Starting /dee2/code/volunteer_pipeline.sh SRR7814943 current disk space = 1547669114880 free memory = 1604553876 SRR7814943 SRAfilesize 851e384fb7fd1c54be60fe61c9f219e0 SRR7814943.sra SRR7814943.sra file validated SRR7814943 is paired end SRR7814943 is conventional basespace SRR7814943 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814943_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.268 37.0 37.0 37.0 37.0 37.0 2 36.308 37.0 37.0 37.0 37.0 37.0 3 36.517 37.0 37.0 37.0 37.0 37.0 4 36.499 37.0 37.0 37.0 37.0 37.0 5 36.5305 37.0 37.0 37.0 37.0 37.0 6 36.5155 37.0 37.0 37.0 37.0 37.0 7 36.4395 37.0 37.0 37.0 37.0 37.0 8 36.585 37.0 37.0 37.0 37.0 37.0 9 36.59 37.0 37.0 37.0 37.0 37.0 10-14 36.5295 37.0 37.0 37.0 37.0 37.0 15-19 36.521899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.5 37.0 37.0 37.0 37.0 37.0 25-29 36.4495 37.0 37.0 37.0 37.0 37.0 30-34 36.479400000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.444900000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4217 37.0 37.0 37.0 37.0 37.0 45-49 36.3611 37.0 37.0 37.0 37.0 37.0 50-54 36.3088 37.0 37.0 37.0 37.0 37.0 55-59 36.2817 37.0 37.0 37.0 37.0 37.0 60-64 36.245000000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2063 37.0 37.0 37.0 37.0 37.0 70-74 36.179199999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.1996 37.0 37.0 37.0 37.0 37.0 80-84 36.196200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.1322 37.0 37.0 37.0 37.0 37.0 90-94 36.1096 37.0 37.0 37.0 37.0 37.0 95-99 36.05200000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.000699999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.994499999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.95719999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.8066 37.0 37.0 37.0 37.0 37.0 120-124 35.783 37.0 37.0 37.0 37.0 37.0 125-129 35.6419 37.0 37.0 37.0 37.0 37.0 130-134 35.617900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.6611 37.0 37.0 37.0 37.0 37.0 140-144 35.631899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.4743 37.0 37.0 37.0 37.0 37.0 150-151 34.7695 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 2.0 26 8.0 27 10.0 28 15.0 29 18.0 30 24.0 31 44.0 32 64.0 33 88.0 34 157.0 35 441.0 36 2890.0 37 237.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.45235707121364 11.68505516549649 8.500501504513542 37.36208625877633 2 22.425 19.3 35.975 22.3 3 22.1 23.724999999999998 25.45 28.725 4 26.724999999999998 30.7 20.025000000000002 22.55 5 24.325 34.75 21.925 19.0 6 19.85 35.099999999999994 22.975 22.075 7 16.05 21.4 41.275 21.275 8 21.575 19.8 28.599999999999998 30.025000000000002 9 21.325 19.575 32.125 26.974999999999998 10-14 22.975 27.61 24.33 25.085 15-19 22.93 26.400000000000002 25.174999999999997 25.495 20-24 23.14 25.35 25.105 26.405 25-29 23.435 25.869999999999997 25.419999999999998 25.275 30-34 23.845 25.314999999999998 25.525 25.314999999999998 35-39 22.994999999999997 25.64 24.88 26.484999999999996 40-44 22.395 25.61 26.064999999999998 25.929999999999996 45-49 23.61 25.52 24.975 25.895000000000003 50-54 23.150000000000002 25.47 24.64 26.740000000000002 55-59 23.705000000000002 25.71 24.92 25.665 60-64 23.74 25.380000000000003 25.195 25.685000000000002 65-69 23.315 25.89 25.235000000000003 25.56 70-74 23.59 25.419999999999998 25.580000000000002 25.41 75-79 23.45 25.845000000000002 