Starting /dee2/code/volunteer_pipeline.sh SRR7814945 current disk space = 1515913072640 free memory = 1592598136 SRR7814945 SRAfilesize ee90162f9bf7f6e9eadf050d3f4482f5 SRR7814945.sra SRR7814945.sra file validated SRR7814945 is paired end SRR7814945 is conventional basespace SRR7814945 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814945_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4085 37.0 37.0 37.0 37.0 37.0 2 36.3595 37.0 37.0 37.0 37.0 37.0 3 36.4675 37.0 37.0 37.0 37.0 37.0 4 36.57 37.0 37.0 37.0 37.0 37.0 5 36.5245 37.0 37.0 37.0 37.0 37.0 6 36.5165 37.0 37.0 37.0 37.0 37.0 7 36.4025 37.0 37.0 37.0 37.0 37.0 8 36.5685 37.0 37.0 37.0 37.0 37.0 9 36.553 37.0 37.0 37.0 37.0 37.0 10-14 36.5771 37.0 37.0 37.0 37.0 37.0 15-19 36.5353 37.0 37.0 37.0 37.0 37.0 20-24 36.5028 37.0 37.0 37.0 37.0 37.0 25-29 36.47619999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.481500000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5017 37.0 37.0 37.0 37.0 37.0 40-44 36.4627 37.0 37.0 37.0 37.0 37.0 45-49 36.4303 37.0 37.0 37.0 37.0 37.0 50-54 36.349599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3606 37.0 37.0 37.0 37.0 37.0 60-64 36.2897 37.0 37.0 37.0 37.0 37.0 65-69 36.2807 37.0 37.0 37.0 37.0 37.0 70-74 36.226299999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.222899999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.16610000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.153800000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.080799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.099599999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.994099999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.0264 37.0 37.0 37.0 37.0 37.0 110-114 35.9705 37.0 37.0 37.0 37.0 37.0 115-119 35.9654 37.0 37.0 37.0 37.0 37.0 120-124 35.842999999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.744099999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.6347 37.0 37.0 37.0 37.0 37.0 135-139 35.67909999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.6148 37.0 37.0 37.0 37.0 37.0 145-149 35.460699999999996 37.0 37.0 37.0 34.6 37.0 150-151 34.807249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 0.0 25 3.0 26 6.0 27 6.0 28 11.0 29 15.0 30 27.0 31 46.0 32 49.0 33 87.0 34 153.0 35 414.0 36 2939.0 37 242.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.16024036054081 13.169754631947923 9.514271407110666 37.1557336004006 2 25.900000000000002 17.4 33.7 23.0 3 23.150000000000002 25.174999999999997 23.0 28.675 4 25.474999999999998 31.15 19.950000000000003 23.425 5 24.775 33.050000000000004 22.400000000000002 19.775000000000002 6 20.625 34.175 22.400000000000002 22.8 7 16.2 20.200000000000003 42.35 21.25 8 21.55 20.7 27.075 30.675 9 20.325 20.0 31.075000000000003 28.599999999999998 10-14 23.34 26.224999999999998 24.46 25.974999999999998 15-19 23.05 25.27 25.69 25.990000000000002 20-24 23.44 25.31 25.505 25.745 25-29 23.56 25.240000000000002 25.1 26.1 30-34 23.74 25.2 25.145 25.915 35-39 23.880000000000003 24.93 25.14 26.05 40-44 23.419999999999998 24.68 25.31 26.590000000000003 45-49 23.72 24.615000000000002 25.52 26.145000000000003 50-54 24.125 24.555 25.650000000000002 25.669999999999998 55-59 