Starting /dee2/code/volunteer_pipeline.sh SRR7814939 current disk space = 1547662270464 free memory = 1604607500 SRR7814939 SRAfilesize 11eaa2ca5fce2bfe785366a5e4f697d5 SRR7814939.sra SRR7814939.sra file validated SRR7814939 is paired end SRR7814939 is conventional basespace SRR7814939 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814939_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32525 37.0 37.0 37.0 37.0 37.0 2 36.2945 37.0 37.0 37.0 37.0 37.0 3 36.4405 37.0 37.0 37.0 37.0 37.0 4 36.5765 37.0 37.0 37.0 37.0 37.0 5 36.5035 37.0 37.0 37.0 37.0 37.0 6 36.4635 37.0 37.0 37.0 37.0 37.0 7 36.527 37.0 37.0 37.0 37.0 37.0 8 36.532 37.0 37.0 37.0 37.0 37.0 9 36.6445 37.0 37.0 37.0 37.0 37.0 10-14 36.5458 37.0 37.0 37.0 37.0 37.0 15-19 36.535199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.486599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.447100000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5053 37.0 37.0 37.0 37.0 37.0 35-39 36.4627 37.0 37.0 37.0 37.0 37.0 40-44 36.3952 37.0 37.0 37.0 37.0 37.0 45-49 36.3942 37.0 37.0 37.0 37.0 37.0 50-54 36.3469 37.0 37.0 37.0 37.0 37.0 55-59 36.290299999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2675 37.0 37.0 37.0 37.0 37.0 65-69 36.235499999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2233 37.0 37.0 37.0 37.0 37.0 75-79 36.217 37.0 37.0 37.0 37.0 37.0 80-84 36.1703 37.0 37.0 37.0 37.0 37.0 85-89 36.1145 37.0 37.0 37.0 37.0 37.0 90-94 36.0594 37.0 37.0 37.0 37.0 37.0 95-99 36.0113 37.0 37.0 37.0 37.0 37.0 100-104 35.9621 37.0 37.0 37.0 37.0 37.0 105-109 35.983399999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9826 37.0 37.0 37.0 37.0 37.0 115-119 35.9185 37.0 37.0 37.0 37.0 37.0 120-124 35.7727 37.0 37.0 37.0 37.0 37.0 125-129 35.686600000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.67139999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.673700000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.5809 37.0 37.0 37.0 37.0 37.0 145-149 35.5002 37.0 37.0 37.0 37.0 37.0 150-151 34.64 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 3.0 25 3.0 26 6.0 27 8.0 28 12.0 29 19.0 30 24.0 31 43.0 32 55.0 33 84.0 34 158.0 35 428.0 36 2887.0 37 266.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.54077791718946 12.020075282308659 10.81555834378921 39.623588456712675 2 23.35 17.424999999999997 35.975 23.25 3 22.575 21.55 23.35 32.525 4 28.449999999999996 29.799999999999997 19.375 22.375 5 25.55 32.675 21.6 20.175 6 20.674999999999997 34.075 24.025 21.224999999999998 7 16.125 21.0 40.425 22.45 8 21.4 20.9 27.875 29.825000000000003 9 20.575 21.275 31.025000000000002 27.125 10-14 23.669999999999998 26.275 23.905 26.150000000000002 15-19 23.51 25.615 25.06 25.814999999999998 20-24 24.154999999999998 24.95 24.695 26.200000000000003 25-29 23.91 25.47 24.555 26.064999999999998 30-34 23.22 25.025 25.44 26.314999999999998 35-39 23.575 24.765 25.205 26.455000000000002 40-44 23.615 25.415 24.515 26.455000000000002 45-49 24.145 25.240000000000002 24.15 26.465 50-54 23.735 25.235000000000003 24.73 26.3 55-59 23.665 25.665 24.465 26.205000000000002 60-64 23.89 25.235000000000003 24.035 26.840000000000003 65-69 24.099999999999998 25.985000000000003 