Starting /dee2/code/volunteer_pipeline.sh SRR7814946 current disk space = 2825397784576 free memory = 1575303444 SRR7814946_1.fastq is conventional basespace SRR7814946_1.fastq read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814946_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 42780861 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 4.2780861E7 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.85419759942001 13.077957633718624 9.355420547553187 32.712424219308176 2 25.926352977674817 16.29293053625348 32.34307513963832 25.43764134643338 3 23.007610809889965 24.08794437306907 24.243228765311667 28.661216051729298 4 27.82685696765196 29.18387266679836 20.365824334391025 22.623446031158654 5 26.098803855303427 31.52477459488251 21.56556643401824 20.810855115795825 6 22.256309895212254 32.20427003561242 22.250770034759235 23.288650034416094 7 17.856957109862748 19.658491679258162 41.00896894057368 21.475582270305406 8 21.288262524683642 20.004644132805087 26.729431649353668 31.9776616931576 9 21.531139824418215 19.276638681956403 30.18111066067604 29.011110832949345 10-14 24.169702428382635 25.09497038874463 24.071493091268078 26.663834091604656 15-19 24.319114568545032 24.4005659446639 24.629308419014755 26.651011067776313 20-24 24.289354999189943 24.46284893611655 24.644741020990672 26.603055043702838 25-29 24.367588581258335 24.389892947689855 24.538938568814686 26.703579902237124 30-34 24.39100278977555 24.26907490244294 24.62263253654479 26.717289771236725 35-39 24.43565707738594 24.219313595362824 24.49838653309883 26.8466427941524 40-44 24.5600367884134 24.205122472874027 24.465062542803896 26.76977819590868 45-49 24.491046124574257 24.208430026688806 24.33328305384036 26.96724079489658 50-54 24.55651558765963 24.095945614558808 24.246470401799534 27.101068395982026 55-59 24.716055621227444 24.1406992720413 24.14729614721873 26.99594895951253 60-64 24.85558717483503 23.936629045404207 24.098007751643895 27.109776028116872 65-69 24.82937779115759 23.889580903946744 24.155295051214605 27.125746253681054 70-74 24.975978255378482 23.895013071137097 24.053372344208395 27.07563632927602 75-79 25.048501478266182 23.787883090992487 24.013871530075097 27.149743900666234 80-84 25.04082094093431 23.772379429203166 24.042240290582274 27.144559339280246 85-89 25.195884673756332 23.69191868298303 23.987146027752924 27.125050615507718 90-94 25.330428015462335 23.70359493232266 23.92745578449204 27.038521267722963 95-99 25.310340320575246 23.54372028083757 23.995001558804663 27.150937839782518 100-104 25.41661842663709 23.633814195558152 23.802713087050773 27.146854290753993 105-109 25.489421075466435 23.441851252128842 23.906024705767376 27.162702966637347 110-114 25.43591584096449 23.510149082787276 23.88678011880126 27.167154957446975 115-119 25.537171867578824 23.295632128581982 23.862024656306005 27.305171347533186 120-124 25.546984560945152 23.372616168084424 23.755464381742286 27.324934889228143 125-129 25.568496622823933 23.25684469043295 23.835030809688472 27.33962787705465 130-134 25.868106301086367 23.231995260684446 23.72801099070914 27.17188744752005 135-139 25.767589630957545 23.209810323451045 23.736941841698247 27.28565820389317 140-144 25.922574115560693 23.080675258031857 23.73862087534891 27.25812975105854 145-149 25.90602455233772 23.129165137068906 23.680924563101883 27.28388574749149 150-151 26.237245435523143 22.912106654421937 23.459083724378527 27.391564185676394 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8577.0 1 5621.0 2 2181.0 3 1559.5 4 1345.5 5 1283.5 6 1202.5 7 1085.5 8 1040.5 9 973.5 10 925.0 11 912.0 12 883.0 13 881.5 14 902.5 15 900.0 16 915.5 17 929.0 18 986.5 19 1165.0 20 1515.0 21 1954.0 22 2438.5 23 3576.5 24 5421.0 25 8124.0 26 12050.5 27 19111.0 28 28588.0 29 41289.5 30 61098.0 31 90333.5 32 127315.0 33 178584.5 34 244742.0 35 327218.5 36 428709.0 37 560874.0 38 712817.0 39 883823.0 40 1077964.5 41 1285778.0 42 1473223.5 43 1601145.0 44 1690742.0 45 1756828.0 46 1780584.5 47 1750743.0 48 1689633.0 49 1638082.5 50 1576261.0 51 1479292.0 52 1357456.5 53 1250915.0 54 1174358.0 55 1131314.0 56 1116848.0 57 1077617.5 58 1032458.5 59 1023656.0 60 1031630.0 61 1005475.5 62 931328.0 63 875567.0 64 892931.5 65 878562.0 66 810264.5 67 757594.5 68 697131.5 69 624747.0 70 549556.5 71 460098.5 72 375751.0 73 309913.0 74 254931.0 75 193041.0 76 132698.5 77 93811.5 78 65564.0 79 43734.0 80 27647.5 81 16226.0 82 9142.0 83 4578.5 84 2085.0 85 940.5 86 446.0 87 225.5 88 146.0 89 92.5 90 54.0 91 48.5 92 39.5 93 36.0 94 35.0 95 31.0 96 35.5 97 40.0 98 86.0 99 91.5 100 33.