23.765 24.995 24.94 26.3 60-64 24.060000000000002 24.595 25.1 26.245 65-69 24.395 25.305 24.52 25.779999999999998 70-74 23.515 24.740000000000002 25.305 26.44 75-79 24.275 24.98 24.490000000000002 26.255 80-84 24.545 24.605 24.8 26.05 85-89 24.115000000000002 25.14 24.815 25.929999999999996 90-94 24.57 24.82 24.349999999999998 26.26 95-99 24.305 24.875 24.575 26.245 100-104 23.845 25.1 24.485 26.57 105-109 24.23 24.055 25.41 26.305 110-114 24.245 25.155 24.42 26.179999999999996 115-119 23.75 24.85 24.89 26.51 120-124 24.34 24.385 24.815 26.46 125-129 24.82 23.96 24.975 26.245 130-134 24.46 24.7 25.019999999999996 25.82 135-139 24.349999999999998 24.4 24.83 26.419999999999998 140-144 24.740000000000002 24.63 24.525 26.105 145-149 24.905 24.44 24.240000000000002 26.415 150-151 25.4375 24.375 24.325 25.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 2.5 28 3.5 29 1.5 30 3.0 31 6.0 32 14.0 33 23.0 34 24.0 35 30.0 36 41.0 37 61.5 38 85.5 39 99.5 40 111.5 41 133.5 42 150.0 43 164.0 44 178.5 45 191.5 46 202.5 47 197.5 48 196.5 49 189.5 50 180.5 51 152.0 52 130.5 53 132.0 54 112.0 55 97.5 56 97.0 57 88.5 58 85.0 59 86.0 60 70.5 61 55.0 62 58.0 63 76.0 64 71.5 65 54.5 66 52.0 67 52.5 68 45.5 69 34.5 70 29.0 71 29.0 72 25.5 73 16.5 74 19.5 75 16.0 76 5.0 77 4.0 78 5.0 79 3.5 80 1.0 81 2.0 82 2.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.75 #Duplication Level Percentage of deduplicated Percentage of total 1 91.9891008174387 84.39999999999999 2 7.138964577656676 13.100000000000001 3 0.7901907356948229 2.175 4 0.05449591280653951 0.2 5 0.027247956403269755 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGATTTCAGGCCACCAAAGTAGCGGTTAAGGACATCAACCTCCTCAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.7375 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.3 0.0 0.0 0.0 0.0 126-127 1.4249999999999998 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 1.975 0.0 0.0 0.0 0.0 134-135 2.275 0.0 0.0 0.0 0.0 136-137 2.5250000000000004 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGACGT 10 0.006830828 145.0 1 >>END_MODULE SRR7814945 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814945_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.266 37.0 37.0 37.0 37.0 37.0 2 35.974 37.0 37.0 37.0 37.0 37.0 3 36.001 37.0 37.0 37.0 37.0 37.0 4 36.2035 37.0 37.0 37.0 37.0 37.0 5 36.145 37.0 37.0 37.0 37.0 37.0 6 35.9935 37.0 37.0 37.0 37.0 37.0 7 36.044 37.0 37.0 37.0 37.0 37.0 8 36.23 37.0 37.0 37.0 37.0 37.0 9 36.0915 37.0 37.0 37.0 37.0 37.0 10-14 36.1871 37.0 37.0 37.0 37.0 37.0 15-19 36.0585 37.0 37.0 37.0 37.0 37.0 20-24 36.1092 37.0 37.0 37.0 37.0 37.0 25-29 36.018100000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.98180000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.921800000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.802499999999995 37.0 37.0 37.0 37.0 37.0 45-49 35.769 37.0 37.0 37.0 37.0 37.0 50-54 35.6267 37.0 37.0 37.0 37.0 37.0 55-59 35.49980000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.6155 37.0 37.0 37.0 37.0 37.0 65-69 35.5564 37.0 37.0 37.0 37.0 37.0 70-74 35.4652 37.0 37.0 37.0 37.0 37.0 75-79 35.425399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.286199999999994 37.0 37.0 37.0 32.2 