23.935000000000002 25.979999999999997 70-74 24.474999999999998 25.319999999999997 24.05 26.155 75-79 24.37 24.875 24.5 26.255 80-84 24.36 23.919999999999998 25.0 26.72 85-89 24.529999999999998 24.52 24.515 26.435 90-94 24.545 24.69 24.560000000000002 26.205000000000002 95-99 24.11 24.725 24.295 26.87 100-104 24.485 24.474999999999998 25.064999999999998 25.974999999999998 105-109 24.585 25.290000000000003 23.835 26.290000000000003 110-114 24.63 24.395 24.93 26.045 115-119 24.97 23.84 24.365000000000002 26.825 120-124 24.224999999999998 25.3 23.94 26.534999999999997 125-129 24.41 24.595 24.325 26.669999999999998 130-134 25.165 24.38 24.315 26.14 135-139 24.5 24.335 24.46 26.705000000000002 140-144 25.745 24.095 24.12 26.040000000000003 145-149 25.119999999999997 24.099999999999998 23.935000000000002 26.845000000000002 150-151 24.6125 24.1875 24.0625 27.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.5 28 2.5 29 1.5 30 6.5 31 10.0 32 9.5 33 13.0 34 21.5 35 31.5 36 41.0 37 53.5 38 75.5 39 96.5 40 105.0 41 124.0 42 150.0 43 163.5 44 171.5 45 187.0 46 200.0 47 195.5 48 170.0 49 172.5 50 179.0 51 161.0 52 163.5 53 151.5 54 130.5 55 110.0 56 99.5 57 100.0 58 75.0 59 59.0 60 63.5 61 63.0 62 62.5 63 69.5 64 73.0 65 66.0 66 59.0 67 55.0 68 52.0 69 45.0 70 35.5 71 30.0 72 27.5 73 19.5 74 12.5 75 10.5 76 6.0 77 4.5 78 5.0 79 2.5 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.25 #Duplication Level Percentage of deduplicated Percentage of total 1 90.22160664819945 81.425 2 8.753462603878116 15.8 3 1.0249307479224377 2.775 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7875000000000001 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1124999999999998 0.0 0.0 0.0 0.0 126-127 1.2000000000000002 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.7625 0.0 0.0 0.0 0.0 136-137 1.9249999999999998 0.0 0.0 0.0 0.0 138-139 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTCTT 10 0.006830828 145.0 1 >>END_MODULE SRR7814939 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814939_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.04 37.0 37.0 37.0 37.0 37.0 2 35.6865 37.0 37.0 37.0 37.0 37.0 3 35.8 37.0 37.0 37.0 37.0 37.0 4 36.0525 37.0 37.0 37.0 37.0 37.0 5 36.1805 37.0 37.0 37.0 37.0 37.0 6 35.992 37.0 37.0 37.0 37.0 37.0 7 35.7495 37.0 37.0 37.0 37.0 37.0 8 35.9045 37.0 37.0 37.0 37.0 37.0 9 35.939 37.0 37.0 37.0 37.0 37.0 10-14 36.0381 37.0 37.0 37.0 37.0 37.0 15-19 35.9543 37.0 37.0 37.0 37.0 37.0 20-24 35.9597 37.0 37.0 37.0 37.0 37.0 25-29 35.9089 37.0 37.0 37.0 37.0 37.0 30-34 35.88340000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.7818 37.0 37.0 37.0 37.0 37.0 40-44 35.67389999999999 37.0 37.0 37.0 37.0 37.0 45-49 35.6358 37.0 37.0 37.0 37.0 37.0 50-54 35.4033 37.0 37.0 37.0 34.6 37.0 55-59 35.3201 37.0 37.0 37.0 34.6 37.0 60-64 35.3019 37.0 37.0 37.0 32.2 37.0 65-69 35.261700000000005 37.0 37.0 37.0 29.8 37.0 70-74 35.1553 37.0 37.0 37.0 27.4 37.0 75-79 34.974199999999996 37.0 37.0 37.0 25.0 37.0 80-84 34.965500000000006 37.0 37.0 37.0 25.0 37.0 85-89 34.9263 37.0 37.0 37.0 25.0 37.0 90-94 34.6564 37.0 37.0 37.0 25.0 37.0 95-99 34.351099999999995 37.0 37.0 37.0 25.0 37.0 100-104 34.4194 37.0 37.0 37.0 25.0 37.0 105-109 