 1.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGGC 10 0.006830828 145.0 5 CTGGCTA 10 0.006830828 145.0 7 GAACTGG 10 0.006830828 145.0 4 GGCTAAT 10 0.006830828 145.0 9 GGGAACT 10 0.006830828 145.0 2 GGAACTG 10 0.006830828 145.0 3 ACTGGCT 10 0.006830828 145.0 6 TGGGAAC 10 0.006830828 145.0 1 GTGGAAT 10 0.006830828 145.0 145 TGGCTAA 10 0.006830828 145.0 8 >>END_MODULE Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399148 spots for SRR7814938.sra Written 2399148 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra Read 2399131 spots for SRR7814938.sra Written 2399131 spots for SRR7814938.sra SRR ids: ['SRR7814938.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ux6u6424 SRR7814938.sra spots: 47982637 blocks: [[1, 2399131], [2399132, 4798262], [4798263, 7197393], [7197394, 9596524], [9596525, 11995655], [11995656, 14394786], [14394787, 16793917], [16793918, 19193048], [19193049, 21592179], [21592180, 23991310], [23991311, 26390441], [26390442, 28789572], [28789573, 31188703], [31188704, 33587834], [33587835, 35986965], [35986966, 38386096], [38386097, 40785227], [40785228, 43184358], [43184359, 45583489], [45583490, 47982637]] SRR7814938 file size 16238040 SRR7814938 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814938 SRR7814938_1.fastq SRR7814938_2.fastq Input file: SRR7814938_1.fastq Paired file: SRR7814938_2.fastq trimmed: SRR7814938-trimmed-pair1.fastq, SRR7814938-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 03:30:26 2024 >> started Sat Dec 7 04:09:49 2024 >> done (2362.171s) 47982637 read pairs processed; of these: 151 ( 0.00%) short read pairs filtered out after trimming by size control 4920 ( 0.01%) empty read pairs filtered out after trimming by size control 47977566 (99.99%) read pairs available; of these: 1269299 ( 2.65%) trimmed read pairs available after processing 46708267 (97.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 23 0.00% 20 20 0.00% 21 27 0.00% 22 31 0.00% 23 31 0.00% 24 37 0.00% 25 39 0.00% 26 35 0.00% 27 46 0.00% 28 36 0.00% 29 39 0.00% 30 56 0.00% 31 55 0.00% 32 59 0.00% 33 60 0.00% 34 48 0.00% 35 62 0.00% 36 59 0.00% 37 75 0.00% 38 72 0.00% 39 69 0.00% 40 60 0.00% 41 56 0.00% 42 91 0.00% 43 67 0.00% 44 64 0.00% 45 103 0.00% 46 92 0.00% 47 89 0.00% 48 107 0.00% 49 104 0.00% 50 92 0.00% 51 108 0.00% 52 127 0.00% 53 137 0.00% 54 151 0.00% 55 158 0.00% 56 170 0.00% 57 150 0.00% 58 164 0.00% 59 152 0.00% 60 186 0.00% 61 212 0.00% 62 205 0.00% 63 208 0.00% 64 234 0.00% 65 241 0.00% 66 281 0.00% 67 301 0.00% 68 346 0.00% 69 423 0.00% 70 430 0.00% 71 475 0.00% 72 506 0.00% 73 566 0.00% 74 607 0.00% 75 697 0.00% 76 737 0.00% 77 777 0.00% 78 879 0.00% 79 968 0.00% 80 1041 0.00% 81 1220 0.00% 82 1321 0.00% 83 1382 0.00% 84 1629 0.00% 85 1690 0.00% 86 1904 0.00% 87 2051 0.00% 88 2358 0.00% 89 2444 0.01% 90 2766 0.01% 91 2969 0.01% 92 3286 0.01% 93 3545 0.01% 94 3932 0.01% 95 4197 0.01% 96 4553 0.01% 97 4849 0.01% 98 4892 0.01% 99 5366 0.01% 100 5927 0.01% 101 6295 0.01% 102 6784 0.01% 103 7412 0.02% 104 7907 0.02% 105 8244 0.02% 106 8766 0.02% 107 8975 0.02% 108 9459 0.02% 109 9711 0.02% 110 10190 0.02% 111 11297 0.02% 112 11946 0.02% 113 12413 0.03% 114 13547 0.03% 115 13905 0.03% 116 14539 0.03% 117 15068 0.03% 118 15087 0.03% 119 16066 0.03% 120 16612 0.03% 121 17472 0.04% 122 18337 0.04% 123 19717 0.04% 124 20985 0.04% 125 21693 0.05% 126 22327 0.05% 127 22957 0.05% 128 23669 0.05% 129 24355 0.05% 130 24602 0.05% 131 25722 0.05% 132 27351 0.06% 133 28897 0.06% 134 29778 0.06% 135 31254 0.07% 136 32384 0.07% 137 33032 0.07% 138 34022 0.07% 139 34877 0.07% 140 35446 0.07% 141 37115 0.08% 142 38419 0.08% 143 39659 0.08% 144 42453 0.09% 145 43926 0.09% 146 45691 0.10% 147 46605 0.10% 148 47527 0.10% 149 48123 0.10% 150 50839 0.11% 151 46708267 97.35% 47977566 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=24 prefix-density=0.71 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=22.30 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.7 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=2.2 sequence=ATCCGCTCCAAGTGGGTTCCTTGCCTCGAGTTCAGCAAGGTCGGTTTCGTCTTCCGTGAGCACGGCAACTCTCCCGGGTACTACGACGGCAGGTACTGGACAATGTGGAAGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=138.18 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814938 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:15:26 Started mapping on | Dec 07 04:16:03 Finished on | Dec 07 04:22:45 Mapping speed, Million of reads per hour | 429.65 Number of input reads | 47977566 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 44578156 Uniquely mapped reads % | 92.91% Average mapped length | 299.87 Number of splices: Total | 46478627 Number of splices: Annotated (sjdb) | 43913408 Number of splices: GT/AG | 45849821 Number of splices: GC/AG | 571339 Number of splices: AT/AC | 18655 Number of splices: Non-canonical | 38812 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 530154 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 50237 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.10% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2869256 2869256 2869256 N_multimapping 530154 530154 530154 N_noFeature 1708353 43273126 2050388 N_ambiguous 1164433 7291 201242 UnstrandedReadsAssigned:41705370 PositiveStrandReadsAssigned:1297739 NegativeStrandReadsAssigned:42326526 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814938 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814938-trimmed-pair1.fastq SRR7814938-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 47,977,566 reads, 43,033,111 reads pseudoaligned [quant] estimated average fragment length: 321.29 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR7814938.ke.tsv 35125 SRR7814938.se.tsv 88098 total ==> SRR7814938.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 616.423 0 0 PNS24247 1044 723.71 182.587 7.8887 PNS24249 1928 1607.71 198.378 3.85821 PNS24246 1044 723.71 182.587 7.8887 PNS24248 1044 723.71 182.587 7.8887 PNS24244 1471 1150.71 253.86 6.89806 PNS24243 293 72.6227 0 0 KQK14069 1603 1282.71 3965.12 96.6555 KQK14071 474 193.729 37.6223 6.07226 ==> SRR7814938.se.tsv <== BRADI_1g14170v3 4133 BRADI_1g53295v3 342 BRADI_1g59795v3 2156 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 333 BRADI_1g74790v3 379 BRADI_1g09890v3 0 BRADI_1g77505v3 591 BRADI_1g48960v3 0 SRR7814938 completed mapping pipeline successfully