37.0 85-89 35.3309 37.0 37.0 37.0 34.6 37.0 90-94 35.1536 37.0 37.0 37.0 29.8 37.0 95-99 34.73350000000001 37.0 37.0 37.0 25.0 37.0 100-104 34.8079 37.0 37.0 37.0 25.0 37.0 105-109 34.5895 37.0 37.0 37.0 25.0 37.0 110-114 34.6382 37.0 37.0 37.0 25.0 37.0 115-119 34.6554 37.0 37.0 37.0 25.0 37.0 120-124 34.3472 37.0 37.0 37.0 25.0 37.0 125-129 34.472300000000004 37.0 37.0 37.0 25.0 37.0 130-134 34.012499999999996 37.0 37.0 37.0 25.0 37.0 135-139 33.9169 37.0 37.0 37.0 25.0 37.0 140-144 34.14359999999999 37.0 37.0 37.0 25.0 37.0 145-149 33.8627 37.0 37.0 37.0 25.0 37.0 150-151 33.132999999999996 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 6.0 15 3.0 16 3.0 17 3.0 18 3.0 19 0.0 20 5.0 21 4.0 22 5.0 23 6.0 24 10.0 25 6.0 26 11.0 27 14.0 28 31.0 29 27.0 30 45.0 31 73.0 32 122.0 33 211.0 34 414.0 35 1027.0 36 1911.0 37 55.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.425 14.875 12.625 33.074999999999996 2 31.275 19.425 27.775 21.525 3 24.925 24.6 26.174999999999997 24.3 4 28.749999999999996 30.5 18.0 22.75 5 28.375 32.15 17.974999999999998 21.5 6 21.95 34.675 19.775000000000002 23.599999999999998 7 20.974999999999998 16.675 36.9 25.45 8 23.525 20.375 22.6 33.5 9 24.625 21.4 25.825 28.15 10-14 25.245 25.585 22.655 26.515 15-19 25.97 24.715 23.599999999999998 25.715 20-24 25.85 24.83 24.025 25.295 25-29 26.145000000000003 25.35 23.395 25.11 30-34 25.66 25.55 23.82 24.97 35-39 25.97 25.0 23.605 25.424999999999997 40-44 25.745 25.2 23.945 25.11 45-49 26.145000000000003 24.915000000000003 23.369999999999997 25.569999999999997 50-54 26.16 24.695 23.7 25.445 55-59 26.665 24.985 23.565 24.785 60-64 26.369999999999997 24.565 23.485 25.580000000000002 65-69 26.179999999999996 25.779999999999998 23.05 24.990000000000002 70-74 26.075 25.014999999999997 23.53 25.380000000000003 75-79 26.950000000000003 25.224999999999998 23.46 24.365000000000002 80-84 26.41 25.6 23.119999999999997 24.87 85-89 27.22 25.03 23.330000000000002 24.42 90-94 26.645000000000003 25.119999999999997 23.935000000000002 24.3 95-99 26.650000000000002 25.115 23.68 24.555 100-104 27.02 24.725 23.3 24.955 105-109 26.68 25.22 23.41 24.69 110-114 26.419999999999998 25.130000000000003 23.44 25.009999999999998 115-119 26.77 26.1 23.150000000000002 23.98 120-124 27.07 25.480000000000004 23.635 23.815 125-129 26.905 24.595 24.13 24.37 130-134 27.029999999999998 25.965 22.905 24.099999999999998 135-139 26.47 24.89 23.895 24.745 140-144 26.950000000000003 25.785000000000004 23.425 23.84 145-149 26.68 25.019999999999996 23.990000000000002 24.310000000000002 150-151 27.0875 25.662499999999998 23.6625 23.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 1.0 26 1.5 27 1.0 28 3.0 29 7.5 30 8.0 31 8.5 32 11.0 33 12.0 34 17.5 35 25.5 36 31.5 37 43.0 38 59.0 39 64.0 40 79.5 41 120.0 42 152.0 43 159.0 44 170.5 45 182.0 46 184.0 47 184.5 48 181.5 49 162.5 50 149.0 51 149.5 52 138.0 53 124.0 54 120.5 55 110.5 56 87.5 57 85.0 58 99.0 59 93.0 60 79.5 61 83.5 62 73.5 63 67.0 64 71.0 65 70.5 66 76.0 67 74.0 68 64.5 69 61.5 70 50.5 71 43.5 72 40.5 73 30.5 74 24.0 75 17.0 76 12.0 77 6.5 78 5.0 79 4.5 80 2.5 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 92.26579520697167 84.7 2 6.835511982570806 12.55 