Starting /dee2/code/volunteer_pipeline.sh SRR7814947 current disk space = 1547084320768 free memory = 1606540364 SRR7814947 SRAfilesize 756c6ad32e596f40ee46d289366f3002 SRR7814947.sra SRR7814947.sra file validated SRR7814947 is paired end SRR7814947 is conventional basespace SRR7814947 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814947_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.19925 37.0 37.0 37.0 37.0 37.0 2 36.277 37.0 37.0 37.0 37.0 37.0 3 36.4 37.0 37.0 37.0 37.0 37.0 4 36.5825 37.0 37.0 37.0 37.0 37.0 5 36.5555 37.0 37.0 37.0 37.0 37.0 6 36.528 37.0 37.0 37.0 37.0 37.0 7 36.4305 37.0 37.0 37.0 37.0 37.0 8 36.5385 37.0 37.0 37.0 37.0 37.0 9 36.514 37.0 37.0 37.0 37.0 37.0 10-14 36.5478 37.0 37.0 37.0 37.0 37.0 15-19 36.539 37.0 37.0 37.0 37.0 37.0 20-24 36.504999999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.491200000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5006 37.0 37.0 37.0 37.0 37.0 35-39 36.4907 37.0 37.0 37.0 37.0 37.0 40-44 36.4426 37.0 37.0 37.0 37.0 37.0 45-49 36.3402 37.0 37.0 37.0 37.0 37.0 50-54 36.308499999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.350300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.264500000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.2339 37.0 37.0 37.0 37.0 37.0 70-74 36.1765 37.0 37.0 37.0 37.0 37.0 75-79 36.220099999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.1433 37.0 37.0 37.0 37.0 37.0 85-89 36.084799999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.025999999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.0221 37.0 37.0 37.0 37.0 37.0 100-104 36.014799999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.0689 37.0 37.0 37.0 37.0 37.0 110-114 35.9467 37.0 37.0 37.0 37.0 37.0 115-119 35.9542 37.0 37.0 37.0 37.0 37.0 120-124 35.7502 37.0 37.0 37.0 37.0 37.0 125-129 35.7561 37.0 37.0 37.0 37.0 37.0 130-134 35.6109 37.0 37.0 37.0 37.0 37.0 135-139 35.7044 37.0 37.0 37.0 37.0 37.0 140-144 35.5427 37.0 37.0 37.0 37.0 37.0 145-149 35.515299999999996 37.0 37.0 37.0 37.0 37.0 150-151 34.69675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 3.0 27 9.0 28 8.0 29 20.0 30 27.0 31 36.0 32 61.0 33 106.0 34 166.0 35 432.0 36 2878.0 37 252.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.65906242165956 12.484331912760089 10.478816746051642 37.377788919528705 2 25.324999999999996 18.125 34.075 22.475 3 22.1 23.9 23.825 30.175 4 26.125 31.324999999999996 19.775000000000002 22.775000000000002 5 24.4 34.449999999999996 21.349999999999998 19.8 6 19.6 33.575 24.025 22.8 7 17.275 19.950000000000003 42.5 20.275000000000002 8 20.75 21.75 26.35 31.15 9 21.025 19.625 31.075000000000003 28.275 10-14 23.235 26.21 24.815 25.740000000000002 15-19 23.105 26.13 25.119999999999997 25.645 20-24 22.89 25.89 25.585 25.635 25-29 23.415 25.755 24.98 25.85 30-34 23.52 25.28 24.86 26.340000000000003 35-39 23.435 25.900000000000002 25.34 25.324999999999996 40-44 23.075000000000003 25.759999999999998 25.295 25.869999999999997 45-49 23.57 25.380000000000003 24.990000000000002 26.06 50-54 23.14 25.825 24.895 26.14 55-59 23.385 26.150000000000002 24.785 25.679999999999996 60-64 23.225 25.174999999999997 25.230000000000004 26.369999999999997 65-69 23.580000000000002 25.235000000000003 24.654999999999998 26.529999999999998 70-74 23.935000000000002 24.975 25.455 25.635 75-79 23.5 25.1 24.9 26.5 80-84 