25.135 25.569999999999997 80-84 24.005000000000003 25.295 24.73 25.97 85-89 24.310000000000002 25.314999999999998 24.805 25.569999999999997 90-94 23.72 25.005 24.83 26.445 95-99 23.36 24.779999999999998 25.669999999999998 26.19 100-104 23.74 25.295 24.505 26.46 105-109 23.44 25.169999999999998 25.03 26.36 110-114 24.13 25.169999999999998 24.875 25.825 115-119 23.415 24.9 25.405 26.279999999999998 120-124 24.245 25.374999999999996 24.54 25.840000000000003 125-129 23.799999999999997 25.09 25.28 25.83 130-134 23.855 24.68 25.245 26.22 135-139 24.265 24.47 25.324999999999996 25.94 140-144 23.905 25.1 24.64 26.355 145-149 24.505 25.380000000000003 24.72 25.395 150-151 24.425 24.712500000000002 23.6875 27.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 0.0 25 1.0 26 2.5 27 1.5 28 0.5 29 5.5 30 11.0 31 8.0 32 8.0 33 23.5 34 32.0 35 35.5 36 53.5 37 66.5 38 81.0 39 111.0 40 131.0 41 135.5 42 160.5 43 185.5 44 186.0 45 189.5 46 190.0 47 194.0 48 203.0 49 188.0 50 163.0 51 146.0 52 147.0 53 145.5 54 121.5 55 110.5 56 94.0 57 79.0 58 74.0 59 59.0 60 61.5 61 67.0 62 54.0 63 50.0 64 58.5 65 57.5 66 48.5 67 40.5 68 42.0 69 37.5 70 28.5 71 23.5 72 19.5 73 18.0 74 15.5 75 10.5 76 6.5 77 6.5 78 3.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.0260374288039 84.82499999999999 2 7.485760781122865 13.8 3 0.46107946840249525 1.275 4 0.027122321670735017 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.38749999999999996 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.825 0.0 0.0 0.0 0.0 126-127 0.95 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.2375 0.0 0.0 0.0 0.0 132-133 1.2999999999999998 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814943 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814943_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.461 37.0 37.0 37.0 37.0 37.0 2 36.0365 37.0 37.0 37.0 37.0 37.0 3 36.114 37.0 37.0 37.0 37.0 37.0 4 36.209 37.0 37.0 37.0 37.0 37.0 5 36.3105 37.0 37.0 37.0 37.0 37.0 6 36.116 37.0 37.0 37.0 37.0 37.0 7 36.078 37.0 37.0 37.0 37.0 37.0 8 36.2565 37.0 37.0 37.0 37.0 37.0 9 36.1855 37.0 37.0 37.0 37.0 37.0 10-14 36.1396 37.0 37.0 37.0 37.0 37.0 15-19 36.1137 37.0 37.0 37.0 37.0 37.0 20-24 36.047200000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.9775 37.0 37.0 37.0 37.0 37.0 30-34 35.9332 37.0 37.0 37.0 37.0 37.0 35-39 35.915499999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.8465 37.0 37.0 37.0 37.0 37.0 45-49 35.8071 37.0 37.0 37.0 37.0 37.0 50-54 35.646699999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.510200000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.5269 37.0 37.0 37.0 37.0 37.0 65-69 35.4936 37.0 37.0 37.0 37.0 37.0 70-74 35.401199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.3797 37.0 37.0 37.0 37.0 37.0 80-84 35.2306 37.0 37.0 37.0 29.8 37.0 85-89 35.2697 37.0 37.0 37.0 34.6 37.0 90-94 35.159499999999994 37.0 37.0 37.0 27.4 37.0 95-99 34.7016 37.0 37.0 37.0 25.0 37.0 100-104 34.7906 37.0 37.0 37.0 25.0 37.0 105-109 34.5918 37.0 37.0 37.0 25.0 37.0 110-114 34.65259999999999 37.0 37.0 37.0 25.0 37.0 115-119 34.7186 37.0 37.0 37.0 25.0 37.0 120-124 34.4188 37.0 37.0 37.0 25.0 37.0 125-129 34.544 37.0 37.0 37.0 25.0 37.0 130-134 34.1519 37.0 37.0 37.0 25.0 37.0 135-139 34.0238 37.0 37.0 37.0 25.0 37.0 140-144 34.3151 37.0 37.0 37.0 25.0 37.0 145-149 34.039 37.0 37.0 37.0 25.0 37.0 150-151 33.61 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 9.0 15 2.0 16 3.0 17 2.0 18 1.0 19 2.0 20 6.0 21 7.0 22 14.0 23 7.0 24 7.0 25 9.0 26 12.0 27 14.0 28 37.0 29 24.0 30 39.0 31 64.0 32 115.0 33 177.0 34 355.0 35 1017.0 36 2022.0 37 51.