Starting /dee2/code/volunteer_pipeline.sh SRR7814941 current disk space = 1547661021184 free memory = 1604577132 SRR7814941 SRAfilesize 14183b8677b835cd5ffe0f78acee1927 SRR7814941.sra SRR7814941.sra file validated SRR7814941 is paired end SRR7814941 is conventional basespace SRR7814941 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814941_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.30875 37.0 37.0 37.0 37.0 37.0 2 36.3675 37.0 37.0 37.0 37.0 37.0 3 36.518 37.0 37.0 37.0 37.0 37.0 4 36.5485 37.0 37.0 37.0 37.0 37.0 5 36.494 37.0 37.0 37.0 37.0 37.0 6 36.557 37.0 37.0 37.0 37.0 37.0 7 36.522 37.0 37.0 37.0 37.0 37.0 8 36.576 37.0 37.0 37.0 37.0 37.0 9 36.512 37.0 37.0 37.0 37.0 37.0 10-14 36.5501 37.0 37.0 37.0 37.0 37.0 15-19 36.5137 37.0 37.0 37.0 37.0 37.0 20-24 36.46509999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4546 37.0 37.0 37.0 37.0 37.0 30-34 36.4624 37.0 37.0 37.0 37.0 37.0 35-39 36.4479 37.0 37.0 37.0 37.0 37.0 40-44 36.4188 37.0 37.0 37.0 37.0 37.0 45-49 36.392599999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.2872 37.0 37.0 37.0 37.0 37.0 55-59 36.2978 37.0 37.0 37.0 37.0 37.0 60-64 36.282 37.0 37.0 37.0 37.0 37.0 65-69 36.2562 37.0 37.0 37.0 37.0 37.0 70-74 36.178700000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.135299999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.15400000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1494 37.0 37.0 37.0 37.0 37.0 90-94 36.0829 37.0 37.0 37.0 37.0 37.0 95-99 36.0158 37.0 37.0 37.0 37.0 37.0 100-104 35.9553 37.0 37.0 37.0 37.0 37.0 105-109 35.9697 37.0 37.0 37.0 37.0 37.0 110-114 35.9936 37.0 37.0 37.0 37.0 37.0 115-119 35.9199 37.0 37.0 37.0 37.0 37.0 120-124 35.803000000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.7478 37.0 37.0 37.0 37.0 37.0 130-134 35.6893 37.0 37.0 37.0 37.0 37.0 135-139 35.6863 37.0 37.0 37.0 37.0 37.0 140-144 35.5283 37.0 37.0 37.0 37.0 37.0 145-149 35.4613 37.0 37.0 37.0 32.2 37.0 150-151 34.6255 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 0.0 22 0.0 23 0.0 24 2.0 25 4.0 26 3.0 27 9.0 28 19.0 29 26.0 30 34.0 31 32.0 32 52.0 33 87.0 34 143.0 35 419.0 36 2911.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.4933600601353 12.853921322976698 10.223001753946379 35.42971686294162 2 25.6 18.125 33.025 23.25 3 21.325 26.424999999999997 24.125 28.125 4 25.324999999999996 31.900000000000002 20.375 22.400000000000002 5 25.224999999999998 33.85 20.775 20.150000000000002 6 22.025 32.824999999999996 23.05 22.1 7 16.975 20.849999999999998 41.725 20.45 8 21.3 21.375 27.0 30.325000000000003 9 20.849999999999998 19.225 30.5 29.425 10-14 23.355 26.0 24.279999999999998 26.365 15-19 23.555 25.6 25.224999999999998 25.619999999999997 20-24 22.945 25.985000000000003 25.435000000000002 25.635 25-29 23.549999999999997 26.22 24.875 25.355 30-34 23.095 26.090000000000003 25.25 25.564999999999998 35-39 23.22 25.8 24.805 26.174999999999997 40-44 23.505000000000003 25.005 25.06 26.43 45-49 23.244999999999997 25.275 25.224999999999998 26.255 50-54 23.61 25.255 24.55 26.584999999999997 55-59 23.974999999999998 25.435000000000002 24.610000000000003 25.979999999999997 60-64 23.41 25.35 24.945 26.295 65-69 