23.655 25.619999999999997 24.865000000000002 25.86 85-89 23.115 25.28 25.31 26.295 90-94 23.785 25.64 24.41 26.165 95-99 24.025 24.985 24.93 26.06 100-104 23.935000000000002 25.165 24.385 26.515 105-109 23.895 25.215 24.740000000000002 26.150000000000002 110-114 24.265 25.045 24.855 25.835 115-119 24.205 25.16 24.6 26.035000000000004 120-124 23.794999999999998 24.92 24.89 26.395000000000003 125-129 24.015 25.31 24.54 26.135 130-134 24.349999999999998 24.385 25.22 26.045 135-139 24.335 24.79 24.705 26.169999999999998 140-144 24.125 24.45 25.069999999999997 26.355 145-149 24.884999999999998 24.63 24.3 26.185000000000002 150-151 25.05 24.087500000000002 25.137500000000003 25.724999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 3.0 25 2.5 26 1.5 27 2.0 28 2.0 29 6.0 30 9.0 31 12.0 32 16.5 33 20.5 34 28.5 35 40.0 36 48.5 37 56.5 38 76.0 39 90.0 40 118.0 41 144.5 42 161.0 43 184.0 44 189.0 45 189.0 46 202.0 47 208.0 48 193.0 49 186.0 50 166.0 51 142.0 52 130.5 53 127.0 54 122.5 55 113.0 56 99.5 57 84.5 58 78.5 59 74.5 60 65.0 61 59.0 62 62.0 63 59.0 64 53.5 65 48.5 66 47.0 67 45.0 68 45.5 69 44.0 70 33.0 71 25.0 72 24.0 73 17.0 74 9.0 75 7.0 76 6.5 77 6.0 78 5.0 79 4.0 80 3.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.575 #Duplication Level Percentage of deduplicated Percentage of total 1 92.57358898190657 85.7 2 6.913313529570618 12.8 3 0.4590872265730489 1.275 4 0.027005130974885227 0.1 5 0.027005130974885227 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAGGCTTTCCAGCATCAACAAGCTTATCATGCATCAATACACTAACTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.7625 0.0 0.0 0.0 0.0 126-127 0.85 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 1.0 0.0 0.0 0.0 0.0 134-135 1.0625 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138-139 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTATT 10 0.006830828 145.0 6 >>END_MODULE SRR7814947 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814947_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0815 37.0 37.0 37.0 37.0 37.0 2 35.7045 37.0 37.0 37.0 37.0 37.0 3 35.862 37.0 37.0 37.0 37.0 37.0 4 35.8995 37.0 37.0 37.0 37.0 37.0 5 36.0395 37.0 37.0 37.0 37.0 37.0 6 35.976 37.0 37.0 37.0 37.0 37.0 7 35.7975 37.0 37.0 37.0 37.0 37.0 8 35.984 37.0 37.0 37.0 37.0 37.0 9 35.8605 37.0 37.0 37.0 37.0 37.0 10-14 35.912 37.0 37.0 37.0 37.0 37.0 15-19 35.8365 37.0 37.0 37.0 37.0 37.0 20-24 35.7505 37.0 37.0 37.0 37.0 37.0 25-29 35.7352 37.0 37.0 37.0 37.0 37.0 30-34 35.7278 37.0 37.0 37.0 37.0 37.0 35-39 35.6383 37.0 37.0 37.0 37.0 37.0 40-44 35.5917 37.0 37.0 37.0 37.0 37.0 45-49 35.509100000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.392799999999994 37.0 37.0 37.0 34.6 37.0 55-59 35.1776 37.0 37.0 37.0 27.4 37.0 60-64 35.13590000000001 37.0 37.0 37.0 27.4 37.0 65-69 35.2005 37.0 37.0 37.0 29.8 37.0 70-74 35.109300000000005 37.0 37.0 37.0 27.4 37.0 75-79 35.0231 37.0 37.0 37.0 27.4 37.0 80-84 34.9028 37.0 37.0 37.0 25.0 37.0 85-89 34.8983 37.0 37.0 37.0 25.0 37.0 90-94 34.7043 37.0 37.0 37.0 25.0 37.0 95-99 34.3722 37.0 37.0 37.0 25.0 37.0 100-104 34.4527 37.0 37.0 37.0 25.0 37.0 105-109 34.2886 37.0 37.0 37.0 25.0 37.0 110-114 34.2907 37.0 37.0 37.0 25.0 37.0 115-119 34.305 37.0 37.0 37.0 25.0 37.0 120-124 33.9602 37.0 37.0 37.0 25.0 37.0 125-129 34.1228 37.0 37.0 37.0 25.0 37.0 130-134 33.7488 37.0 37.0 37.0 25.0 37.0 135-139 33.56679999999999 37.0 37.0 37.0 25.0 37.0 140-144 33.823100000000004 37.0 37.0 37.0 25.0 37.0 145-149 33.497299999999996 37.0 37.0 37.0 25.0 37.0 150-151 32.90875 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 8.0 15 5.0 16 2.0 17 3.0 18 3.0 19 4.0 20 5.0 21 13.0 22 10.0 23 5.0 24 11.0 25 2.0 26 10.0 27 25.0 28 29.0 29 41.0 30 56.0 31 100.0 32 148.0 33 288.0 34 496.0 35 1087.0 36 1610.0 37 34.