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.013903413491374098 2 0.016282982242924002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 4.674987724066611E-6 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 8.929226552967225E-5 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 8.414977903319898E-6 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.06371868018271068 125-129 0.0 130-134 0.0 135-139 9.349975448133219E-7 140-144 0.0 145-149 1.402496317219983E-5 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4.2780861E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 21.646248785034945 #Duplication Level Percentage of deduplicated Percentage of total 1 55.44161398827111 12.001029694339898 2 17.262094466593673 7.473191827493235 3 8.127594440148835 5.277957938259855 4 4.578375527487922 3.9641862279727667 5 2.833172397934838 3.0663777288295764 6 1.9383517400733203 2.517482639911949 7 1.471030390475631 2.228960286180783 8 1.074692024394986 1.8610440741877368 9 0.8586966438658149 1.6728805065594585 >10 5.4742942174508595 22.701702075924413 >50 0.520938725126765 7.8370876423023645 >100 0.3625770171917261 15.428803706317455 >500 0.03683942144114942 5.4696023904442175 >1k 0.01892808815975832 7.270814308069696 >5k 7.172340778835789E-4 1.0031366623075662 >10k+ 8.36773055929063E-5 0.22574229089910633 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.4959960717013152E-4 0.0 0.0 0.0 2.337493862033305E-6 2 1.4959960717013152E-4 4.67498772406661E-6 2.337493862033305E-6 0.0 2.3374938620333052E-5 3 1.5193710103216483E-4 7.012481586099915E-6 2.337493862033305E-6 0.0 3.0387420206432966E-5 4 1.7297454579046458E-4 1.1687469310166526E-5 2.337493862033305E-6 4.67498772406661E-6 3.0387420206432966E-5 5 1.823245212385978E-4 1.1687469310166526E-5 1.402496317219983E-5 7.012481586099915E-6 3.506240793049958E-5 6 1.893370028246977E-4 1.1687469310166526E-5 1.402496317219983E-5 9.34997544813322E-6 3.739990179253288E-5 7 1.9868697827283094E-4 1.6362457034233135E-5 1.6362457034233135E-5 9.34997544813322E-6 4.207488951659949E-5 8 2.0803695372096414E-4 1.6362457034233135E-5 2.1037444758299744E-5 1.1687469310166526E-5 5.609985268879932E-5 9 2.314118923412972E-4 1.6362457034233135E-5 2.5712432482366357E-5 1.402496317219983E-5 6.311233427489924E-5 10-11 2.559555778926469E-4 3.038742020643297E-5 2.5712432482366357E-5 1.5193710103216483E-5 9.817474220539881E-5 12-13 2.8868049196111316E-4 3.623115486151623E-5 3.739990179253288E-5 1.6362457034233135E-5 1.3440589706691504E-4 14-15 3.167304183055128E-4 3.973739565456619E-5 3.973739565456619E-5 1.869995089626644E-5 1.975182313418143E-4 16-17 3.634802955461789E-4 3.973739565456619E-5 4.6749877240666104E-5 2.5712432482366357E-5 2.746555287889133E-4 18-19 4.2659262982107816E-4 4.090614258558284E-5 5.609985268879932E-5 3.389366099948293E-5 2.933554796851798E-4 20-21 4.745112539927609E-4 4.207488951659949E-5 6.778732199896585E-5 3.973739565456619E-5 3.1322417751246287E-4 22-23 5.446360698537601E-4 4.4412383378632796E-5 7.713729744709906E-5 4.4412383378632796E-5 3.6932403020126215E-4 24-25 6.474857997832255E-4 4.6749877240666104E-5 8.298103210218233E-5 5.4931105757782665E-5 4.581487969585278E-4 26-27 7.550105174367575E-4 4.6749877240666104E-5 9.817474220539881E-5 5.609985268879932E-5 4.815237355788608E-4 28-29 8.660414758833396E-4 4.6749877240666104E-5 1.0284972992946543E-4 5.726859961981597E-5 4.897049640959774E-4 30-31 0.0010039536137433046 4.6749877240666104E-5 1.0284972992946543E-4 5.843734655083262E-5 5.072361680612271E-4 32-33 0.0011512157270514027 4.6749877240666104E-5 1.0284972992946543E-4 6.428108120591588E-5 5.177548904403771E-4 34-35 0.0012832841302562845 4.6749877240666104E-5 1.0401847686048208E-4 7.479980358506576E-5 5.21261131233427E-4 36-37 0.0014469087005986158 4.6749877240666104E-5 1.2154968082573186E-4 7.713729744709906E-5 5.282736128195269E-4 38-39 0.0016526081604575468 4.6749877240666104E-5 1.2622466854979848E-4 8.531852596421563E-5 5.306111066815602E-4 40-41 0.0018548013795234275 4.6749877240666104E-5 1.2622466854979848E-4 