24.035 25.509999999999998 24.345 26.11 70-74 24.135 25.415 24.474999999999998 25.974999999999998 75-79 23.919999999999998 25.05 24.93 26.1 80-84 23.794999999999998 24.905 24.83 26.47 85-89 24.355 25.324999999999996 24.709999999999997 25.61 90-94 24.21 25.11 24.610000000000003 26.07 95-99 24.115000000000002 24.745 24.83 26.31 100-104 24.135 24.77 24.335 26.76 105-109 24.6 25.064999999999998 24.135 26.200000000000003 110-114 24.044999999999998 25.009999999999998 24.48 26.465 115-119 24.39 24.515 25.019999999999996 26.075 120-124 24.33 24.665 24.54 26.465 125-129 24.545 25.05 23.974999999999998 26.43 130-134 24.62 24.645 24.12 26.615 135-139 24.975 24.85 23.39 26.784999999999997 140-144 24.84 24.565 24.32 26.275 145-149 24.54 24.63 23.849999999999998 26.979999999999997 150-151 23.962500000000002 24.349999999999998 24.2625 27.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 1.0 28 1.5 29 3.5 30 8.0 31 9.5 32 11.5 33 17.5 34 28.0 35 37.5 36 45.0 37 54.5 38 72.0 39 101.0 40 129.5 41 141.0 42 159.5 43 177.5 44 193.5 45 215.5 46 199.5 47 180.5 48 187.0 49 171.0 50 157.5 51 148.5 52 126.5 53 133.5 54 131.0 55 101.0 56 93.0 57 88.0 58 83.0 59 82.0 60 70.0 61 65.0 62 66.0 63 59.0 64 59.0 65 57.0 66 45.0 67 51.0 68 47.5 69 42.0 70 36.0 71 25.0 72 20.0 73 14.5 74 15.0 75 10.0 76 6.0 77 8.0 78 5.5 79 3.0 80 1.0 81 0.0 82 1.5 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 91.8484187568157 84.22500000000001 2 7.279171210468921 13.350000000000001 3 0.8451472191930207 2.325 4 0.02726281352235551 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.4375 0.0 0.0 0.0 0.0 138-139 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814941 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814941_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3925 37.0 37.0 37.0 37.0 37.0 2 36.1815 37.0 37.0 37.0 37.0 37.0 3 36.19 37.0 37.0 37.0 37.0 37.0 4 36.321 37.0 37.0 37.0 37.0 37.0 5 36.2465 37.0 37.0 37.0 37.0 37.0 6 36.177 37.0 37.0 37.0 37.0 37.0 7 36.174 37.0 37.0 37.0 37.0 37.0 8 36.231 37.0 37.0 37.0 37.0 37.0 9 36.221 37.0 37.0 37.0 37.0 37.0 10-14 36.1703 37.0 37.0 37.0 37.0 37.0 15-19 36.058800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.0441 37.0 37.0 37.0 37.0 37.0 25-29 35.9665 37.0 37.0 37.0 37.0 37.0 30-34 35.9458 37.0 37.0 37.0 37.0 37.0 35-39 35.8663 37.0 37.0 37.0 37.0 37.0 40-44 35.842600000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.7856 37.0 37.0 37.0 37.0 37.0 50-54 35.680400000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.5178 37.0 37.0 37.0 37.0 37.0 60-64 35.5752 37.0 37.0 37.0 37.0 37.0 65-69 35.557900000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.4722 37.0 37.0 37.0 37.0 37.0 75-79 35.4362 37.0 37.0 37.0 37.0 37.0 80-84 35.327200000000005 37.0 37.0 37.0 34.6 37.0 85-89 35.3133 37.0 37.0 37.0 34.6 37.0 90-94 35.178999999999995 37.0 37.0 37.0 29.8 37.0 95-99 34.8327 37.0 37.0 37.0 25.0 37.0 100-104 34.9471 37.0 37.0 37.0 25.0 37.0 105-109 34.7633 37.0 37.0 37.0 25.0 37.0 110-114 34.72420000000001 37.0 37.0 37.0 25.0 37.0 115-119 34.8086 37.0 37.0 37.0 25.0 37.0 120-124 34.5496 37.0 37.0 37.0 25.0 37.0 125-129 34.5724 37.0 37.0 37.0 25.0 37.0 130-134 34.1465 37.0 37.0 37.0 25.0 37.0 135-139 34.0471 37.0 37.0 37.0 25.0 37.0 140-144 34.3713 37.0 37.0 37.0 25.0 37.0 145-149 34.0679 37.0 37.0 37.0 25.0 37.0 150-151 33.522999999999996 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 4.0 14 10.0 15 10.0 16 6.0 17 1.0 18 2.0 19 2.0 20 3.0 21 4.0 22 5.0 23 6.0 24 13.0 25 12.0 26 12.0 27 18.0 28 21.0 29 23.0 30 44.0 31 61.0 32 85.0 33 174.0 34 360.0 35 920.0 36 2149.0 37 53.