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.05 14.799999999999999 10.5 31.65 2 26.525 21.224999999999998 30.775000000000002 21.475 3 23.1 24.9 27.875 24.125 4 26.6 32.425 17.474999999999998 23.5 5 27.35 33.025 19.1 20.525 6 22.375 33.074999999999996 19.625 24.925 7 22.075 16.150000000000002 36.475 25.3 8 22.425 19.575 24.025 33.975 9 24.625 21.375 24.85 29.15 10-14 26.040000000000003 25.080000000000002 23.155 25.724999999999998 15-19 26.215 24.65 23.535 25.6 20-24 25.88 25.424999999999997 23.990000000000002 24.705 25-29 25.985000000000003 24.805 23.849999999999998 25.36 30-34 26.340000000000003 24.560000000000002 23.95 25.15 35-39 25.77 24.995 23.990000000000002 25.245 40-44 26.295 25.240000000000002 23.72 24.745 45-49 26.095000000000002 24.884999999999998 24.03 24.990000000000002 50-54 25.575 25.845000000000002 23.65 24.93 55-59 26.525 24.815 24.104999999999997 24.555 60-64 26.22 25.155 24.335 24.29 65-69 26.565 25.135 23.845 24.455 70-74 26.22 25.47 24.035 24.275 75-79 26.505000000000003 25.06 24.46 23.974999999999998 80-84 26.05 25.835 23.97 24.145 85-89 26.63 24.995 24.235 24.14 90-94 26.845000000000002 25.2 23.76 24.195 95-99 26.305 26.325 23.43 23.94 100-104 26.71 25.564999999999998 23.865 23.86 105-109 25.590000000000003 25.490000000000002 24.415 24.505 110-114 26.52 25.915 23.830000000000002 23.735 115-119 26.185000000000002 25.3 24.65 23.865 120-124 26.41 26.005 23.665 23.919999999999998 125-129 26.61 25.590000000000003 23.75 24.05 130-134 26.915 25.874999999999996 24.01 23.200000000000003 135-139 26.200000000000003 25.64 24.575 23.585 140-144 26.31 25.44 24.33 23.919999999999998 145-149 27.0 25.69 23.724999999999998 23.585 150-151 27.437499999999996 25.174999999999997 24.1875 23.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 1.5 12 1.5 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.5 21 1.5 22 0.5 23 1.0 24 1.5 25 1.5 26 1.0 27 1.5 28 2.0 29 4.0 30 7.0 31 9.0 32 11.5 33 15.0 34 21.5 35 30.5 36 34.5 37 43.5 38 61.0 39 72.5 40 96.0 41 120.0 42 139.0 43 159.5 44 173.5 45 186.5 46 204.0 47 192.5 48 174.0 49 176.5 50 156.0 51 134.5 52 125.0 53 116.5 54 122.0 55 115.0 56 105.0 57 102.5 58 90.5 59 80.0 60 76.5 61 77.5 62 79.0 63 86.0 64 75.5 65 61.0 66 60.5 67 60.0 68 61.5 69 57.5 70 49.5 71 38.0 72 26.5 73 20.0 74 18.5 75 16.0 76 12.0 77 8.0 78 2.0 79 2.0 80 1.5 81 0.5 82 2.5 83 2.5 84 1.0 85 0.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 92.10526315789474 84.875 2 7.37927292457949 13.600000000000001 3 0.4340748779164406 1.2 4 0.05425935973955508 0.2 5 0.02712967986977754 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0 0.0 0.0 0.0 0.025 76-77 0.0125 0.0 0.0 0.0 0.025 78-79 0.025 0.0 0.0 0.0 0.025 80-81 0.025 0.0 0.0 0.0 0.025 82-83 0.025 0.0 0.0 0.0 0.025 84-85 0.025 0.0 0.0 0.0 0.025 86-87 0.025 0.0 0.0 0.0 0.025 88-89 0.025 0.0 0.0 0.0 0.025 90-91 0.025 0.0 0.0 0.0 0.025 92-93 0.025 0.0 0.0 0.0 0.025 94-95 0.0625 0.0 0.0 0.0 0.025 96-97 0.1 0.0 0.0 0.0 0.025 98-99 0.1125 0.0 0.0 0.0 0.025 100-101 0.15 0.0 0.0 0.0 0.025 102-103 0.15 0.0 0.0 0.0 0.025 104-105 0.15 0.0 0.0 0.0 0.025 106-107 