34.185500000000005 37.0 37.0 37.0 25.0 37.0 110-114 34.203900000000004 37.0 37.0 37.0 25.0 37.0 115-119 34.2491 37.0 37.0 37.0 25.0 37.0 120-124 33.962 37.0 37.0 37.0 25.0 37.0 125-129 34.1315 37.0 37.0 37.0 25.0 37.0 130-134 33.493700000000004 37.0 37.0 37.0 25.0 37.0 135-139 33.5026 37.0 37.0 37.0 22.2 37.0 140-144 33.733700000000006 37.0 37.0 37.0 25.0 37.0 145-149 33.425200000000004 37.0 37.0 37.0 25.0 37.0 150-151 32.8705 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 3.0 15 8.0 16 4.0 17 1.0 18 0.0 19 0.0 20 0.0 21 3.0 22 4.0 23 11.0 24 8.0 25 10.0 26 13.0 27 24.0 28 27.0 29 42.0 30 65.0 31 97.0 32 141.0 33 288.0 34 561.0 35 1177.0 36 1480.0 37 28.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.925 13.975000000000001 12.7 35.4 2 27.725 22.125 30.15 20.0 3 24.474999999999998 23.325000000000003 25.775 26.424999999999997 4 29.2 31.175000000000004 17.275 22.35 5 29.975 31.275 17.2 21.55 6 21.099999999999998 33.875 20.5 24.525 7 22.025 15.075 37.824999999999996 25.074999999999996 8 24.2 19.650000000000002 22.375 33.775 9 25.25 21.5 24.85 28.4 10-14 25.94 25.4 22.470000000000002 26.19 15-19 26.900000000000002 24.404999999999998 23.01 25.685000000000002 20-24 26.205000000000002 24.615000000000002 23.380000000000003 25.8 25-29 27.029999999999998 24.355 23.095 25.52 30-34 25.95 25.014999999999997 22.84 26.195 35-39 25.605 25.005 23.685000000000002 25.705 40-44 26.529999999999998 24.505 23.200000000000003 25.765 45-49 26.36 24.224999999999998 23.29 26.125 50-54 26.47 25.03 23.04 25.46 55-59 26.484999999999996 24.975 23.380000000000003 25.16 60-64 26.69 24.305 23.880000000000003 25.124999999999996 65-69 26.26 24.63 23.919999999999998 25.19 70-74 27.215 24.15 23.235 25.4 75-79 27.439999999999998 24.12 24.01 24.43 80-84 27.505000000000003 24.805 23.285 24.404999999999998 85-89 26.85 24.72 23.175 25.255 90-94 26.650000000000002 24.349999999999998 23.755000000000003 25.245 95-99 27.04 24.67 23.330000000000002 24.959999999999997 100-104 27.36 24.035 23.345 25.259999999999998 105-109 27.395000000000003 24.97 23.200000000000003 24.435000000000002 110-114 27.32 24.75 22.91 25.019999999999996 115-119 28.015 24.77 22.88 24.335 120-124 27.01 24.82 23.32 24.85 125-129 27.169999999999998 25.255 22.99 24.585 130-134 27.075 25.195 23.135 24.595 135-139 26.955000000000002 24.310000000000002 23.575 25.16 140-144 27.01 25.11 23.200000000000003 24.68 145-149 27.435 24.395 23.445 24.725 150-151 28.075 23.6125 23.962500000000002 24.349999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 2.5 27 3.5 28 2.0 29 1.5 30 4.0 31 7.0 32 8.0 33 8.0 34 14.5 35 23.5 36 27.5 37 38.5 38 61.0 39 80.5 40 95.0 41 114.0 42 132.5 43 157.0 44 172.0 45 159.0 46 173.5 47 180.0 48 165.0 49 157.5 50 151.5 51 147.0 52 122.0 53 123.0 54 124.5 55 97.5 56 79.5 57 103.0 58 111.0 59 85.5 60 85.0 61 91.0 62 87.5 63 76.0 64 77.5 65 82.5 66 83.0 67 81.0 68 74.0 69 66.5 70 50.0 71 40.5 72 33.0 73 26.5 74 23.5 75 16.0 76 14.0 77 13.5 78 8.0 79 6.0 80 5.0 81 2.0 82 1.5 83 2.5 84 2.0 85 0.5 86 1.0 87 0.5 88 0.5 89 0.5 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.525 #Duplication Level Percentage of deduplicated Percentage of total 1 90.72079536039767 82.125 2 8.174537420602043 