3 0.6808278867102396 1.875 4 0.13616557734204793 0.5 5 0.08169934640522876 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTATCTACTCTCAGAAGATTGTGATCAAGACCTGTGGGACTACCATGC 5 0.125 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5375000000000001 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.2 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAAAC 10 0.006830828 145.0 9 GACTTTT 10 0.006830828 145.0 1 GCTTAAT 10 0.006830828 145.0 1 >>END_MODULE Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842924 spots for SRR7814945.sra Written 1842924 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra Read 1842909 spots for SRR7814945.sra Written 1842909 spots for SRR7814945.sra SRR ids: ['SRR7814945.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fqjg9ieo SRR7814945.sra spots: 36858195 blocks: [[1, 1842909], [1842910, 3685818], [3685819, 5528727], [5528728, 7371636], [7371637, 9214545], [9214546, 11057454], [11057455, 12900363], [12900364, 14743272], [14743273, 16586181], [16586182, 18429090], [18429091, 20271999], [20272000, 22114908], [22114909, 23957817], [23957818, 25800726], [25800727, 27643635], [27643636, 29486544], [29486545, 31329453], [31329454, 33172362], [33172363, 35015271], [35015272, 36858195]] SRR7814945 file size 12468332 SRR7814945 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814945 SRR7814945_1.fastq SRR7814945_2.fastq Input file: SRR7814945_1.fastq Paired file: SRR7814945_2.fastq trimmed: SRR7814945-trimmed-pair1.fastq, SRR7814945-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:36:36 2024 >> started Thu Dec 12 02:37:19 2024 >> done (43.257s) 36858195 read pairs processed; of these: 114 ( 0.00%) short read pairs filtered out after trimming by size control 1513 ( 0.00%) empty read pairs filtered out after trimming by size control 36856568 (100.00%) read pairs available; of these: 1694384 ( 4.60%) trimmed read pairs available after processing 35162184 (95.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 20 0.00% 20 18 0.00% 21 22 0.00% 22 21 0.00% 23 35 0.00% 24 33 0.00% 25 31 0.00% 26 35 0.00% 27 39 0.00% 28 56 0.00% 29 60 0.00% 30 63 0.00% 31 57 0.00% 32 65 0.00% 33 45 0.00% 34 49 0.00% 35 74 0.00% 36 71 0.00% 37 79 0.00% 38 86 0.00% 39 73 0.00% 40 73 0.00% 41 83 0.00% 42 95 0.00% 43 95 0.00% 44 82 0.00% 45 116 0.00% 46 104 0.00% 47 82 0.00% 48 115 0.00% 49 114 0.00% 50 125 0.00% 51 123 0.00% 52 124 0.00% 53 139 0.00% 54 158 0.00% 55 149 0.00% 56 172 0.00% 57 163 0.00% 58 198 0.00% 59 200 0.00% 60 219 0.00% 61 209 0.00% 62 219 0.00% 63 203 0.00% 64 267 0.00% 65 243 0.00% 66 278 0.00% 67 316 0.00% 68 356 0.00% 69 356 0.00% 70 406 0.00% 71 469 0.00% 72 490 0.00% 73 516 0.00% 74 605 0.00% 75 707 0.00% 76 764 0.00% 77 824 0.00% 78 919 0.00% 79 1102 0.00% 80 1121 0.00% 81 1298 0.00% 82 1471 0.00% 83 1629 0.00% 84 1800 0.00% 85 1970 0.01% 86 2120 0.01% 87 2357 0.01% 88 2635 0.01% 89 2933 0.01% 90 3101 0.01% 91 3521 0.01% 92 3838 0.01% 93 4323 0.01% 94 4712 0.01% 95 5099 0.01% 96 5436 0.01% 97 5859 0.02% 98 6323 0.02% 99 6743 0.02% 100 7340 0.02% 101 7915 0.02% 102 8799 0.02% 103 9262 0.03% 104 10050 0.03% 105 10650 0.03% 106 11152 0.03% 107 11440 0.03% 108 12360 0.03% 109 13009 0.04% 110 13503 0.04% 111 