9.466850141234885E-5 5.376235882676602E-4 42-43 0.0020301134191759254 4.6749877240666104E-5 1.2622466854979848E-4 9.817474220539881E-5 5.551547922329099E-4 44-45 0.002251006589138073 4.6749877240666104E-5 1.3440589706691504E-4 9.817474220539881E-5 5.867109593703596E-4 46-47 0.002476574746824287 4.6749877240666104E-5 1.4492461944606491E-4 9.934348913641545E-5 6.264483550249257E-4 48-49 0.002737205312441 4.7918624171682755E-5 1.4492461944606491E-4 1.0518722379149873E-4 6.369670774040756E-4 50-51 0.0030492607430224463 4.9087371102699405E-5 1.601183295492814E-4 1.157059461706486E-4 6.474857997832255E-4 52-53 0.003392872340741342 4.9087371102699405E-5 1.7297454579046458E-4 1.3089965627386508E-4 6.650170037484752E-4 54-55 0.0036990840366677054 4.9087371102699405E-5 1.8115577430758114E-4 1.4024963172199828E-4 6.872231954377916E-4 56-57 0.004140870376592 4.9087371102699405E-5 1.8699950896266442E-4 1.425871255840316E-4 7.222856033682913E-4 58-59 0.00466797524248051 4.9087371102699405E-5 1.893370028246977E-4 1.425871255840316E-4 7.421543011955744E-4 60-61 0.0051471614841973375 5.2593611895749364E-5 2.045307129279142E-4 1.4375587251504824E-4 8.157853578496235E-4 62-63 0.005807503500221746 5.726859961981597E-5 2.1271194144503074E-4 1.5076835410114816E-4 8.450040311250397E-4 64-65 0.006486545467142422 6.544982813693254E-5 2.45436855513497E-4 1.5894958261826475E-4 8.520165127111397E-4 66-67 0.007295318343405945 7.012481586099916E-5 2.501118432375636E-4 1.6362457034233135E-4 8.625352350902896E-4 68-69 0.008234990875943333 7.129356279201581E-5 2.5478683096163024E-4 1.6946830499741462E-4 8.835726798485893E-4 70-71 0.009442306455683535 7.246230972303246E-5 2.804992634439966E-4 1.9401199054876433E-4 9.209725816411221E-4 72-73 0.010914927588764518 7.479980358506576E-5 2.933554796851798E-4 2.0569945985893085E-4 9.501912549165385E-4 74-75 0.012760378992839813 7.713729744709906E-5 3.178991652365295E-4 2.0569945985893085E-4 9.665537119507717E-4 76-77 0.014826723566877253 7.713729744709906E-5 3.3075538147771266E-4 2.1037444758299745E-4 9.735661935368716E-4 78-79 0.01751717900207759 7.713729744709906E-5 3.377678630638126E-4 2.22061916893164E-4 9.910973975021213E-4 80-81 0.020677470703546617 7.947479130913237E-5 3.5413032009804575E-4 2.2673690461723058E-4 0.0010121348422604212 82-83 0.024724841325657283 7.947479130913237E-5 3.693240302012622E-4 2.3024314541028053E-4 0.001036678527811771 84-85 0.029855640352820387 8.064353824014902E-5 3.7750525871837874E-4 2.3491813313434716E-4 0.0010507034909839705 86-87 0.03594481186341715 8.414977903319898E-5 3.786740056493954E-4 2.407618677894304E-4 0.001060053466432104 88-89 0.043458685882923204 8.765601982624893E-5 3.786740056493954E-4 2.407618677894304E-4 0.0010705721888112536 90-91 0.052212600396237936 8.882476675726559E-5 3.8218024644244537E-4 2.407618677894304E-4 0.0010904408866385367 92-93 0.06328764631455173 8.882476675726559E-5 3.856864872354953E-4 2.4193061472044708E-4 0.0011173220660519196 94-95 0.0771185974962028 8.882476675726559E-5 3.86855234166512E-4 2.4309936165146372E-4 0.0011488782331893696 96-97 0.09329989875612835 8.999351368828225E-5 3.880239810975286E-4 2.4309936165146372E-4 0.0012026405920161354 98-99 0.11184323756363856 9.349975448133221E-5 3.880239810975286E-4 2.4543685551349704E-4 0.0012377029999466349 100-101 0.13288185106886932 9.349975448133221E-5 3.880239810975286E-4 2.4543685551349704E-4 0.0012739341548081511 102-103 0.15755409878263088 9.349975448133221E-5 3.880239810975286E-4 2.4543685551349704E-4 0.0013101653096696674 104-105 0.1865553851288781 9.349975448133221E-5 4.3828009913124465E-4 2.48943096306547E-4 0.001335877742152034 106-107 0.21912251836165708 9.349975448133221E-5 4.932112048890273E-4 2.5244933709959696E-4 0.0013873026071167666 108-109 0.25495513051969665 9.349975448133221E-5 5.037299272681772E-4 2.5244933709959696E-4 0.0014247025089092996 110-111 0.29545104293249264 9.349975448133221E-5 5.177548904403771E-4 2.5244933709959696E-4 0.001510021034873515 112-113 0.3407937488682147 9.349975448133221E-5 5.282736128195269E-4 2.5244933709959696E-4 0.0015392397081489314 114-115 0.39264520646276846 9.817474220539881E-5 5.282736128195269E-4 2.5244933709959696E-4 0.001549758430528081 116-117 0.45015924293809795 1.0752471765353203E-4 5.282736128195269E-4 2.536180840306136E-4 0.0015719646222173977 