Starting /dee2/code/volunteer_pipeline.sh SRR7814940 current disk space = 1547649654784 free memory = 1604612580 SRR7814940 SRAfilesize d6507aec198d2971893ee26399992a7e SRR7814940.sra SRR7814940.sra file validated SRR7814940 is paired end SRR7814940 is conventional basespace SRR7814940 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814940_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3335 37.0 37.0 37.0 37.0 37.0 2 36.288 37.0 37.0 37.0 37.0 37.0 3 36.511 37.0 37.0 37.0 37.0 37.0 4 36.5065 37.0 37.0 37.0 37.0 37.0 5 36.5655 37.0 37.0 37.0 37.0 37.0 6 36.4615 37.0 37.0 37.0 37.0 37.0 7 36.44 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.5885 37.0 37.0 37.0 37.0 37.0 10-14 36.5825 37.0 37.0 37.0 37.0 37.0 15-19 36.5338 37.0 37.0 37.0 37.0 37.0 20-24 36.505399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.475899999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.505399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.42280000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.4423 37.0 37.0 37.0 37.0 37.0 45-49 36.361599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.342200000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.369099999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2913 37.0 37.0 37.0 37.0 37.0 65-69 36.2537 37.0 37.0 37.0 37.0 37.0 70-74 36.293800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.209900000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.1923 37.0 37.0 37.0 37.0 37.0 85-89 36.1363 37.0 37.0 37.0 37.0 37.0 90-94 36.069199999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1055 37.0 37.0 37.0 37.0 37.0 100-104 36.027499999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.009499999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.9948 37.0 37.0 37.0 37.0 37.0 115-119 35.892199999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.832 37.0 37.0 37.0 37.0 37.0 125-129 35.69859999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.720600000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.7097 37.0 37.0 37.0 37.0 37.0 140-144 35.599199999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.5789 37.0 37.0 37.0 37.0 37.0 150-151 34.705749999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 2.0 25 1.0 26 4.0 27 12.0 28 15.0 29 20.0 30 23.0 31 40.0 32 60.0 33 79.0 34 147.0 35 414.0 36 2923.0 37 259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.82957393483709 13.55889724310777 7.894736842105263 36.716791979949875 2 22.3 17.424999999999997 36.625 23.65 3 22.325 24.325 22.1 31.25 4 27.250000000000004 31.324999999999996 19.475 21.95 5 25.174999999999997 33.6 22.575 18.65 6 19.900000000000002 34.125 23.9 22.075 7 17.175 19.225 42.725 20.875 8 20.200000000000003 19.925 28.225 31.65 9 20.575 21.224999999999998 30.9 27.3 10-14 22.564999999999998 26.35 25.05 26.035000000000004 15-19 23.535 25.995 25.474999999999998 24.995 20-24 23.330000000000002 25.025 25.679999999999996 25.965 25-29 23.244999999999997 25.0 25.885 25.869999999999997 30-34 23.135 25.89 24.935 26.040000000000003 35-39 23.175 25.455 25.259999999999998 26.11 40-44 23.1 25.124999999999996 24.915000000000003 26.86 45-49 23.330000000000002 26.064999999999998 24.759999999999998 25.845000000000002 50-54 23.985 25.264999999999997 24.935 25.814999999999998 55-59 23.595 25.36 25.035 26.009999999999998 60-64 23.72 25.119999999999997 25.055 26.105 65-69 