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.9 14.124999999999998 12.775 35.199999999999996 2 30.8 20.1 29.275000000000002 19.825 3 24.45 23.325000000000003 26.125 26.1 4 27.575 31.2 17.974999999999998 23.25 5 27.700000000000003 33.324999999999996 18.325 20.65 6 22.475 35.15 17.974999999999998 24.4 7 22.25 14.7 35.85 27.200000000000003 8 22.475 20.674999999999997 23.175 33.675 9 24.975 20.849999999999998 25.75 28.425 10-14 26.584999999999997 24.925 22.355 26.135 15-19 26.19 24.235 23.77 25.805 20-24 26.21 24.755 23.294999999999998 25.740000000000002 25-29 25.535000000000004 24.775 23.61 26.08 30-34 26.11 24.94 23.645 25.305 35-39 25.52 24.625 23.89 25.965 40-44 25.965 24.54 23.91 25.585 45-49 26.875 25.009999999999998 23.285 24.83 50-54 26.279999999999998 24.485 23.605 25.629999999999995 55-59 26.665 24.69 23.665 24.98 60-64 26.534999999999997 24.82 23.665 24.98 65-69 26.619999999999997 24.97 23.625 24.785 70-74 26.705000000000002 24.635 23.724999999999998 24.935 75-79 26.71 23.880000000000003 24.635 24.775 80-84 26.845000000000002 24.975 23.865 24.315 85-89 26.545 24.815 23.945 24.695 90-94 26.795 24.82 23.880000000000003 24.505 95-99 26.740000000000002 24.365000000000002 23.9 24.995 100-104 26.700000000000003 24.92 23.919999999999998 24.46 105-109 26.91 24.715 23.41 24.965 110-114 26.775 25.169999999999998 23.235 24.82 115-119 27.24 24.58 23.775 24.404999999999998 120-124 27.255000000000003 24.68 24.16 23.905 125-129 26.840000000000003 24.77 23.57 24.82 130-134 26.724999999999998 25.145 23.09 25.040000000000003 135-139 26.795 24.7 23.865 24.64 140-144 27.134999999999998 24.625 23.935000000000002 24.305 145-149 26.815 24.88 23.995 24.310000000000002 150-151 26.987499999999997 25.0625 23.7625 24.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 3.5 22 3.0 23 1.5 24 2.5 25 2.5 26 1.5 27 1.5 28 3.5 29 5.0 30 4.0 31 4.0 32 5.5 33 11.0 34 16.5 35 21.0 36 33.5 37 48.0 38 55.5 39 70.0 40 100.0 41 126.0 42 127.5 43 150.0 44 186.0 45 191.0 46 182.5 47 173.5 48 163.5 49 158.0 50 161.5 51 153.0 52 129.0 53 113.5 54 110.0 55 101.0 56 87.5 57 84.5 58 94.0 59 100.0 60 97.5 61 84.5 62 76.5 63 76.0 64 70.0 65 70.0 66 70.0 67 68.0 68 71.5 69 63.5 70 51.5 71 44.0 72 37.0 73 37.0 74 26.0 75 13.0 76 12.5 77 8.5 78 5.0 79 4.0 80 4.0 81 4.0 82 2.0 83 1.5 84 2.0 85 1.5 86 1.5 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 0.5 97 0.5 98 1.0 99 1.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.925 #Duplication Level Percentage of deduplicated Percentage of total 1 93.11272531611515 86.52499999999999 2 6.268496099004574 11.65 3 0.5380683346785041 1.5 4 0.053806833467850416 0.2 5 0.026903416733925208 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCTGAAGGAAGCTGTGTTCCGCTGTCTTGTTTGTGGCTTCTACTCAGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0125 0.0 0.0 96-97 0.05 0.0 0.025 0.0 0.0 98-99 0.05 0.0 0.025 0.0 0.0 100-101 0.075 0.0 0.025 0.0 0.0 102-103 0.0875 0.0 0.025 0.0 0.0 104-105 