118-119 0.5127035662045231 1.1453719923963195E-4 5.306111066815602E-4 2.559555778926469E-4 0.0016233894871821304 120-121 0.5793794098720921 1.1453719923963195E-4 5.317798536125769E-4 2.5712432482366353E-4 0.0016420894380783967 122-123 0.6528047670662823 1.1687469310166525E-4 5.352860944056268E-4 2.6179931254773016E-4 0.0017063705192843126 124-125 0.7360908421174599 1.1921218696369856E-4 5.376235882676602E-4 2.641368064097635E-4 0.0017531203965249788 126-127 0.8287876674571837 1.203809338947152E-4 5.399610821296935E-4 2.711492879958634E-4 0.001769482853559212 128-129 0.9269624096625826 1.2388717468776516E-4 5.422985759917267E-4 2.734867818578967E-4 0.001819738971592928 130-131 1.0312602170395775 1.2505592161878183E-4 5.504798045088433E-4 2.8868049196111316E-4 0.001836101428627161 132-133 1.1432647416796964 1.2856216241183177E-4 5.668422615430765E-4 2.945242266161964E-4 0.0018524638856613942 134-135 1.2671858100284612 1.297309093428484E-4 6.007359225425594E-4 3.015367082022964E-4 0.0018781763181437605 136-137 1.4041559378620265 1.3089965627386508E-4 6.124233918527259E-4 3.015367082022964E-4 0.0019003825098330772 138-139 1.5492231444336757 1.3089965627386508E-4 6.147608857147591E-4 3.1556167137449615E-4 0.0019366136646945932 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTA 46375 0.0 19.038525 4 TTTTTTT 345345 0.0 16.945873 1 CGGGACT 14565 0.0 16.37854 1 TTTTTAA 28015 0.0 15.214464 5 GTCGGTT 19565 0.0 13.934704 1 TTTTTAG 20340 0.0 12.1883545 5 GGCAATT 29065 0.0 11.101443 1 GGGAAAT 31220 0.0 10.8693285 1 TTACGGG 9515 0.0 10.513329 8 GTCGAAT 23960 0.0 10.168157 1 TTTTTTG 55750 0.0 10.141909 3 TTTTTGA 35705 0.0 10.06984 4 GTCGCTT 12005 0.0 9.663792 1 GCGATTT 13740 0.0 9.604492 1 GACTGCG 20905 0.0 9.570374 4 GTCAGAA 36290 0.0 9.330816 1 GTCGGCT 17580 0.0 9.321362 1 GTCGAAC 55815 0.0 9.314466 1 GTCGATT 31220 0.0 9.127449 1 GTCAAAT 35815 0.0 9.110397 1 >>END_MODULE SRR7814946 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814946_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 42780861 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 4.2780861E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.68981207741026 14.88981037100999 10.915204412143352 29.505173139436398 2 31.222915312527256 19.19489184661337 26.019226214264364 23.56296662659501 3 26.670316429582847 22.566275606281042 25.783915382161194 24.979492581974917 4 29.690893785424283 29.965621776522916 16.611502980269613 23.73198145778319 5 29.203252828408477 31.860155876713186 16.856923473326074 22.07966782155226 6 24.279396807838907 33.172995279361025 17.615019482660717 24.932588430139354 7 23.307672559465317 15.763023095771727 34.293634249203166 26.63567009555979 8 24.21928815317672 20.136432036746527 21.188063512793722 34.456216297283035 9 25.34205657992718 21.074033549722152 23.330724923932692 30.253184946417978 10-14 27.358741569285307 24.098909944920585 21.38133498940435 27.161013496389756 15-19 27.43051244340314 23.75079688087624 22.02740286129351 26.79128781442711 20-24 27.153406286049268 24.09218692442866 22.113113151229005 26.641293638293067 25-29 27.27552444538225 24.052480851191845 22.04840384114756 26.623590862278345 30-34 27.151134709514146 24.191067589780392 22.142756780888536 26.515040919816922 35-39 27.346102301513415 24.07256592233628 21.966669509995516 26.614662266154788 40-44 27.519663524303546 23.990701355917075 21.92143023956437 26.568204880215013 45-49 27.586025910044214 23.948346434635805 21.96540691408712 26.50022074123286 50-54 27.528484758640086 23.922824741652583 22.02676379047163 26.521926709235704 55-59 27.637289487932463 23.750199884943875 21.964042285170464 26.64846834195319 60-64 27.525978007276148 23.801014032881433 22.12310844388688 26.549899515955534 65-69 27.57329030848631 23.859941949274933 22.08485425293334 26.481913489305413 70-74 27.635527485059264 23.692492303976774 22.167826870057617 26.504153340906345 75-79 27.58936244878288 23.673204707123592 22.16723314661666 26.57019969747687 80-84 27.609973534660742 23.87342414637237 22.065331036698865 26.451271282268024 85-89 27.70535020346002 23.805086130550333 22.046113983661552 26.44344968232809 90-94 27.602947963109013 23.87571629285348 22.168261643915958 26.35307410012155 95-99 27.75971900144787 23.87992378180514 22.16283678816095 26.197520428586046 100-104 27.718967133457177 