23.13 25.27 25.130000000000003 26.47 70-74 23.69 24.36 25.295 26.655 75-79 23.27 25.35 24.635 26.745 80-84 23.885 25.03 24.785 26.3 85-89 24.025 24.84 25.314999999999998 25.82 90-94 23.315 24.565 25.585 26.534999999999997 95-99 23.86 25.169999999999998 24.8 26.169999999999998 100-104 23.885 25.474999999999998 24.85 25.790000000000003 105-109 24.345 25.35 24.065 26.240000000000002 110-114 23.945 24.955 24.755 26.345000000000002 115-119 24.535 24.610000000000003 25.119999999999997 25.735000000000003 120-124 24.310000000000002 24.695 24.66 26.334999999999997 125-129 24.035 25.005 24.86 26.1 130-134 24.044999999999998 24.959999999999997 24.349999999999998 26.645000000000003 135-139 24.08 24.625 24.23 27.065 140-144 23.905 24.79 24.85 26.455000000000002 145-149 24.495 24.865000000000002 24.465 26.174999999999997 150-151 24.025 24.337500000000002 24.8625 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.0 26 2.5 27 2.0 28 1.5 29 4.5 30 11.0 31 14.0 32 16.0 33 21.0 34 25.0 35 33.0 36 44.5 37 63.5 38 78.0 39 88.5 40 119.5 41 151.5 42 168.5 43 176.0 44 197.0 45 210.0 46 199.0 47 184.5 48 180.5 49 173.0 50 156.0 51 152.0 52 141.5 53 126.5 54 114.0 55 102.0 56 103.5 57 92.0 58 74.0 59 65.5 60 60.0 61 61.5 62 62.0 63 65.5 64 64.5 65 61.5 66 57.5 67 46.0 68 39.0 69 45.5 70 40.5 71 24.0 72 16.5 73 15.0 74 13.5 75 9.0 76 5.0 77 5.5 78 6.0 79 3.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.0 #Duplication Level Percentage of deduplicated Percentage of total 1 91.15384615384615 82.95 2 7.829670329670329 14.249999999999998 3 0.9890109890109889 2.7 4 0.027472527472527472 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.7875000000000001 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.0 0.0 0.0 0.0 0.0 128-129 1.225 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.4375 0.0 0.0 0.0 0.0 134-135 1.6 0.0 0.0 0.0 0.0 136-137 1.8 0.0 0.0 0.0 0.0 138-139 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTATTG 10 0.006830828 145.0 2 GCCTATT 10 0.006830828 145.0 1 GGCGACA 10 0.006830828 145.0 1 TAGTCAT 10 0.006830828 145.0 145 GGAAAAG 10 0.006830828 145.0 1 >>END_MODULE SRR7814940 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814940_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3125 37.0 37.0 37.0 37.0 37.0 2 36.0245 37.0 37.0 37.0 37.0 37.0 3 36.08 37.0 37.0 37.0 37.0 37.0 4 36.132 37.0 37.0 37.0 37.0 37.0 5 36.2435 37.0 37.0 37.0 37.0 37.0 6 36.141 37.0 37.0 37.0 37.0 37.0 7 36.038 37.0 37.0 37.0 37.0 37.0 8 36.164 37.0 37.0 37.0 37.0 37.0 9 36.129 37.0 37.0 37.0 37.0 37.0 10-14 36.0738 37.0 37.0 37.0 37.0 37.0 15-19 36.0119 37.0 37.0 37.0 37.0 37.0 20-24 35.9617 37.0 37.0 37.0 37.0 37.0 25-29 35.9613 37.0 37.0 37.0 37.0 37.0 30-34 35.934799999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.8599 37.0 37.0 37.0 37.0 37.0 40-44 35.7955 37.0 37.0 37.0 37.0 37.0 45-49 35.7615 37.0 37.0 37.0 37.0 37.0 50-54 35.6143 37.0 37.0 37.0 37.0 37.0 55-59 35.5245 37.0 37.0 37.0 37.0 37.0 60-64 35.4974 37.0 37.0 37.0 37.0 37.0 65-69 35.410199999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.379599999999996 37.0 37.0 37.0 34.6 37.0 75-79 35.313399999999994 37.0 37.0 37.0 34.6 37.0 80-84 35.1758 37.0 37.0 37.0 27.4 37.0 85-89 35.264 37.0 37.0 37.0 34.6 37.0 90-94 35.16709999999999 37.0 37.0 37.0 27.4 37.0 95-99 34.689800000000005 37.0 37.0 37.0 25.0 37.0 100-104 34.7305 37.0 37.0 37.0 25.0 37.0 105-109 