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.15 13.750000000000002 12.25 31.85 2 30.85 18.975 27.750000000000004 22.425 3 25.525 23.425 26.325 24.725 4 28.025 30.9 17.875 23.200000000000003 5 27.575 33.050000000000004 18.05 21.325 6 23.325000000000003 33.550000000000004 18.375 24.75 7 22.675 14.124999999999998 36.3 26.900000000000002 8 23.150000000000002 20.7 21.3 34.849999999999994 9 24.224999999999998 22.2 25.05 28.525 10-14 26.895000000000003 24.39 22.39 26.325 15-19 26.52 23.72 23.330000000000002 26.43 20-24 26.169999999999998 24.085 23.61 26.135 25-29 26.490000000000002 24.4 23.43 25.679999999999996 30-34 26.040000000000003 24.89 23.365 25.705 35-39 26.985 24.26 23.515 25.240000000000002 40-44 26.395000000000003 25.169999999999998 22.945 25.490000000000002 45-49 26.495 24.92 22.975 25.61 50-54 26.729999999999997 24.474999999999998 23.285 25.509999999999998 55-59 27.305 24.635 22.84 25.22 60-64 26.674999999999997 25.025 23.599999999999998 24.7 65-69 26.68 24.779999999999998 23.05 25.490000000000002 70-74 27.175 24.425 23.435 24.965 75-79 26.955000000000002 25.305 22.900000000000002 24.84 80-84 26.484999999999996 24.474999999999998 23.97 25.069999999999997 85-89 26.345000000000002 24.87 23.185 25.6 90-94 26.884999999999998 24.98 23.474999999999998 24.66 95-99 27.3 24.385 23.74 24.575 100-104 26.58 25.28 23.89 24.25 105-109 26.724999999999998 25.040000000000003 23.669999999999998 24.565 110-114 26.61 25.445 23.09 24.855 115-119 26.965 24.895 23.419999999999998 24.72 120-124 26.834999999999997 24.945 23.724999999999998 24.495 125-129 26.685 24.87 23.615 24.83 130-134 26.775 25.130000000000003 23.66 24.435000000000002 135-139 27.29 25.064999999999998 23.655 23.990000000000002 140-144 26.705000000000002 25.480000000000004 23.385 24.43 145-149 26.455000000000002 25.580000000000002 24.19 23.775 150-151 27.775 25.275 22.6875 24.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.5 14 1.0 15 1.5 16 2.5 17 2.0 18 1.0 19 1.0 20 1.5 21 2.0 22 1.5 23 1.0 24 1.5 25 1.0 26 0.0 27 0.5 28 0.5 29 1.5 30 3.5 31 3.5 32 6.0 33 14.5 34 21.0 35 22.0 36 23.0 37 37.0 38 49.0 39 65.5 40 87.5 41 96.0 42 114.0 43 144.5 44 165.0 45 172.0 46 179.5 47 173.5 48 173.0 49 167.0 50 163.5 51 154.5 52 133.0 53 134.0 54 129.5 55 115.0 56 104.5 57 95.5 58 93.5 59 97.5 60 84.0 61 79.0 62 86.5 63 85.5 64 81.0 65 74.5 66 79.0 67 85.5 68 75.0 69 49.5 70 44.5 71 47.0 72 33.5 73 30.0 74 27.0 75 20.5 76 13.0 77 9.5 78 8.0 79 3.5 80 2.0 81 1.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.5 87 1.0 88 1.5 89 1.0 90 1.5 91 1.5 92 0.5 93 1.5 94 1.0 95 0.5 96 1.0 97 1.