0.15 0.0 0.025 0.0 0.0 106-107 0.225 0.0 0.025 0.0 0.0 108-109 0.2625 0.0 0.025 0.0 0.0 110-111 0.32499999999999996 0.0 0.025 0.0 0.0 112-113 0.4 0.0 0.025 0.0 0.0 114-115 0.4125 0.0 0.025 0.0 0.0 116-117 0.4625 0.0 0.025 0.0 0.0 118-119 0.5125 0.0 0.025 0.0 0.0 120-121 0.6125 0.0 0.025 0.0 0.0 122-123 0.625 0.0 0.025 0.0 0.0 124-125 0.7375 0.0 0.025 0.0 0.0 126-127 0.825 0.0 0.025 0.0 0.0 128-129 0.8875 0.0 0.025 0.0 0.0 130-131 0.9 0.0 0.025 0.0 0.0 132-133 0.975 0.0 0.025 0.0 0.0 134-135 1.0375 0.0 0.025 0.0 0.0 136-137 1.2125 0.0 0.025 0.0 0.0 138-139 1.375 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAATA 10 0.006830828 145.0 4 >>END_MODULE Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957926 spots for SRR7814947.sra Written 2957926 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra Read 2957916 spots for SRR7814947.sra Written 2957916 spots for SRR7814947.sra SRR ids: ['SRR7814947.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_87b3yrl8 SRR7814947.sra spots: 59158330 blocks: [[1, 2957916], [2957917, 5915832], [5915833, 8873748], [8873749, 11831664], [11831665, 14789580], [14789581, 17747496], [17747497, 20705412], [20705413, 23663328], [23663329, 26621244], [26621245, 29579160], [29579161, 32537076], [32537077, 35494992], [35494993, 38452908], [38452909, 41410824], [41410825, 44368740], [44368741, 47326656], [47326657, 50284572], [50284573, 53242488], [53242489, 56200404], [56200405, 59158330]] SRR7814947 file size 20025116 SRR7814947 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814947 SRR7814947_1.fastq SRR7814947_2.fastq Input file: SRR7814947_1.fastq Paired file: SRR7814947_2.fastq trimmed: SRR7814947-trimmed-pair1.fastq, SRR7814947-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 04:48:55 2024 >> started Sat Dec 7 04:51:04 2024 >> done (129.174s) 59158330 read pairs processed; of these: 177 ( 0.00%) short read pairs filtered out after trimming by size control 3869 ( 0.01%) empty read pairs filtered out after trimming by size control 59154284 (99.99%) read pairs available; of these: 1339936 ( 2.27%) trimmed read pairs available after processing 57814348 (97.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 26 0.00% 20 22 0.00% 21 34 0.00% 22 40 0.00% 23 37 0.00% 24 37 0.00% 25 49 0.00% 26 51 0.00% 27 70 0.00% 28 53 0.00% 29 69 0.00% 30 102 0.00% 31 86 0.00% 32 103 0.00% 33 93 0.00% 34 95 0.00% 35 103 0.00% 36 94 0.00% 37 139 0.00% 38 108 0.00% 39 116 0.00% 40 109 0.00% 41 116 0.00% 42 142 0.00% 43 131 0.00% 44 138 0.00% 45 147 0.00% 46 163 0.00% 47 144 0.00% 48 150 0.00% 49 167 0.00% 50 174 0.00% 51 170 0.00% 52 155 0.00% 53 186 0.00% 54 197 0.00% 55 251 0.00% 56 239 0.00% 57 220 0.00% 58 236 0.00% 59 254 0.00% 60 265 0.00% 61 280 0.00% 62 281 0.00% 63 306 0.00% 64 290 0.00% 65 296 0.00% 66 351 0.00% 67 336 0.00% 68 438 0.00% 69 432 0.00% 70 436 0.00% 71 506 0.00% 72 549 0.00% 73 600 0.00% 74 609 0.00% 75 688 0.00% 76 685 0.00% 77 788 0.00% 78 875 0.00% 79 1051 0.00% 80 1008 0.00% 81 1197 0.00% 82 1295 0.00% 83 1379 0.00% 84 1565 0.00% 85 1671 0.00% 86 1787 0.00% 87 1915 0.00% 88 2162 0.00% 89 2277 0.00% 90 2679 0.00% 91 2802 0.00% 92 3267 0.01% 93 3463 0.01% 94 3784 0.01% 95 4010 0.01% 96 4275 0.01% 97 4710 0.01% 98 4853 0.01% 99 5229 0.01% 100 5741 0.01% 101 6183 0.01% 102 6732 0.01% 103 7056 0.01% 104 7536 0.01% 105 7936 0.01% 106 8417 0.01% 