Starting /dee2/code/volunteer_pipeline.sh SRR7814942 current disk space = 1547662508032 free memory = 1604573132 SRR7814942 SRAfilesize 579d6b7f6de5d26be6f28627c4034951 SRR7814942.sra SRR7814942.sra file validated SRR7814942 is paired end SRR7814942 is conventional basespace SRR7814942 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814942_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.28525 37.0 37.0 37.0 37.0 37.0 2 36.178 37.0 37.0 37.0 37.0 37.0 3 36.4275 37.0 37.0 37.0 37.0 37.0 4 36.509 37.0 37.0 37.0 37.0 37.0 5 36.446 37.0 37.0 37.0 37.0 37.0 6 36.488 37.0 37.0 37.0 37.0 37.0 7 36.4985 37.0 37.0 37.0 37.0 37.0 8 36.564 37.0 37.0 37.0 37.0 37.0 9 36.517 37.0 37.0 37.0 37.0 37.0 10-14 36.5158 37.0 37.0 37.0 37.0 37.0 15-19 36.5015 37.0 37.0 37.0 37.0 37.0 20-24 36.4566 37.0 37.0 37.0 37.0 37.0 25-29 36.431 37.0 37.0 37.0 37.0 37.0 30-34 36.442400000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4349 37.0 37.0 37.0 37.0 37.0 40-44 36.4122 37.0 37.0 37.0 37.0 37.0 45-49 36.338499999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.266 37.0 37.0 37.0 37.0 37.0 55-59 36.2692 37.0 37.0 37.0 37.0 37.0 60-64 36.263099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.19840000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.1791 37.0 37.0 37.0 37.0 37.0 75-79 36.16610000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0952 37.0 37.0 37.0 37.0 37.0 85-89 36.1391 37.0 37.0 37.0 37.0 37.0 90-94 36.052499999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.9978 37.0 37.0 37.0 37.0 37.0 100-104 36.0034 37.0 37.0 37.0 37.0 37.0 105-109 35.9756 37.0 37.0 37.0 37.0 37.0 110-114 35.93730000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.9055 37.0 37.0 37.0 37.0 37.0 120-124 35.7449 37.0 37.0 37.0 37.0 37.0 125-129 35.7113 37.0 37.0 37.0 37.0 37.0 130-134 35.606 37.0 37.0 37.0 37.0 37.0 135-139 35.638099999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.62820000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.505500000000005 37.0 37.0 37.0 34.6 37.0 150-151 34.8705 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 3.0 24 4.0 25 1.0 26 4.0 27 10.0 28 12.0 29 19.0 30 22.0 31 43.0 32 58.0 33 87.0 34 178.0 35 435.0 36 2887.0 37 236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.468303683287395 15.008769731896768 9.77198697068404 33.750939614131795 2 26.325 18.475 30.625000000000004 24.575 3 21.099999999999998 26.224999999999998 26.125 26.55 4 24.025 32.2 21.275 22.5 5 24.3 33.550000000000004 22.425 19.725 6 22.175 32.800000000000004 23.425 21.6 7 17.175 20.0 42.65 20.175 8 21.925 19.5 27.0 31.574999999999996 9 21.5 20.474999999999998 29.525000000000002 28.499999999999996 10-14 22.830000000000002 26.66 24.895 25.615 15-19 22.86 25.575 25.669999999999998 25.895000000000003 20-24 23.48 25.835 25.14 25.545 25-29 23.52 25.990000000000002 25.115 25.374999999999996 30-34 23.7 25.825 24.86 25.615 35-39 23.5 25.424999999999997 25.405 25.669999999999998 40-44 23.47 25.435000000000002 25.629999999999995 25.465 45-49 23.335 25.485000000000003 24.6 26.58 50-54 23.185 25.855 24.515 26.445 55-59 23.395 26.009999999999998 24.529999999999998 26.064999999999998 60-64 23.945 25.44 24.87 25.745 65-69 23.735 25.064999999999998 24.9 26.3 70-74 23.865 25.515 24.92 25.7 75-79 23.44 25.28 25.28 26.0 80-84 24.05 24.625 24.92 26.405 85-89 23.849999999999998 