34.5614 37.0 37.0 37.0 25.0 37.0 110-114 34.5952 37.0 37.0 37.0 25.0 37.0 115-119 34.677800000000005 37.0 37.0 37.0 25.0 37.0 120-124 34.330499999999994 37.0 37.0 37.0 25.0 37.0 125-129 34.3824 37.0 37.0 37.0 25.0 37.0 130-134 33.953900000000004 37.0 37.0 37.0 25.0 37.0 135-139 33.8835 37.0 37.0 37.0 25.0 37.0 140-144 34.1528 37.0 37.0 37.0 25.0 37.0 145-149 33.8857 37.0 37.0 37.0 25.0 37.0 150-151 33.2145 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 10.0 15 4.0 16 7.0 17 3.0 18 2.0 19 2.0 20 2.0 21 3.0 22 5.0 23 9.0 24 3.0 25 8.0 26 13.0 27 16.0 28 21.0 29 36.0 30 55.0 31 80.0 32 105.0 33 201.0 34 399.0 35 1066.0 36 1909.0 37 35.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.1 14.674999999999999 10.274999999999999 32.95 2 28.299999999999997 21.525 30.225 19.950000000000003 3 24.224999999999998 22.85 27.425 25.5 4 27.85 31.1 19.45 21.6 5 29.15 31.674999999999997 18.375 20.8 6 20.825 36.425000000000004 18.75 24.0 7 21.325 16.900000000000002 37.125 24.65 8 24.175 20.375 23.474999999999998 31.974999999999998 9 25.7 21.725 24.725 27.85 10-14 25.745 25.465 23.080000000000002 25.71 15-19 26.674999999999997 25.040000000000003 24.0 24.285 20-24 26.090000000000003 24.52 24.415 24.975 25-29 25.729999999999997 25.365 24.099999999999998 24.805 30-34 26.240000000000002 24.385 24.085 25.290000000000003 35-39 26.075 24.59 23.87 25.465 40-44 26.055 24.845 23.73 25.369999999999997 45-49 26.355 24.485 24.185000000000002 24.975 50-54 26.045 24.605 23.715 25.635 55-59 27.195000000000004 24.79 23.400000000000002 24.615000000000002 60-64 26.484999999999996 24.834999999999997 24.145 24.535 65-69 26.31 25.005 23.865 24.82 70-74 26.91 25.019999999999996 24.095 23.974999999999998 75-79 26.834999999999997 24.9 23.635 24.63 80-84 26.640000000000004 24.775 23.945 24.64 85-89 27.58 24.55 23.555 24.315 90-94 26.369999999999997 24.745 23.925 24.959999999999997 95-99 26.68 25.165 23.810000000000002 24.345 100-104 26.729999999999997 24.86 24.165 24.245 105-109 26.729999999999997 25.035 23.9 24.335 110-114 26.935 24.555 24.19 24.32 115-119 26.495 25.019999999999996 24.26 24.224999999999998 120-124 27.26 25.11 23.400000000000002 24.23 125-129 27.0 25.319999999999997 23.79 23.89 130-134 27.6 24.610000000000003 24.215 23.575 135-139 26.779999999999998 25.25 23.96 24.01 140-144 26.939999999999998 25.14 24.15 23.77 145-149 27.134999999999998 25.290000000000003 24.03 23.544999999999998 150-151 28.1125 24.8625 23.9 23.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 1.5 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 1.0 27 1.0 28 3.0 29 5.0 30 5.5 31 8.5 32 10.0 33 13.0 34 20.5 35 32.0 36 38.5 37 47.5 38 73.0 39 97.0 40 108.5 41 119.0 42 141.5 43 148.5 44 154.5 45 165.0 46 157.5 47 166.5 48 188.5 49 170.0 50 147.0 51 154.0 52 149.0 53 115.0 54 107.0 55 115.5 56 101.5 57 100.5 58 93.0 59 80.0 60 76.5 61 76.0 62 83.5 63 79.5 64 68.5 65 73.0 66 78.0 67 66.5 68 62.5 69 61.0 70 48.5 71 35.5 72 25.5 73 24.5 74 21.5 75 19.5 76 15.0 77 7.0 78 5.5 79 4.0 80 2.0 81 1.0 82 0.0 83 0.5 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.5 90 1.5 91 1.5 92 1.5 93 1.0 94 1.0 95 1.0 96 0.5 97 1.0 98 0.5 99 1.