23.9212352458264 22.079020803251247 26.280776817465174 105-109 27.55473902219967 23.857121529181004 22.22933381354807 26.358805635071253 110-114 27.790183177546744 24.084914494698666 22.028430451685832 26.09647187606876 115-119 27.748197961700676 24.078538297768247 21.963028280333113 26.21023546019796 120-124 27.765523933704838 24.072588440891828 22.038463882248653 26.123423743154678 125-129 27.743090070113364 24.153549878297216 22.04906955939947 26.054290492189953 130-134 27.943043502560645 24.055701450234952 22.190264941138047 25.810990106066356 135-139 27.795632470764314 24.322697023740552 22.333479278706193 25.54819122678894 140-144 27.96066727128283 24.32628038972848 22.21846119459821 25.494591144390476 145-149 27.904172849630122 24.424879153320454 22.187334658832604 25.483613338216827 150-151 28.27255977854209 24.4571316598794 21.948961008522012 25.321347553056494 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3280.0 1 2489.5 2 1749.5 3 2000.5 4 2480.0 5 3126.5 6 3917.5 7 4667.5 8 5280.5 9 5907.5 10 6619.0 11 7234.5 12 7551.0 13 7929.0 14 8356.0 15 8541.5 16 8660.0 17 8898.0 18 9163.0 19 9400.0 20 9754.0 21 10176.0 22 10572.0 23 11048.0 24 11617.5 25 13062.5 26 15452.0 27 18186.5 28 22212.0 29 27537.5 30 35610.5 31 46499.5 32 61323.5 33 83706.0 34 118237.5 35 170679.5 36 241970.0 37 336801.0 38 456502.5 39 607608.5 40 778753.5 41 964007.0 42 1143368.0 43 1281803.5 44 1402711.5 45 1501568.0 46 1550459.0 47 1563334.0 48 1533466.0 49 1491139.0 50 1435231.5 51 1395925.0 52 1328277.5 53 1231073.0 54 1195363.0 55 1165134.5 56 1101398.5 57 1087558.5 58 1167250.5 59 1205972.5 60 1173855.0 61 1156800.0 62 1197657.5 63 1177188.0 64 1091073.5 65 1048174.0 66 1005792.0 67 981120.5 68 967693.0 69 907009.5 70 806633.5 71 704452.5 72 611561.0 73 518944.0 74 405717.5 75 290292.0 76 209159.5 77 149264.5 78 103719.5 79 67959.0 80 44811.5 81 31291.0 82 21800.5 83 14868.0 84 10094.0 85 7694.0 86 6611.0 87 5883.5 88 5494.5 89 5157.0 90 4889.0 91 4828.0 92 4838.5 93 4826.0 94 4853.5 95 4914.0 96 5098.5 97 5470.0 98 6067.0 99 7688.0 100 28063.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0017437704210768457 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 2.0336196599689754E-4 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 4.628237846825944E-5 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 9.162975939170555E-5 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 5.7034850233612644E-5 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 6.59173269093392E-5 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 3.272491406846627E-5 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4.2780861E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 23.51961421876025 #Duplication Level Percentage of deduplicated Percentage of total 1 59.957068900508744 14.101671302275939 2 15.245325186815775 7.171283340669123 3 7.313622737605463 5.160407559901012 4 4.206086309501789 3.957021094811644 5 2.6120279982365036 3.0716945423561577 6 1.8371774128174139 2.5925822400531375 7 1.303285812494819 2.145694566866316 8 1.0035144230527133 1.888181767452927 9 0.8007325022313155 1.6949627590412815 >10 4.881185068082447 21.63443004061096 >50 0.4644154647218958 7.605472686247601 >100 0.3278678026046731 15.097446456634092 >500 0.03167900887348867 5.104312860129916 >1k 0.014916153270795393 6.1072075783921544 >5k 8.652231589993199E-4 1.373592868734254 >10k+ 2.2999602330120217E-4 1.2940383358240568 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 72291 0.16897976878024967 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 50453 0.11793357782116634 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.4492461944606491E-4 0.0 4.67498772406661E-6 0.0 0.0 2 1.4492461944606491E-4 0.0 4.67498772406661E-6 0.0 0.0 3 1.4492461944606491E-4 0.0 4.67498772406661E-6 0.0 2.337493862033305E-6 4 1.5661208875623143E-4 0.0 7.012481586099915E-6 0.0 4.67498772406661E-6 5 1.6128707648029804E-4 0.0 7.012481586099915E-6 0.0 4.67498772406661E-6 6 1.7063705192843127E-4 0.0 7.012481586099915E-6 0.0 4.67498772406661E-6 7 1.7764953351453118E-4 0.0 7.012481586099915E-6 0.0 7.012481586099915E-6 8 1.893370028246977E-4 0.0 7.012481586099915E-6 0.0 1.6362457034233135E-5 9 1.940119905487643E-4 0.0 7.012481586099915E-6 0.0 1.869995089626644E-5 10-11 2.138806883760474E-4 0.0 9.349975448133221E-6 