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.16326530612244 84.675 2 6.938775510204081 12.75 3 0.8163265306122449 2.25 4 0.05442176870748299 0.2 5 0.027210884353741496 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.037500000000000006 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.32499999999999996 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.7 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.1749999999999998 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.3875 0.0 0.0 0.0 0.0 138-139 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040757 spots for SRR7814941.sra Written 2040757 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra Read 2040753 spots for SRR7814941.sra Written 2040753 spots for SRR7814941.sra SRR ids: ['SRR7814941.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_56avit7y SRR7814941.sra spots: 40815064 blocks: [[1, 2040753], [2040754, 4081506], [4081507, 6122259], [6122260, 8163012], [8163013, 10203765], [10203766, 12244518], [12244519, 14285271], [14285272, 16326024], [16326025, 18366777], [18366778, 20407530], [20407531, 22448283], [22448284, 24489036], [24489037, 26529789], [26529790, 28570542], [28570543, 30611295], [30611296, 32652048], [32652049, 34692801], [34692802, 36733554], [36733555, 38774307], [38774308, 40815064]] SRR7814941 file size 13809185 SRR7814941 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814941 SRR7814941_1.fastq SRR7814941_2.fastq Input file: SRR7814941_1.fastq Paired file: SRR7814941_2.fastq trimmed: SRR7814941-trimmed-pair1.fastq, SRR7814941-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 03:30:26 2024 >> started Sat Dec 7 04:04:39 2024 >> done (2053.016s) 40815064 read pairs processed; of these: 105 ( 0.00%) short read pairs filtered out after trimming by size control 11313 ( 0.03%) empty read pairs filtered out after trimming by size control 40803646 (99.97%) read pairs available; of these: 1141876 ( 2.80%) trimmed read pairs available after processing 39661770 (97.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 8 0.00% 20 17 0.00% 21 21 0.00% 22 22 0.00% 23 25 0.00% 24 18 0.00% 25 35 0.00% 26 27 0.00% 27 44 0.00% 28 29 0.00% 29 40 0.00% 30 37 0.00% 31 45 0.00% 32 56 0.00% 33 51 0.00% 34 53 0.00% 35 61 0.00% 36 45 0.00% 37 68 0.00% 38 84 0.00% 39 56 0.00% 40 67 0.00% 41 79 0.00% 42 87 0.00% 43 77 0.00% 44 74 0.00% 45 74 0.00% 46 113 0.00% 47 81 0.00% 48 76 0.00% 49 105 0.00% 50 97 0.00% 51 111 0.00% 52 100 0.00% 53 137 0.00% 54 128 0.00% 55 156 0.00% 56 160 0.00% 57 143 0.00% 58 146 0.00% 59 179 0.00% 60 168 0.00% 61 190 0.00% 62 183 0.00% 63 226 0.00% 64 207 0.00% 65 200 0.00% 66 275 0.00% 67 241 0.00% 68 298 0.00% 69 323 0.00% 70 342 0.00% 71 375 0.00% 72 437 0.00% 73 457 0.00% 74 467 0.00% 75 517 0.00% 76 552 0.00% 77 656 0.00% 78 706 0.00% 79 738 0.00% 80 844 0.00% 81 922 0.00% 82 1037 0.00% 83 1068 0.00% 84 1230 0.00% 85 1316 0.00% 86 1541 0.00% 87 1632 0.00% 88 1804 0.00% 89 1870 0.00% 90 2155 0.01% 91 2242 0.01% 92 2712 0.01% 93 2866 0.01% 94 3042 0.01% 95 3407 0.01% 96 3560 0.01% 97 3814 0.01% 98 4089 0.01% 99 4488 0.01% 100 4725 0.01% 101 5260 0.01% 102 5691 0.01% 103 6153 0.02% 104 6340 0.02% 105 6900 0.02% 106 7142 0.02% 107 7572 0.02% 108 7791 0.02% 109 8518 0.02% 110 8939 0.02% 111 9497 0.02% 112 10316 0.03% 113 10768 0.03% 114 11461 0.03% 115 11768 0.03% 116 12464 0.03% 117 13011 0.03% 118 13378 