25.515 24.79 25.845000000000002 90-94 24.265 25.619999999999997 24.135 25.979999999999997 95-99 24.435000000000002 25.56 24.415 25.590000000000003 100-104 23.31 25.905 24.545 26.240000000000002 105-109 24.215 25.105 24.745 25.935000000000002 110-114 23.825 24.645 25.224999999999998 26.305 115-119 24.52 25.11 24.65 25.72 120-124 24.44 25.31 24.224999999999998 26.025 125-129 24.535 24.035 24.865000000000002 26.565 130-134 23.645 25.669999999999998 24.685000000000002 26.0 135-139 24.36 24.654999999999998 25.0 25.985000000000003 140-144 24.685000000000002 24.505 24.945 25.865 145-149 23.915 25.255 24.555 26.275 150-151 24.2375 25.525 24.075 26.1625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 1.0 24 0.0 25 1.0 26 2.5 27 2.5 28 1.5 29 3.0 30 5.5 31 10.0 32 15.5 33 19.5 34 28.5 35 37.0 36 54.5 37 70.0 38 80.0 39 100.5 40 120.0 41 133.5 42 165.0 43 178.5 44 196.5 45 210.5 46 204.0 47 191.5 48 171.5 49 176.5 50 177.5 51 156.0 52 130.5 53 132.5 54 126.0 55 108.0 56 91.5 57 70.5 58 70.5 59 72.0 60 58.0 61 57.0 62 58.5 63 54.5 64 56.5 65 57.5 66 52.0 67 44.0 68 38.5 69 41.5 70 39.5 71 34.5 72 31.5 73 17.5 74 12.5 75 12.0 76 6.0 77 4.0 78 2.5 79 2.5 80 1.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.025 #Duplication Level Percentage of deduplicated Percentage of total 1 92.25753871230644 84.89999999999999 2 6.954631893507199 12.8 3 0.6791632708503124 1.875 4 0.08149959250203749 0.3 5 0.027166530834012496 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TCTCATCCAACGTGAACTGCTTAACTCCATGGGGAATCATCATATCTGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.07500000000000001 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.1375 0.0 0.0 0.0 0.025 106-107 0.15 0.0 0.0 0.0 0.025 108-109 0.16249999999999998 0.0 0.0 0.0 0.025 110-111 0.225 0.0 0.0 0.0 0.025 112-113 0.275 0.0 0.0 0.0 0.025 114-115 0.4125 0.0 0.0 0.0 0.025 116-117 0.48750000000000004 0.0 0.0 0.0 0.025 118-119 0.55 0.0 0.0 0.0 0.025 120-121 0.625 0.0 0.0 0.0 0.025 122-123 0.7375 0.0 0.0 0.0 0.025 124-125 0.7875000000000001 0.0 0.0 0.0 0.025 126-127 0.925 0.0 0.0 0.0 0.025 128-129 1.0125 0.0 0.0 0.0 0.025 130-131 1.1375 0.0 0.0 0.0 0.025 132-133 1.25 0.0 0.0 0.0 0.025 134-135 1.3875 0.0 0.0 0.0 0.025 136-137 1.475 0.0 0.0 0.0 0.025 138-139 1.55 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAGTA 10 0.006830828 145.0 7 >>END_MODULE SRR7814942 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814942_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4565 37.0 37.0 37.0 37.0 37.0 2 36.1135 37.0 37.0 37.0 37.0 37.0 3 36.088 37.0 37.0 37.0 37.0 37.0 4 36.2485 37.0 37.0 37.0 37.0 37.0 5 36.2205 37.0 37.0 37.0 37.0 37.0 6 36.142 37.0 37.0 37.0 37.0 37.0 7 36.1325 37.0 37.0 37.0 37.0 37.0 8 36.216 37.0 37.0 37.0 37.0 37.0 9 36.135 37.0 37.0 37.0 37.0 37.0 10-14 36.120999999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.0459 37.0 37.0 37.0 37.0 37.0 20-24 36.033 37.0 37.0 37.0 37.0 37.0 25-29 35.9208 37.0 37.0 37.0 37.0 37.0 30-34 35.9345 37.0 37.0 37.0 37.0 37.0 35-39 35.907799999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.78060000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.7308 37.0 37.0 37.0 37.0 37.0 50-54 35.522800000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.4805 37.0 37.0 37.0 37.0 37.0 60-64 35.430899999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.4826 