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.3175303197354 82.825 2 7.497243660418963 13.600000000000001 3 0.9922822491730982 2.7 4 0.11025358324145534 0.4 5 0.0 0.0 6 0.05512679162072767 0.3 7 0.027563395810363836 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit ATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCAT 6 0.15 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.1625 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6625000000000001 0.0 0.0 0.0 0.0 122-123 0.7124999999999999 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.2000000000000002 0.0 0.0 0.0 0.0 132-133 1.375 0.0 0.0 0.0 0.0 134-135 1.55 0.0 0.0 0.0 0.0 136-137 1.75 0.0 0.0 0.0 0.0 138-139 1.9500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGTTG 10 0.006830828 145.0 4 TGATCCT 10 0.006830828 145.0 9 GTTTCCC 10 0.006830828 145.0 145 GACTGTT 10 0.006830828 145.0 3 TACCTGC 10 0.006830828 145.0 3 AGACTGT 10 0.006830828 145.0 2 CTGTTGA 10 0.006830828 145.0 5 >>END_MODULE Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra Read 2110099 spots for SRR7814940.sra Written 2110099 spots for SRR7814940.sra SRR ids: ['SRR7814940.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8rwq4kqu SRR7814940.sra spots: 42201980 blocks: [[1, 2110099], [2110100, 4220198], [4220199, 6330297], [6330298, 8440396], [8440397, 10550495], [10550496, 12660594], [12660595, 14770693], [14770694, 16880792], [16880793, 18990891], [18990892, 21100990], [21100991, 23211089], [23211090, 25321188], [25321189, 27431287], [27431288, 29541386], [29541387, 31651485], [31651486, 33761584], [33761585, 35871683], [35871684, 37981782], [37981783, 40091881], [40091882, 42201980]] SRR7814940 file size 14279165 SRR7814940 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814940 SRR7814940_1.fastq SRR7814940_2.fastq Input file: SRR7814940_1.fastq Paired file: SRR7814940_2.fastq trimmed: SRR7814940-trimmed-pair1.fastq, SRR7814940-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:09:18 2024 >> started Sat Dec 7 04:35:34 2024 >> done (1576.539s) 42201980 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 2814 ( 0.01%) empty read pairs filtered out after trimming by size control 42199056 (99.99%) read pairs available; of these: 1309616 ( 3.10%) trimmed read pairs available after processing 40889440 (96.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 17 0.00% 20 14 0.00% 21 22 0.00% 22 16 0.00% 23 24 0.00% 24 23 0.00% 25 26 0.00% 26 27 0.00% 27 28 0.00% 28 28 0.00% 29 33 0.00% 30 33 0.00% 31 43 0.00% 32 54 0.00% 33 51 0.00% 34 55 0.00% 35 54 0.00% 36 61 0.00% 37 64 0.00% 38 61 0.00% 39 79 0.00% 40 67 0.00% 41 52 0.00% 42 74 0.00% 43 80 0.00% 44 81 0.00% 45 76 0.00% 46 83 0.00% 47 86 0.00% 48 103 0.00% 49 109 0.00% 50 107 0.00% 51 120 0.00% 52 122 0.00% 53 138 0.00% 54 137 0.00% 55 136 0.00% 56 151 0.00% 57 156 0.00% 58 172 0.00% 59 184 0.00% 60 235 0.00% 61 218 0.00% 62 247 0.00% 63 226 0.00% 64 243 0.00% 65 256 0.00% 66 267 0.00% 67 323 0.00% 68 353 0.00% 69 367 0.00% 70 432 0.00% 71 465 0.00% 72 525 0.00% 73 578 0.00% 74 560 0.00% 75 680 0.00% 76 703 0.00% 77 752 0.00% 78 821 0.00% 79 957 0.00% 80 1026 0.00% 81 1144 0.00% 82 1293 0.00% 83 1474 0.00% 84 1554 0.00% 85 1717 0.00% 86 1992 0.00% 87 2122 0.01% 88 2309 0.01% 89 2473 0.01% 90 2663 0.01% 91 3164 0.01% 92 3230 0.01% 93 3674 0.01% 94 4017 0.01% 95 4284 0.01% 96 4535 0.01% 97 4905 0.01% 98 5096 0.01% 99 5587 0.01% 100 5841 0.01% 101 6418 0.02% 102 7007 0.02% 103 7197 0.02% 104 7845 0.02% 105 8324 0.02% 106 8850 0.02% 107 9326 0.02% 108 9812 0.02% 109 10426 0.02% 110 10859 0.03% 111 11342 0.03% 112 11946 0.03% 