0.16249999999999998 0.0 0.0 0.0 0.025 108-109 0.2 0.0 0.0 0.0 0.025 110-111 0.2375 0.0 0.0 0.0 0.025 112-113 0.30000000000000004 0.0 0.0 0.0 0.025 114-115 0.38749999999999996 0.0 0.0 0.0 0.025 116-117 0.4375 0.0 0.0 0.0 0.025 118-119 0.475 0.0 0.0 0.0 0.025 120-121 0.55 0.0 0.0 0.0 0.025 122-123 0.7 0.0 0.0 0.0 0.025 124-125 0.75 0.0 0.0 0.0 0.025 126-127 0.875 0.0 0.0 0.0 0.025 128-129 0.975 0.0 0.0 0.0 0.025 130-131 1.1125 0.0 0.0 0.0 0.025 132-133 1.1749999999999998 0.0 0.0 0.0 0.025 134-135 1.25 0.0 0.0 0.0 0.025 136-137 1.375 0.0 0.0 0.0 0.025 138-139 1.5375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGCAC 10 0.006830828 145.0 5 >>END_MODULE Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281809 spots for SRR7814943.sra Written 2281809 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra Read 2281802 spots for SRR7814943.sra Written 2281802 spots for SRR7814943.sra SRR ids: ['SRR7814943.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_acbigpaa SRR7814943.sra spots: 45636047 blocks: [[1, 2281802], [2281803, 4563604], [4563605, 6845406], [6845407, 9127208], [9127209, 11409010], [11409011, 13690812], [13690813, 15972614], [15972615, 18254416], [18254417, 20536218], [20536219, 22818020], [22818021, 25099822], [25099823, 27381624], [27381625, 29663426], [29663427, 31945228], [31945229, 34227030], [34227031, 36508832], [36508833, 38790634], [38790635, 41072436], [41072437, 43354238], [43354239, 45636047]] SRR7814943 file size 15442858 SRR7814943 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814943 SRR7814943_1.fastq SRR7814943_2.fastq Input file: SRR7814943_1.fastq Paired file: SRR7814943_2.fastq trimmed: SRR7814943-trimmed-pair1.fastq, SRR7814943-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:30:10 2024 >> started Sat Dec 7 04:44:35 2024 >> done (864.962s) 45636047 read pairs processed; of these: 129 ( 0.00%) short read pairs filtered out after trimming by size control 6625 ( 0.01%) empty read pairs filtered out after trimming by size control 45629293 (99.99%) read pairs available; of these: 1231258 ( 2.70%) trimmed read pairs available after processing 44398035 (97.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 16 0.00% 20 25 0.00% 21 24 0.00% 22 26 0.00% 23 24 0.00% 24 43 0.00% 25 46 0.00% 26 41 0.00% 27 46 0.00% 28 47 0.00% 29 50 0.00% 30 62 0.00% 31 61 0.00% 32 75 0.00% 33 50 0.00% 34 71 0.00% 35 70 0.00% 36 72 0.00% 37 77 0.00% 38 92 0.00% 39 86 0.00% 40 87 0.00% 41 77 0.00% 42 92 0.00% 43 106 0.00% 44 97 0.00% 45 101 0.00% 46 123 0.00% 47 101 0.00% 48 119 0.00% 49 134 0.00% 50 108 0.00% 51 119 0.00% 52 124 0.00% 53 159 0.00% 54 165 0.00% 55 165 0.00% 56 159 0.00% 57 189 0.00% 58 205 0.00% 59 203 0.00% 60 230 0.00% 61 215 0.00% 62 208 0.00% 63 232 0.00% 64 270 0.00% 65 277 0.00% 66 283 0.00% 67 326 0.00% 68 312 0.00% 69 386 0.00% 70 425 0.00% 71 447 0.00% 72 498 0.00% 73 577 0.00% 74 562 0.00% 75 635 0.00% 76 637 0.00% 77 745 0.00% 78 801 0.00% 79 877 0.00% 80 964 0.00% 81 1043 0.00% 82 1245 0.00% 83 1414 0.00% 84 1507 0.00% 85 1547 0.00% 86 1770 0.00% 87 1830 0.00% 88 2186 0.00% 89 2260 0.00% 90 2512 0.01% 91 2887 0.01% 92 2986 0.01% 93 3381 0.01% 94 3740 0.01% 95 3899 0.01% 96 4246 0.01% 97 4499 0.01% 98 4834 0.01% 99 5267 0.01% 100 5418 0.01% 101 5884 0.01% 102 6355 0.01% 103 7022 0.02% 104 7245 0.02% 105 7865 0.02% 106 8327 0.02% 107 