37.0 37.0 37.0 37.0 37.0 70-74 35.433400000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.378499999999995 37.0 37.0 37.0 34.6 37.0 80-84 35.147299999999994 37.0 37.0 37.0 29.8 37.0 85-89 35.257400000000004 37.0 37.0 37.0 32.2 37.0 90-94 35.0983 37.0 37.0 37.0 27.4 37.0 95-99 34.7264 37.0 37.0 37.0 25.0 37.0 100-104 34.7792 37.0 37.0 37.0 25.0 37.0 105-109 34.4748 37.0 37.0 37.0 25.0 37.0 110-114 34.645500000000006 37.0 37.0 37.0 25.0 37.0 115-119 34.6991 37.0 37.0 37.0 25.0 37.0 120-124 34.3245 37.0 37.0 37.0 25.0 37.0 125-129 34.441500000000005 37.0 37.0 37.0 25.0 37.0 130-134 34.0883 37.0 37.0 37.0 25.0 37.0 135-139 33.8514 37.0 37.0 37.0 25.0 37.0 140-144 34.1726 37.0 37.0 37.0 25.0 37.0 145-149 33.9131 37.0 37.0 37.0 25.0 37.0 150-151 33.3635 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 6.0 15 4.0 16 4.0 17 5.0 18 7.0 19 4.0 20 8.0 21 8.0 22 11.0 23 11.0 24 8.0 25 17.0 26 15.0 27 15.0 28 14.0 29 19.0 30 50.0 31 73.0 32 100.0 33 185.0 34 364.0 35 996.0 36 2020.0 37 52.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.75 16.225 11.774999999999999 30.25 2 29.45 22.725 27.200000000000003 20.625 3 25.275 25.124999999999996 25.474999999999998 24.125 4 26.474999999999998 30.825000000000003 18.625 24.075 5 27.450000000000003 32.5 19.025 21.025 6 23.925 34.150000000000006 17.875 24.05 7 20.625 16.7 36.975 25.7 8 23.45 20.325 22.675 33.550000000000004 9 24.2 21.7 24.349999999999998 29.75 10-14 26.0 24.759999999999998 22.68 26.56 15-19 26.005 24.725 23.525 25.745 20-24 26.419999999999998 25.679999999999996 22.74 25.16 25-29 26.090000000000003 25.485000000000003 23.169999999999998 25.255 30-34 25.974999999999998 25.330000000000002 23.474999999999998 25.22 35-39 26.27 25.224999999999998 23.165 25.34 40-44 26.085 25.124999999999996 23.955000000000002 24.834999999999997 45-49 26.045 25.14 23.275000000000002 25.540000000000003 50-54 25.924999999999997 25.685000000000002 23.785 24.605 55-59 26.200000000000003 25.16 23.39 25.25 60-64 25.825 24.995 24.23 24.95 65-69 26.555 25.115 23.54 24.79 70-74 25.825 25.174999999999997 24.0 25.0 75-79 26.295 25.185000000000002 24.13 24.39 80-84 26.665 24.775 23.515 25.045 85-89 26.41 24.89 23.98 24.72 90-94 25.95 25.03 24.04 24.98 95-99 25.95 25.759999999999998 23.87 24.42 100-104 26.565 25.380000000000003 23.895 24.16 105-109 26.040000000000003 25.085 24.38 24.495 110-114 26.745 25.230000000000004 23.27 24.755 115-119 27.084999999999997 25.474999999999998 23.45 23.990000000000002 120-124 26.575 25.290000000000003 23.724999999999998 24.41 125-129 26.35 24.965 24.275 24.41 130-134 26.619999999999997 24.965 23.97 24.445 135-139 26.275 25.245 24.08 24.4 140-144 26.405 25.14 24.395 24.060000000000002 145-149 27.005000000000003 25.0 24.04 23.955000000000002 150-151 27.4125 25.1 24.15 23.3375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.5 16 1.0 17 0.5 18 1.