14.799999999999999 3 1.0494338580502625 2.85 4 0.027616680475006903 0.1 5 0.027616680475006903 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5375 0.0 0.0 0.0 0.0 116-117 0.6499999999999999 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.25 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.375 0.0 0.0 0.0 0.0 132-133 1.45 0.0 0.0 0.0 0.0 134-135 1.7375 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.1500000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCAAG 10 0.006830828 145.0 6 GACATCC 10 0.006830828 145.0 3 >>END_MODULE Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135571 spots for SRR7814939.sra Written 2135571 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Read 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra Written 2135562 spots for SRR7814939.sra SRR ids: ['SRR7814939.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q4lsmdhw SRR7814939.sra spots: 42711249 blocks: [[1, 2135562], [2135563, 4271124], [4271125, 6406686], [6406687, 8542248], [8542249, 10677810], [10677811, 12813372], [12813373, 14948934], [14948935, 17084496], [17084497, 19220058], [19220059, 21355620], [21355621, 23491182], [23491183, 25626744], [25626745, 27762306], [27762307, 29897868], [29897869, 32033430], [32033431, 34168992], [34168993, 36304554], [36304555, 38440116], [38440117, 40575678], [40575679, 42711249]] SRR7814939 file size 14451740 SRR7814939 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814939 SRR7814939_1.fastq SRR7814939_2.fastq Input file: SRR7814939_1.fastq Paired file: SRR7814939_2.fastq trimmed: SRR7814939-trimmed-pair1.fastq, SRR7814939-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 03:30:17 2024 >> started Sat Dec 7 04:05:50 2024 >> done (2133.715s) 42711249 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 3111 ( 0.01%) empty read pairs filtered out after trimming by size control 42708025 (99.99%) read pairs available; of these: 1264183 ( 2.96%) trimmed read pairs available after processing 41443842 (97.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 19 0.00% 20 24 0.00% 21 38 0.00% 22 31 0.00% 23 41 0.00% 24 32 0.00% 25 48 0.00% 26 51 0.00% 27 56 0.00% 28 76 0.00% 29 51 0.00% 30 67 0.00% 31 72 0.00% 32 89 0.00% 33 84 0.00% 34 64 0.00% 35 94 0.00% 36 81 0.00% 37 97 0.00% 38 105 0.00% 39 108 0.00% 40 100 0.00% 41 95 0.00% 42 98 0.00% 43 106 0.00% 44 109 0.00% 45 149 0.00% 46 143 0.00% 47 114 0.00% 48 135 0.00% 49 139 0.00% 50 170 0.00% 51 135 0.00% 52 166 0.00% 53 165 0.00% 54 194 0.00% 55 193 0.00% 56 210 0.00% 57 177 0.00% 58 214 0.00% 59 225 0.00% 60 230 0.00% 61 256 0.00% 62 254 0.00% 63 259 0.00% 64 256 0.00% 65 273 0.00% 66 304 0.00% 67 328 0.00% 68 360 0.00% 69 387 0.00% 70 406 0.00% 71 434 0.00% 72 529 0.00% 73 519 0.00% 74 503 0.00% 75 582 0.00% 76 644 0.00% 77 754 0.00% 78 767 0.00% 79 885 0.00% 80 923 0.00% 81 1046 0.00% 82 1166 0.00% 83 1219 0.00% 84 1391 0.00% 85 1504 0.00% 86 1672 0.00% 87 1843 0.00% 88 2016 0.00% 89 2257 0.01% 90 2367 0.01% 91 2615 0.01% 92 2887 0.01% 93 3095 0.01% 94 3360 0.01% 95 3713 0.01% 96 4026 0.01% 97 4393 0.01% 98 4597 0.01% 99 4917 0.01% 100 5383 0.01% 101 5702 0.01% 102 6243 0.01% 103 6728 0.02% 104 7065 0.02% 105 7588 0.02% 106 8253 0.02% 