0.0 2.2206191689316398E-5 12-13 2.430993616514637E-4 0.0 1.1687469310166526E-5 2.337493862033305E-6 2.804992634439966E-5 14-15 2.7231803492688004E-4 1.1687469310166525E-6 1.1687469310166526E-5 2.337493862033305E-6 3.7399901792532886E-5 16-17 3.167304183055128E-4 2.337493862033305E-6 1.7531203965249786E-5 1.1687469310166526E-5 4.4412383378632796E-5 18-19 3.8451774030447865E-4 2.337493862033305E-6 1.9868697827283094E-5 1.1687469310166526E-5 5.2593611895749364E-5 20-21 4.3828009913124465E-4 2.337493862033305E-6 4.3243636447616146E-5 1.1687469310166526E-5 5.843734655083262E-5 22-23 5.130799027163104E-4 2.337493862033305E-6 4.6749877240666104E-5 1.1687469310166526E-5 6.428108120591588E-5 24-25 6.381358243350923E-4 2.337493862033305E-6 5.1424864964732706E-5 1.1687469310166526E-5 7.246230972303246E-5 26-27 7.97085406953357E-4 2.337493862033305E-6 5.609985268879932E-5 1.1687469310166526E-5 7.596855051608242E-5 28-29 9.572037365026384E-4 3.5062407930499576E-6 6.42810812059159E-5 1.1687469310166526E-5 1.0284972992946541E-4 30-31 0.001150046980120386 4.67498772406661E-6 7.246230972303246E-5 1.1687469310166526E-5 1.285621624118318E-4 32-33 0.0013569151869103336 4.67498772406661E-6 7.947479130913237E-5 1.1687469310166526E-5 1.402496317219983E-4 34-35 0.0015322272265628316 4.67498772406661E-6 8.414977903319898E-5 1.1687469310166526E-5 1.5310584796318148E-4 36-37 0.0017718203474212453 7.012481586099915E-6 8.414977903319898E-5 1.1687469310166526E-5 1.5894958261826475E-4 38-39 0.002037125900762025 7.012481586099915E-6 9.583724834336551E-5 1.1687469310166526E-5 1.6596206420436467E-4 40-41 0.002312950176481955 9.34997544813322E-6 1.0051223606743213E-4 1.1687469310166526E-5 1.718057988594479E-4 42-43 0.0026016306684430684 9.34997544813322E-6 1.0986221151556533E-4 1.1687469310166526E-5 1.7531203965249787E-4 44-45 0.0029242048214036644 9.34997544813322E-6 1.1687469310166525E-4 1.1687469310166526E-5 1.893370028246977E-4 46-47 0.00327482890070866 9.34997544813322E-6 1.180434400326819E-4 1.1687469310166526E-5 1.975182313418143E-4 48-49 0.003645321677840939 9.34997544813322E-6 1.203809338947152E-4 1.1687469310166526E-5 1.9985572520384758E-4 50-51 0.004045033128248634 1.0518722379149872E-5 1.2388717468776516E-4 1.2856216241183178E-5 2.0803695372096417E-4 52-53 0.004479806986586829 1.2856216241183178E-5 1.285621624118318E-4 1.402496317219983E-5 2.22061916893164E-4 54-55 0.004946137012062474 1.402496317219983E-5 1.4141837865301496E-4 1.402496317219983E-5 2.314118923412972E-4 56-57 0.00553401671836385 1.402496317219983E-5 1.5076835410114816E-4 1.402496317219983E-5 2.5244933709959696E-4 58-59 0.006194358734388258 1.402496317219983E-5 1.5661208875623143E-4 1.402496317219983E-5 2.8868049196111316E-4 60-61 0.0068102883670340345 1.402496317219983E-5 1.5661208875623143E-4 1.402496317219983E-5 3.02705455133313E-4 62-63 0.007610880014780441 2.1037444758299744E-5 1.5778083568724808E-4 1.402496317219983E-5 3.073804428573796E-4 64-65 0.008402121687078715 2.1037444758299744E-5 1.601183295492814E-4 1.402496317219983E-5 3.178991652365295E-4 66-67 0.009337119231892038 2.4543685551349703E-5 1.6362457034233135E-4 1.402496317219983E-5 3.365991161327959E-4 68-69 0.010440416334771756 3.0387420206432966E-5 1.64793317273348E-4 1.402496317219983E-5 3.7399901792532883E-4 70-71 0.011852262627439873 3.0387420206432966E-5 1.7063705192843127E-4 1.402496317219983E-5 4.055551850627784E-4 72-73 0.013489677077794204 3.0387420206432966E-5 1.7063705192843127E-4 1.402496317219983E-5 4.4178633992429466E-4 74-75 0.015568877868072829 3.272491406846627E-5 1.7881828044554783E-4 1.5193710103216483E-5 4.6866751933767766E-4 76-77 0.017811703228693784 3.272491406846627E-5 1.8699950896266442E-4 1.6362457034233135E-5 5.060674211302106E-4 78-79 0.020699676895235934 3.272491406846627E-5 1.8699950896266442E-4 1.6362457034233135E-5 5.189236373713937E-4 80-81 0.02410540545221846 3.272491406846627E-5 1.9050574975571437E-4 1.6362457034233135E-5 5.306111066815602E-4 82-83 0.028352631799532974 3.272491406846627E-5 1.9985572520384758E-4 1.6362457034233135E-5 5.504798045088433E-4 84-85 0.03365173038476248 3.272491406846627E-5 2.0219321906588087E-4 1.6362457034233135E-5 5.680110084740932E-4 86-87 0.039936082632839015 3.389366099948293E-5 2.0336196599689754E-4 1.6362457034233135E-5 5.773609839222263E-4 88-89 0.04764513738982486 