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.0 25 1.5 26 1.0 27 1.0 28 4.0 29 4.5 30 6.0 31 10.5 32 12.5 33 17.0 34 21.5 35 23.0 36 36.0 37 45.5 38 55.5 39 76.5 40 96.5 41 120.0 42 150.0 43 166.0 44 172.0 45 178.0 46 185.5 47 181.0 48 167.5 49 162.5 50 147.5 51 145.0 52 145.5 53 130.5 54 105.5 55 87.0 56 83.0 57 93.0 58 90.5 59 82.5 60 84.5 61 76.0 62 81.0 63 81.0 64 78.0 65 73.5 66 71.0 67 70.5 68 68.5 69 67.5 70 45.0 71 38.5 72 36.5 73 27.0 74 21.5 75 13.5 76 10.5 77 6.5 78 5.0 79 6.0 80 3.0 81 1.5 82 1.5 83 1.0 84 2.0 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 1.0 97 1.0 98 0.5 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.37242128121606 85.075 2 6.894679695982628 12.7 3 0.5971769815418024 1.6500000000000001 4 0.08143322475570033 0.3 5 0.02714440825190011 0.125 6 0.02714440825190011 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CTCCTATCTCATCCTCTTTCCCGTGATCAGCTACATCGGCATAACCCACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.7875000000000001 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.975 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.2000000000000002 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.425 0.0 0.0 0.0 0.0 138-139 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGGAG 10 0.006830828 145.0 8 >>END_MODULE Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771188 spots for SRR7814942.sra Written 1771188 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra Read 1771180 spots for SRR7814942.sra Written 1771180 spots for SRR7814942.sra SRR ids: ['SRR7814942.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jzyqufk_ SRR7814942.sra spots: 35423608 blocks: [[1, 1771180], [1771181, 3542360], [3542361, 5313540], [5313541, 7084720], [7084721, 8855900], [8855901, 10627080], [10627081, 12398260], [12398261, 14169440], [14169441, 15940620], [15940621, 17711800], [17711801, 19482980], [19482981, 21254160], [21254161, 23025340], [23025341, 24796520], [24796521, 26567700], [26567701, 28338880], [28338881, 30110060], [30110061, 31881240], [31881241, 33652420], [33652421, 35423608]] SRR7814942 file size 11982198 SRR7814942 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814942 SRR7814942_1.fastq SRR7814942_2.fastq Input file: SRR7814942_1.fastq Paired file: SRR7814942_2.fastq trimmed: SRR7814942-trimmed-pair1.fastq, SRR7814942-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:18:36 2024 >> started Sat Dec 7 04:35:32 2024 >> done (1016.677s) 35423608 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 4247 ( 0.01%) empty read pairs filtered out after trimming by size control 35419236 (99.99%) read pairs available; of these: 738922 ( 2.09%) trimmed read pairs available after processing 34680314 (97.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 10 0.00% 20 16 0.00% 21 15 0.00% 22 23 0.00% 23 25 0.00% 24 23 0.00% 25 22 0.00% 26 25 0.00% 27 39 0.00% 28 42 0.00% 29 35 0.00% 30 20 0.00% 31 33 0.00% 32 42 0.00% 33 46 0.00% 34 42 0.00% 35 67 0.00% 36 58 0.00% 37 54 0.00% 38 47 0.00% 39 47 0.00% 40 55 0.00% 41 53 0.00% 42 56 0.00% 43 58 0.00% 44 74 0.00% 45 63 0.00% 46 81 0.00% 47 83 0.00% 48 70 0.00% 49 84 0.00% 50 79 0.00% 51 73 0.00% 52 88 0.00% 53 91 0.00% 54 100 0.00% 55 113 0.00% 56 117 0.00% 57 126 0.00% 58 124 0.00% 59 128 0.00% 60 115 0.00% 61 140 0.00% 62 155 0.00% 63 151 0.00% 64 162 0.00% 65 151 0.00% 66 165 0.00% 67 162 0.00% 68 209 0.00% 69 227 0.00% 70 242 0.00% 71 262 0.00% 72 311 0.00% 73 325 0.00% 74 312 0.00% 75 336 0.00% 76 370 0.00% 77 410 0.00% 78 434 0.00% 79 478 0.00% 80 534 0.00% 81 614 0.00% 82 652 0.00% 83 745 0.00% 84 876 0.00% 85 902 0.00% 86 962 0.00% 87 1071 0.00% 88 1131 0.00% 89 1263 0.00% 90 1426 0.00% 91 1542 0.00% 92 1661 0.00% 93 1930 0.01% 94 2030 0.01% 95 2168 0.01% 96 2400 0.01% 97 2446 0.01% 98 2730 0.01% 99 2940 0.01% 100 