8538 0.02% 108 9127 0.02% 109 9428 0.02% 110 10054 0.02% 111 10542 0.02% 112 11390 0.02% 113 12008 0.03% 114 12726 0.03% 115 13206 0.03% 116 13743 0.03% 117 14643 0.03% 118 14967 0.03% 119 15492 0.03% 120 16184 0.04% 121 16855 0.04% 122 17594 0.04% 123 18914 0.04% 124 19928 0.04% 125 20665 0.05% 126 21468 0.05% 127 22224 0.05% 128 22573 0.05% 129 23801 0.05% 130 24354 0.05% 131 25125 0.06% 132 26834 0.06% 133 27928 0.06% 134 29065 0.06% 135 30164 0.07% 136 31440 0.07% 137 32121 0.07% 138 33317 0.07% 139 34082 0.07% 140 35312 0.08% 141 36222 0.08% 142 38295 0.08% 143 39311 0.09% 144 40982 0.09% 145 42666 0.09% 146 44499 0.10% 147 45250 0.10% 148 46415 0.10% 149 47343 0.10% 150 49637 0.11% 151 44398035 97.30% 45629293 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=4.71 fanout-score-rank=27 prefix-density=0.17 prefix-fanout=3.8 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=33 fanout-score=240.71 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=20.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=32 prefix-density=0.46 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=713.58 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=22.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814943 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 04:50:45 Started mapping on | Dec 07 04:50:45 Finished on | Dec 07 05:06:35 Mapping speed, Million of reads per hour | 172.91 Number of input reads | 45629293 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 41943672 Uniquely mapped reads % | 91.92% Average mapped length | 300.02 Number of splices: Total | 42153300 Number of splices: Annotated (sjdb) | 39610919 Number of splices: GT/AG | 41622990 Number of splices: GC/AG | 462718 Number of splices: AT/AC | 31625 Number of splices: Non-canonical | 35967 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461770 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 52502 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.26% % of reads unmapped: other | 0.69% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3223851 3223851 3223851 N_multimapping 461770 461770 461770 N_noFeature 1329298 40852629 1669827 N_ambiguous 870848 6467 121845 UnstrandedReadsAssigned:39743526 PositiveStrandReadsAssigned:1084576 NegativeStrandReadsAssigned:40152000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814943 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814943-trimmed-pair1.fastq SRR7814943-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 45,629,293 reads, 40,915,878 reads pseudoaligned [quant] estimated average fragment length: 310.769 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR7814943.ke.tsv 35125 SRR7814943.se.tsv 88098 total ==> SRR7814943.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 627.073 0 0 PNS24247 1044 734.231 187.962 8.56623 PNS24249 1928 1618.23 252.31 5.21728 PNS24246 1044 734.231 187.962 8.56623 PNS24248 1044 734.231 187.962 8.56623 PNS24244 1471 1161.23 396.803 11.4343 PNS24243 293 71.349 0 0 KQK14069 1603 1293.23 4593.49 118.855 KQK14071 474 196.344 1.83157 0.312146 ==> SRR7814943.se.tsv <== BRADI_1g14170v3 4600 BRADI_1g53295v3 482 BRADI_1g59795v3 729 BRADI_1g07683v3 0 BRADI_1g00485v3 90 BRADI_1g20270v3 3770 BRADI_1g74790v3 574 BRADI_1g09890v3 11 BRADI_1g77505v3 394 BRADI_1g48960v3 0 SRR7814943 completed mapping pipeline successfully