107 8267 0.02% 108 8966 0.02% 109 9610 0.02% 110 9803 0.02% 111 10716 0.03% 112 11507 0.03% 113 11965 0.03% 114 12547 0.03% 115 13530 0.03% 116 14043 0.03% 117 14530 0.03% 118 15129 0.04% 119 15866 0.04% 120 16642 0.04% 121 17586 0.04% 122 18435 0.04% 123 19584 0.05% 124 20325 0.05% 125 21034 0.05% 126 22181 0.05% 127 23059 0.05% 128 23555 0.06% 129 24618 0.06% 130 25307 0.06% 131 26565 0.06% 132 27630 0.06% 133 28774 0.07% 134 30189 0.07% 135 31123 0.07% 136 32759 0.08% 137 33430 0.08% 138 34831 0.08% 139 35791 0.08% 140 36096 0.08% 141 38297 0.09% 142 39560 0.09% 143 40796 0.10% 144 42486 0.10% 145 44071 0.10% 146 45918 0.11% 147 46708 0.11% 148 48080 0.11% 149 49363 0.12% 150 51633 0.12% 151 41443842 97.04% 42708025 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=3.2 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=267.00 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=24.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=26 prefix-density=0.47 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=536.32 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=21.7 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814939 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:10:38 Started mapping on | Dec 07 04:10:38 Finished on | Dec 07 04:16:19 Mapping speed, Million of reads per hour | 450.88 Number of input reads | 42708025 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 40323691 Uniquely mapped reads % | 94.42% Average mapped length | 299.82 Number of splices: Total | 40068460 Number of splices: Annotated (sjdb) | 37576486 Number of splices: GT/AG | 39554863 Number of splices: GC/AG | 455169 Number of splices: AT/AC | 25166 Number of splices: Non-canonical | 33262 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 448246 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 54930 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1936088 1936088 1936088 N_multimapping 448246 448246 448246 N_noFeature 1042466 39292673 1357915 N_ambiguous 834284 6178 119737 UnstrandedReadsAssigned:38446941 PositiveStrandReadsAssigned:1024840 NegativeStrandReadsAssigned:38846039 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814939 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814939-trimmed-pair1.fastq SRR7814939-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,708,025 reads, 39,571,055 reads pseudoaligned [quant] estimated average fragment length: 307.583 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,295 rounds 52973 SRR7814939.ke.tsv 35125 SRR7814939.se.tsv 88098 total ==> SRR7814939.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 630.152 0 0 PNS24247 1044 737.417 238.595 11.0615 PNS24249 1928 1621.42 377.933 7.96866 PNS24246 1044 737.417 238.595 11.0615 PNS24248 1044 737.417 238.595 11.0615 PNS24244 1471 1164.42 470.281 13.8075 PNS24243 293 72.7604 0 0 KQK14069 1603 1296.42 12644 333.43 KQK14071 474 198.425 311.231 53.623 ==> SRR7814939.se.tsv <== BRADI_1g14170v3 14291 BRADI_1g53295v3 355 BRADI_1g59795v3 637 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 3848 BRADI_1g74790v3 337 BRADI_1g09890v3 0 BRADI_1g77505v3 353 BRADI_1g48960v3 0 SRR7814939 completed mapping pipeline successfully