3.506240793049958E-5 2.0336196599689754E-4 1.6362457034233135E-5 5.890484532323928E-4 90-91 0.0565404702817926 3.506240793049958E-5 2.045307129279142E-4 1.7531203965249786E-5 6.019046694735761E-4 92-93 0.06780602194986211 3.506240793049958E-5 2.0803695372096414E-4 1.869995089626644E-5 6.077484041286593E-4 94-95 0.08181929765275178 3.506240793049958E-5 2.0803695372096414E-4 1.869995089626644E-5 6.135921387837426E-4 96-97 0.09827174820067319 3.506240793049958E-5 2.0920570065198078E-4 1.869995089626644E-5 6.170983795767925E-4 98-99 0.1170114364925942 4.207488951659949E-5 2.138806883760474E-4 1.869995089626644E-5 6.241108611628925E-4 100-101 0.13829314935947642 4.6749877240666104E-5 2.1504943530706406E-4 1.869995089626644E-5 6.35798330473059E-4 102-103 0.16317460277388995 4.6749877240666104E-5 2.243994107551973E-4 2.1037444758299744E-5 6.404733181971256E-4 104-105 0.19223666396055 4.6749877240666104E-5 2.2673690461723058E-4 2.1037444758299744E-5 6.498232936452588E-4 106-107 0.2248493783236387 4.9087371102699405E-5 2.290743984792639E-4 2.1037444758299744E-5 6.568357752313587E-4 108-109 0.26080470890943497 4.9087371102699405E-5 2.290743984792639E-4 2.1037444758299744E-5 6.62679509886442E-4 110-111 0.3012527026980593 5.025611803371606E-5 2.314118923412972E-4 2.1037444758299744E-5 6.790419669206751E-4 112-113 0.3465883961521953 5.142486496473271E-5 2.314118923412972E-4 2.2206191689316398E-5 6.965731708859249E-4 114-115 0.39858828460698814 5.142486496473271E-5 2.3491813313434716E-4 2.3374938620333052E-5 7.211168564372746E-4 116-117 0.4563010080605905 5.3762358826766014E-5 2.3842437392739712E-4 2.3374938620333052E-5 7.328043257474412E-4 118-119 0.5191725804677003 5.3762358826766014E-5 2.3842437392739712E-4 2.3374938620333052E-5 7.43323048126591E-4 120-121 0.5861826857575401 5.3762358826766014E-5 2.3959312085841377E-4 2.3374938620333052E-5 7.690354806089573E-4 122-123 0.659667649045212 5.3762358826766014E-5 2.4543685551349704E-4 2.3374938620333052E-5 7.818916968501406E-4 124-125 0.7426568623759116 5.3762358826766014E-5 2.477743493755303E-4 2.3374938620333052E-5 7.924104192292904E-4 126-127 0.8346594520386114 5.609985268879932E-5 2.512805901685803E-4 2.5712432482366357E-5 8.064353824014902E-4 128-129 0.9317297283941994 5.609985268879932E-5 2.571243248236636E-4 2.5712432482366357E-5 8.134478639875902E-4 130-131 1.034300127807152 6.077484041286593E-5 2.641368064097635E-4 2.5712432482366357E-5 8.368228026079232E-4 132-133 1.1447946314123971 6.077484041286593E-5 2.734867818578967E-4 2.804992634439966E-5 8.485102719180897E-4 134-135 1.2667148050152615 6.194358734388258E-5 2.7582427571993E-4 2.804992634439966E-5 8.742227044004561E-4 136-137 1.400947727536386 6.311233427489924E-5 2.7582427571993E-4 2.804992634439966E-5 8.882476675726559E-4 138-139 1.5435500468305208 6.66185750679492E-5 2.7582427571993E-4 2.804992634439966E-5 8.987663899518057E-4 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGCT 38095 0.0 26.130377 1 AGCCTAG 24990 0.0 18.77073 9 CTCACAC 25875 0.0 18.016405 7 TCACACT 25715 0.0 17.874992 8 GTTCGAT 23620 0.0 17.86431 1 TTGGCTT 56365 0.0 17.776085 2 TTCGATC 24470 0.0 16.680613 2 CACACAC 53445 0.0 16.509224 1 AGCACAC 36130 0.0 16.374397 1 CCTCACA 29365 0.0 15.924554 6 CACACTC 30740 0.0 15.684147 9 GCACACA 36265 0.0 15.333639 2 AAAGCCT 42690 0.0 15.080798 4 AAGCCTA 31435 0.0 14.806919 8 AAGCCTC 44410 0.0 14.757922 5 TCGCTTG 25390 0.0 14.534437 9 ACATGCG 14960 0.0 14.24798 6 CTCGCTT 27390 0.0 13.976069 8 AGCCTCT 47300 0.0 13.580324 6 GCTTCTC 73895 0.0 13.441355 5 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814946 SRR7814946_1.fastq SRR7814946_2.fastq Input file: SRR7814946_1.fastq Paired file: SRR7814946_2.fastq trimmed: SRR7814946-trimmed-pair1.fastq, SRR7814946-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 11:14:12 2025 >> started Thu Apr 10 11:15:01 2025 >> done (49.155s) 42780861 read pairs processed; of these: 115 ( 0.00%) short read pairs filtered out after trimming by size control 5358 ( 0.01%) empty read pairs filtered out after trimming by size control 42775388 (99.99%) read pairs available; of these: 1190817 ( 2.78%) trimmed read pairs available after processing 41584571 (97.