14692 0.04% 112 15765 0.04% 113 16541 0.04% 114 17662 0.05% 115 18244 0.05% 116 19068 0.05% 117 19677 0.05% 118 20828 0.06% 119 21538 0.06% 120 22600 0.06% 121 23635 0.06% 122 25132 0.07% 123 26340 0.07% 124 27781 0.08% 125 28953 0.08% 126 29957 0.08% 127 31111 0.08% 128 32321 0.09% 129 33330 0.09% 130 34267 0.09% 131 35659 0.10% 132 37854 0.10% 133 39598 0.11% 134 41144 0.11% 135 42592 0.12% 136 44179 0.12% 137 45249 0.12% 138 46435 0.13% 139 47960 0.13% 140 48451 0.13% 141 50688 0.14% 142 52806 0.14% 143 53853 0.15% 144 56969 0.15% 145 58984 0.16% 146 60031 0.16% 147 61871 0.17% 148 62725 0.17% 149 64432 0.17% 150 66671 0.18% 151 35162184 95.40% 36856568 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=2.6 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=306.83 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=25.3 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=25 prefix-density=0.73 prefix-fanout=3.0 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=824.84 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=23.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814945 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:38:38 Started mapping on | Dec 12 02:38:39 Finished on | Dec 12 02:43:57 Mapping speed, Million of reads per hour | 417.24 Number of input reads | 36856568 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 33575014 Uniquely mapped reads % | 91.10% Average mapped length | 298.99 Number of splices: Total | 33614964 Number of splices: Annotated (sjdb) | 31454860 Number of splices: GT/AG | 33187322 Number of splices: GC/AG | 380844 Number of splices: AT/AC | 19476 Number of splices: Non-canonical | 27322 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299743 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 35718 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.33% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2981811 2981811 2981811 N_multimapping 299743 299743 299743 N_noFeature 1002067 32719710 1282216 N_ambiguous 682736 5349 109755 UnstrandedReadsAssigned:31890211 PositiveStrandReadsAssigned:849955 NegativeStrandReadsAssigned:32183043 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814945 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814945-trimmed-pair1.fastq SRR7814945-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,856,568 reads, 32,756,234 reads pseudoaligned [quant] estimated average fragment length: 290.901 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,212 rounds 52973 SRR7814945.ke.tsv 35125 SRR7814945.se.tsv 88098 total ==> SRR7814945.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 646.994 0 0 PNS24247 1044 754.099 210.38 11.9617 PNS24249 1928 1638.1 326.126 8.53613 PNS24246 1044 754.099 210.38 11.9617 PNS24248 1044 754.099 210.38 11.9617 PNS24244 1471 1181.1 334.732 12.1514 PNS24243 293 80.9897 3 1.58821 KQK14069 1603 1313.1 13287.8 433.88 KQK14071 474 212.598 354.059 71.4054 ==> SRR7814945.se.tsv <== BRADI_1g14170v3 14753 BRADI_1g53295v3 263 BRADI_1g59795v3 585 BRADI_1g07683v3 0 BRADI_1g00485v3 18 BRADI_1g20270v3 2817 BRADI_1g74790v3 471 BRADI_1g09890v3 0 BRADI_1g77505v3 355 BRADI_1g48960v3 0 SRR7814945 completed mapping pipeline successfully