3110 0.01% 101 3269 0.01% 102 3746 0.01% 103 3981 0.01% 104 4249 0.01% 105 4402 0.01% 106 4679 0.01% 107 4955 0.01% 108 5378 0.02% 109 5452 0.02% 110 5634 0.02% 111 6142 0.02% 112 6582 0.02% 113 7135 0.02% 114 7537 0.02% 115 7853 0.02% 116 8061 0.02% 117 8342 0.02% 118 8622 0.02% 119 8921 0.03% 120 9419 0.03% 121 10011 0.03% 122 10421 0.03% 123 11408 0.03% 124 11955 0.03% 125 12592 0.04% 126 12937 0.04% 127 13203 0.04% 128 13481 0.04% 129 13834 0.04% 130 14184 0.04% 131 15145 0.04% 132 16232 0.05% 133 16778 0.05% 134 17470 0.05% 135 18496 0.05% 136 19190 0.05% 137 19476 0.05% 138 20149 0.06% 139 20737 0.06% 140 20892 0.06% 141 22225 0.06% 142 23334 0.07% 143 23939 0.07% 144 24954 0.07% 145 26621 0.08% 146 27390 0.08% 147 28202 0.08% 148 28579 0.08% 149 28941 0.08% 150 31078 0.09% 151 34680314 97.91% 35419236 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.40 fanout-score-rank=29 prefix-density=0.17 prefix-fanout=3.6 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=346.47 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=28.1 sequence=TCTTCTTCTTGTC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=713.92 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=22.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814942 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:39:21 Started mapping on | Dec 07 04:39:21 Finished on | Dec 07 04:58:09 Mapping speed, Million of reads per hour | 113.04 Number of input reads | 35419236 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 32506452 Uniquely mapped reads % | 91.78% Average mapped length | 300.16 Number of splices: Total | 32946445 Number of splices: Annotated (sjdb) | 30921375 Number of splices: GT/AG | 32543247 Number of splices: GC/AG | 351572 Number of splices: AT/AC | 24456 Number of splices: Non-canonical | 27170 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332646 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 33458 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.61% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2580138 2580138 2580138 N_multimapping 332646 332646 332646 N_noFeature 980932 31703695 1222805 N_ambiguous 667864 5431 107149 UnstrandedReadsAssigned:30857656 PositiveStrandReadsAssigned:797326 NegativeStrandReadsAssigned:31176498 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814942 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814942-trimmed-pair1.fastq SRR7814942-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,419,236 reads, 31,879,846 reads pseudoaligned [quant] estimated average fragment length: 332.874 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52973 SRR7814942.ke.tsv 35125 SRR7814942.se.tsv 88098 total ==> SRR7814942.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 605.254 0 0 PNS24247 1044 712.126 163.384 10.2225 PNS24249 1928 1596.13 183.721 5.12857 PNS24246 1044 712.126 163.384 10.2225 PNS24248 1044 712.126 163.384 10.2225 PNS24244 1471 1139.13 316.128 12.365 PNS24243 293 69.8093 0 0 KQK14069 1603 1271.13 1389.44 48.703 KQK14071 474 187.688 8.40422 1.9951 ==> SRR7814942.se.tsv <== BRADI_1g14170v3 1446 BRADI_1g53295v3 235 BRADI_1g59795v3 448 BRADI_1g07683v3 0 BRADI_1g00485v3 119 BRADI_1g20270v3 3713 BRADI_1g74790v3 385 BRADI_1g09890v3 1 BRADI_1g77505v3 232 BRADI_1g48960v3 0 SRR7814942 completed mapping pipeline successfully