107 8918 0.02% 108 9527 0.02% 109 9859 0.02% 110 10508 0.02% 111 11191 0.02% 112 11937 0.02% 113 12490 0.02% 114 13012 0.02% 115 13816 0.02% 116 14345 0.02% 117 15332 0.03% 118 15650 0.03% 119 16567 0.03% 120 17462 0.03% 121 18352 0.03% 122 19054 0.03% 123 20289 0.03% 124 21277 0.04% 125 22128 0.04% 126 23048 0.04% 127 23830 0.04% 128 24714 0.04% 129 25692 0.04% 130 26443 0.04% 131 27412 0.05% 132 28920 0.05% 133 30280 0.05% 134 31856 0.05% 135 33006 0.06% 136 34480 0.06% 137 35317 0.06% 138 36629 0.06% 139 37725 0.06% 140 38646 0.07% 141 40703 0.07% 142 42236 0.07% 143 43335 0.07% 144 46003 0.08% 145 47405 0.08% 146 48882 0.08% 147 50508 0.09% 148 51777 0.09% 149 53273 0.09% 150 56079 0.09% 151 57814348 97.73% 59154284 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=29 prefix-density=0.20 prefix-fanout=2.4 sequence=TCATGTTGTCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=300.00 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=23.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=30 prefix-density=0.45 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=593.62 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=21.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR7814947 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:11:08 Started mapping on | Dec 07 05:11:08 Finished on | Dec 07 05:22:31 Mapping speed, Million of reads per hour | 311.79 Number of input reads | 59154284 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 54595354 Uniquely mapped reads % | 92.29% Average mapped length | 300.02 Number of splices: Total | 56228000 Number of splices: Annotated (sjdb) | 52767061 Number of splices: GT/AG | 55516576 Number of splices: GC/AG | 621690 Number of splices: AT/AC | 40714 Number of splices: Non-canonical | 49020 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 718554 % of reads mapped to multiple loci | 1.21% Number of reads mapped to too many loci | 85284 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.59% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3840376 3840376 3840376 N_multimapping 718554 718554 718554 N_noFeature 1590850 53196567 2067381 N_ambiguous 1082428 9729 159168 UnstrandedReadsAssigned:51922076 PositiveStrandReadsAssigned:1389058 NegativeStrandReadsAssigned:52368805 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814947 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814947-trimmed-pair1.fastq SRR7814947-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 59,154,284 reads, 53,504,301 reads pseudoaligned [quant] estimated average fragment length: 325.56 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,339 rounds 52973 SRR7814947.ke.tsv 35125 SRR7814947.se.tsv 88098 total ==> SRR7814947.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 612.457 0 0 PNS24247 1044 719.44 252.639 8.89433 PNS24249 1928 1603.44 433.725 6.85124 PNS24246 1044 719.44 252.639 8.89433 PNS24248 1044 719.44 252.639 8.89433 PNS24244 1471 1146.44 343.359 7.58586 PNS24243 293 70.2375 1 0.360611 KQK14069 1603 1278.44 11642.8 230.667 KQK14071 474 190.217 39.2448 5.22565 ==> SRR7814947.se.tsv <== BRADI_1g14170v3 11802 BRADI_1g53295v3 385 BRADI_1g59795v3 1002 BRADI_1g07683v3 0 BRADI_1g00485v3 81 BRADI_1g20270v3 3775 BRADI_1g74790v3 690 BRADI_1g09890v3 1 BRADI_1g77505v3 534 BRADI_1g48960v3 0 SRR7814947 completed mapping pipeline successfully