0.03% 119 14003 0.03% 120 14884 0.04% 121 15344 0.04% 122 16411 0.04% 123 17469 0.04% 124 18387 0.05% 125 19111 0.05% 126 19683 0.05% 127 20449 0.05% 128 21083 0.05% 129 22111 0.05% 130 22489 0.06% 131 23559 0.06% 132 24926 0.06% 133 26258 0.06% 134 27032 0.07% 135 28702 0.07% 136 29680 0.07% 137 30270 0.07% 138 31096 0.08% 139 32434 0.08% 140 32943 0.08% 141 34653 0.08% 142 35948 0.09% 143 37206 0.09% 144 39035 0.10% 145 40940 0.10% 146 41968 0.10% 147 42910 0.11% 148 44330 0.11% 149 45195 0.11% 150 47434 0.12% 151 39661770 97.20% 40803646 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=34 prefix-density=0.24 prefix-fanout=2.9 sequence=ATGCCCTCCTTGTCCTGGATCTTGGCCTTCACGTTGTCGATGGTGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=392.73 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=33.2 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=29 prefix-density=0.46 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=771.77 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=22.4 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814941 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:12:44 Started mapping on | Dec 07 04:12:44 Finished on | Dec 07 04:21:12 Mapping speed, Million of reads per hour | 289.16 Number of input reads | 40803646 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 37220027 Uniquely mapped reads % | 91.22% Average mapped length | 299.95 Number of splices: Total | 37782620 Number of splices: Annotated (sjdb) | 35668310 Number of splices: GT/AG | 37303819 Number of splices: GC/AG | 421109 Number of splices: AT/AC | 27379 Number of splices: Non-canonical | 30313 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 467506 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 36066 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.00% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3116113 3116113 3116113 N_multimapping 467506 467506 467506 N_noFeature 864234 36256746 1152322 N_ambiguous 769850 5499 96268 UnstrandedReadsAssigned:35585943 PositiveStrandReadsAssigned:957782 NegativeStrandReadsAssigned:35971437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814941 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814941-trimmed-pair1.fastq SRR7814941-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,803,646 reads, 36,794,119 reads pseudoaligned [quant] estimated average fragment length: 306.447 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,220 rounds 52973 SRR7814941.ke.tsv 35125 SRR7814941.se.tsv 88098 total ==> SRR7814941.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 631.205 2.98825e-05 1.67242e-06 PNS24247 1044 738.553 163.805 7.83508 PNS24249 1928 1622.55 188.538 4.10487 PNS24246 1044 738.553 163.805 7.83508 PNS24248 1044 738.553 163.805 7.83508 PNS24244 1471 1165.55 387.047 11.7309 PNS24243 293 72.2183 0 0 KQK14069 1603 1297.55 4298.04 117.015 KQK14071 474 198.743 5.0538 0.898306 ==> SRR7814941.se.tsv <== BRADI_1g14170v3 4300 BRADI_1g53295v3 273 BRADI_1g59795v3 604 BRADI_1g07683v3 0 BRADI_1g00485v3 77 BRADI_1g20270v3 3771 BRADI_1g74790v3 479 BRADI_1g09890v3 13 BRADI_1g77505v3 360 BRADI_1g48960v3 0 SRR7814941 completed mapping pipeline successfully