113 12866 0.03% 114 13648 0.03% 115 14298 0.03% 116 14938 0.04% 117 15384 0.04% 118 16144 0.04% 119 16887 0.04% 120 17230 0.04% 121 18353 0.04% 122 19194 0.05% 123 20084 0.05% 124 20926 0.05% 125 22273 0.05% 126 23046 0.05% 127 23586 0.06% 128 24274 0.06% 129 25269 0.06% 130 26189 0.06% 131 27065 0.06% 132 28555 0.07% 133 29882 0.07% 134 30562 0.07% 135 32080 0.08% 136 33542 0.08% 137 34079 0.08% 138 35237 0.08% 139 36431 0.09% 140 37358 0.09% 141 38923 0.09% 142 40079 0.09% 143 40935 0.10% 144 42970 0.10% 145 45071 0.11% 146 47057 0.11% 147 47534 0.11% 148 49213 0.12% 149 49612 0.12% 150 53116 0.13% 151 40889440 96.90% 42199056 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=29 prefix-density=0.51 prefix-fanout=2.9 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=256.59 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=22.6 sequence=ATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGAACGAAGTTGGTGGCAAAGGCCCACGCGTTGTTGTTGACGGGGTCGGCAAGGTGGTCAGCGAGGTTCTCAAGGGGACCCTTGCCGGTGAC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=33 prefix-density=0.33 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=134.03 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=19.4 sequence=GCCGCCGCCGCC SRR7814940 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:37:45 Started mapping on | Dec 07 04:37:45 Finished on | Dec 07 04:51:43 Mapping speed, Million of reads per hour | 181.28 Number of input reads | 42199056 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 39973763 Uniquely mapped reads % | 94.73% Average mapped length | 299.83 Number of splices: Total | 42772209 Number of splices: Annotated (sjdb) | 40464470 Number of splices: GT/AG | 42208629 Number of splices: GC/AG | 507164 Number of splices: AT/AC | 22983 Number of splices: Non-canonical | 33433 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.72 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410701 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 40057 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.71% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1814592 1814592 1814592 N_multimapping 410701 410701 410701 N_noFeature 1357892 38833551 1665556 N_ambiguous 994502 6411 163369 UnstrandedReadsAssigned:37621369 PositiveStrandReadsAssigned:1133801 NegativeStrandReadsAssigned:38144838 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814940 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814940-trimmed-pair1.fastq SRR7814940-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,199,056 reads, 38,667,432 reads pseudoaligned [quant] estimated average fragment length: 305.237 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR7814940.ke.tsv 35125 SRR7814940.se.tsv 88098 total ==> SRR7814940.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 632.458 0 0 PNS24247 1044 739.763 156.721 7.37326 PNS24249 1928 1623.76 116.18 2.4902 PNS24246 1044 739.763 156.721 7.37326 PNS24248 1044 739.763 156.721 7.37326 PNS24244 1471 1166.76 281.657 8.40163 PNS24243 293 73.1419 0 0 KQK14069 1603 1298.76 13829.7 370.601 KQK14071 474 199.345 68.4639 11.9531 ==> SRR7814940.se.tsv <== BRADI_1g14170v3 14094 BRADI_1g53295v3 375 BRADI_1g59795v3 1244 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 453 BRADI_1g74790v3 1568 BRADI_1g09890v3 0 BRADI_1g77505v3 576 BRADI_1g48960v3 4 SRR7814940 completed mapping pipeline successfully