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 11 0.00% 20 11 0.00% 21 17 0.00% 22 22 0.00% 23 22 0.00% 24 29 0.00% 25 31 0.00% 26 27 0.00% 27 27 0.00% 28 32 0.00% 29 43 0.00% 30 28 0.00% 31 38 0.00% 32 48 0.00% 33 23 0.00% 34 34 0.00% 35 43 0.00% 36 43 0.00% 37 44 0.00% 38 59 0.00% 39 47 0.00% 40 45 0.00% 41 50 0.00% 42 52 0.00% 43 59 0.00% 44 53 0.00% 45 61 0.00% 46 71 0.00% 47 68 0.00% 48 65 0.00% 49 75 0.00% 50 96 0.00% 51 84 0.00% 52 72 0.00% 53 86 0.00% 54 91 0.00% 55 110 0.00% 56 124 0.00% 57 124 0.00% 58 129 0.00% 59 111 0.00% 60 123 0.00% 61 179 0.00% 62 159 0.00% 63 150 0.00% 64 162 0.00% 65 184 0.00% 66 212 0.00% 67 214 0.00% 68 245 0.00% 69 259 0.00% 70 362 0.00% 71 300 0.00% 72 388 0.00% 73 454 0.00% 74 419 0.00% 75 479 0.00% 76 499 0.00% 77 624 0.00% 78 647 0.00% 79 717 0.00% 80 748 0.00% 81 910 0.00% 82 986 0.00% 83 1170 0.00% 84 1200 0.00% 85 1324 0.00% 86 1494 0.00% 87 1649 0.00% 88 1766 0.00% 89 1889 0.00% 90 2091 0.00% 91 2474 0.01% 92 2625 0.01% 93 3051 0.01% 94 3340 0.01% 95 3522 0.01% 96 3796 0.01% 97 4087 0.01% 98 4256 0.01% 99 4653 0.01% 100 4829 0.01% 101 5365 0.01% 102 5945 0.01% 103 6348 0.01% 104 6605 0.02% 105 7225 0.02% 106 7305 0.02% 107 7873 0.02% 108 8238 0.02% 109 8847 0.02% 110 9308 0.02% 111 9852 0.02% 112 10607 0.02% 113 11272 0.03% 114 12224 0.03% 115 12594 0.03% 116 13031 0.03% 117 13963 0.03% 118 14003 0.03% 119 14563 0.03% 120 15496 0.04% 121 16004 0.04% 122 17078 0.04% 123 18352 0.04% 124 19223 0.04% 125 20347 0.05% 126 21077 0.05% 127 21339 0.05% 128 21949 0.05% 129 22886 0.05% 130 23514 0.05% 131 24276 0.06% 132 26006 0.06% 133 27114 0.06% 134 28255 0.07% 135 30279 0.07% 136 31009 0.07% 137 31689 0.07% 138 32585 0.08% 139 33518 0.08% 140 34404 0.08% 141 36115 0.08% 142 37138 0.09% 143 39057 0.09% 144 40779 0.10% 145 43043 0.10% 146 44051 0.10% 147 45464 0.11% 148 46445 0.11% 149 46581 0.11% 150 49621 0.12% 151 41584571 97.22% 42775388 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=30 prefix-density=0.69 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=49.50 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=4.4 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=4.36 fanout-score-rank=13 prefix-density=0.81 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=91.56 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGA SRR7814946 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 11:15:44 Started mapping on | Apr 10 11:15:44 Finished on | Apr 10 11:19:22 Mapping speed, Million of reads per hour | 706.38 Number of input reads | 42775388 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 39396308 Uniquely mapped reads % | 92.10% Average mapped length | 299.91 Number of splices: Total | 39908879 Number of splices: Annotated (sjdb) | 37880213 Number of splices: GT/AG | 39400445 Number of splices: GC/AG | 462076 Number of splices: AT/AC | 13224 Number of splices: Non-canonical | 33134 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 617375 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 68042 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.10% % of reads unmapped: other | 1.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2761705 2761705 2761705 N_multimapping 617375 617375 617375 N_noFeature 1288542 38226063 1546848 N_ambiguous 1108616 6623 197913 UnstrandedReadsAssigned:36999150 PositiveStrandReadsAssigned:1163622 NegativeStrandReadsAssigned:37651547 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814946 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814946-trimmed-pair1.fastq SRR7814946-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,775,388 reads, 38,361,448 reads pseudoaligned [quant] estimated average fragment length: 309.379 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR7814946.ke.tsv 35125 SRR7814946.se.tsv 88098 total ==> SRR7814946.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 628.264 0 0 PNS24247 1044 735.621 131.531 5.59048 PNS24249 1928 1619.62 148.352 2.86389 PNS24246 1044 735.621 131.531 5.59048 PNS24248 1044 735.621 131.531 5.59048 PNS24244 1471 1162.62 315.056 8.47279 PNS24243 293 72.629 1 0.430493 KQK14069 1603 1294.62 21485.6 518.897 KQK14071 474 196.577 445.821 70.9093 ==> SRR7814946.se.tsv <== BRADI_1g14170v3 23245 BRADI_1g53295v3 196 BRADI_1g59795v3 515 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 222 BRADI_1g74790v3 2130 BRADI_1g09890v3 0 BRADI_1g77505v3 618 BRADI_1g48960v3 0 SRR7814946 completed mapping pipeline successfully