Starting /dee2/code/volunteer_pipeline.sh SRR7814948 current disk space = 1515918319616 free memory = 1570810532 SRR7814948 SRAfilesize 7e62eb95ce0570ef1d1537a7cd16b185 SRR7814948.sra SRR7814948.sra file validated SRR7814948 is paired end SRR7814948 is conventional basespace SRR7814948 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814948_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.226 37.0 37.0 37.0 37.0 37.0 2 36.277 37.0 37.0 37.0 37.0 37.0 3 36.4705 37.0 37.0 37.0 37.0 37.0 4 36.492 37.0 37.0 37.0 37.0 37.0 5 36.532 37.0 37.0 37.0 37.0 37.0 6 36.45 37.0 37.0 37.0 37.0 37.0 7 36.395 37.0 37.0 37.0 37.0 37.0 8 36.5335 37.0 37.0 37.0 37.0 37.0 9 36.5455 37.0 37.0 37.0 37.0 37.0 10-14 36.4908 37.0 37.0 37.0 37.0 37.0 15-19 36.472899999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.452099999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.3855 37.0 37.0 37.0 37.0 37.0 30-34 36.43860000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.3863 37.0 37.0 37.0 37.0 37.0 40-44 36.3572 37.0 37.0 37.0 37.0 37.0 45-49 36.3125 37.0 37.0 37.0 37.0 37.0 50-54 36.2693 37.0 37.0 37.0 37.0 37.0 55-59 36.263 37.0 37.0 37.0 37.0 37.0 60-64 36.2065 37.0 37.0 37.0 37.0 37.0 65-69 36.159000000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.1437 37.0 37.0 37.0 37.0 37.0 75-79 36.1498 37.0 37.0 37.0 37.0 37.0 80-84 36.08879999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.0902 37.0 37.0 37.0 37.0 37.0 90-94 36.0262 37.0 37.0 37.0 37.0 37.0 95-99 35.994800000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.9556 37.0 37.0 37.0 37.0 37.0 105-109 35.986999999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.912099999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.8628 37.0 37.0 37.0 37.0 37.0 120-124 35.6491 37.0 37.0 37.0 37.0 37.0 125-129 35.5926 37.0 37.0 37.0 37.0 37.0 130-134 35.605999999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.60080000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.4902 37.0 37.0 37.0 37.0 37.0 145-149 35.3346 37.0 37.0 37.0 32.2 37.0 150-151 34.54025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 1.0 25 4.0 26 4.0 27 7.0 28 15.0 29 17.0 30 39.0 31 44.0 32 51.0 33 96.0 34 179.0 35 457.0 36 2878.0 37 204.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.69674185463659 12.756892230576442 9.24812030075188 39.29824561403509 2 24.275 18.175 34.599999999999994 22.95 3 22.75 24.275 23.7 29.275000000000002 4 27.425 30.275000000000002 19.275000000000002 23.025000000000002 5 25.724999999999998 32.725 21.9 19.650000000000002 6 20.4 33.550000000000004 23.599999999999998 22.45 7 16.075 20.25 41.55 22.125 8 21.099999999999998 18.75 27.775 32.375 9 18.975 20.925 30.3 29.799999999999997 10-14 23.575 26.384999999999998 24.59 25.45 15-19 23.945 24.915000000000003 25.430000000000003 25.71 20-24 23.35 24.85 25.22 26.58 25-29 23.549999999999997 24.77 25.119999999999997 26.56 30-34 23.035 25.28 25.66 26.025 35-39 23.31 24.37 25.314999999999998 27.005000000000003 40-44 24.125 25.165 24.515 26.195 45-49 24.29 24.975 24.895 25.840000000000003 50-54 24.349999999999998 24.575 24.875 26.200000000000003 55-59 23.7 24.945 24.975 26.38 60-64 24.060000000000002 24.75 25.205 25.985000000000003 65-69 23.815 25.515 24.535 26.135 70-74 24.255 24.735 24.85 26.16 75-79 23.98 24.83 24.585 26.605 80-84 23.98 25.105 24.115000000000002 26.8 85-89 24.465 24.97 24.505 26.06 90-94 24.805 24.545 24.69 25.96 95-99 25.095 23.89 24.755 26.26 100-104 24.91 24.349999999999998 24.745 25.995 105-109 25.064999999999998 24.055 24.6 26.279999999999998 110-114 24.565 24.385 24.610000000000003 26.44 115-119 25.124999999999996 24.884999999999998 24.315 25.674999999999997 120-124 24.83 24.279999999999998 24.415 26.474999999999998 125-129 24.95 24.2 24.265 26.584999999999997 130-134 24.79 24.245 24.77 26.195 135-139 25.005 23.905 24.385 26.705000000000002 140-144 25.590000000000003 23.549999999999997 24.42 26.44 145-149 25.069999999999997 23.925 24.36 26.645000000000003 150-151 26.075 23.6375 24.5125 25.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 1.5 26 0.0 27 0.5 28 1.5 29 6.0 30 10.5 31 9.5 32 13.0 33 19.5 34 31.0 35 38.5 36 46.5 37 67.5 38 76.5 39 87.0 40 107.0 41 138.5 42 166.5 43 172.5 44 178.0 45 179.0 46 176.5 47 192.0 48 188.0 49 155.0 50 152.0 51 150.0 52 136.5 53 123.5 54 102.5 55 91.0 56 94.0 57 99.5 58 89.5 59 79.0 60 80.0 61 67.0 62 63.5 63 64.5 64 70.5 65 77.5 66 70.0 67 63.0 68 49.0 69 45.0 70 43.5 71 35.0 72 26.0 73 18.0 74 14.5 75 11.5 76 8.0 77 6.0 78 3.5 79 2.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.15 #Duplication Level Percentage of deduplicated Percentage of total 1 92.24091155724362 85.0 2 7.162235485621269 13.200000000000001 3 0.48833423765599565 1.35 4 0.05425935973955508 0.2 5 0.05425935973955508 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGGTTGTTGGGAGAGATCACATGCATAAATACAACATGAAACAAACGT 5 0.125 No Hit GAAGAATCCAAACATGGAGAACATGGCGAGGCGGCCGTTCTTGAGCTCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.16249999999999998 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4375 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.5875 0.0 0.0 0.0 0.0 122-123 0.6625 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0499999999999998 0.0 0.0 0.0 0.0 130-131 1.1 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138-139 1.6124999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814948 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814948_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.371 37.0 37.0 37.0 37.0 37.0 2 36.1055 37.0 37.0 37.0 37.0 37.0 3 36.288 37.0 37.0 37.0 37.0 37.0 4 36.238 37.0 37.0 37.0 37.0 37.0 5 36.2735 37.0 37.0 37.0 37.0 37.0 6 36.0835 37.0 37.0 37.0 37.0 37.0 7 36.164 37.0 37.0 37.0 37.0 37.0 8 36.238 37.0 37.0 37.0 37.0 37.0 9 36.199 37.0 37.0 37.0 37.0 37.0 10-14 36.2638 37.0 37.0 37.0 37.0 37.0 15-19 36.1878 37.0 37.0 37.0 37.0 37.0 20-24 36.14 37.0 37.0 37.0 37.0 37.0 25-29 36.08539999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.041700000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.054700000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.908699999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9203 37.0 37.0 37.0 37.0 37.0 50-54 35.691100000000006 37.0 37.0 37.0 37.0 37.0 55-59 35.5905 37.0 37.0 37.0 37.0 37.0 60-64 35.656 37.0 37.0 37.0 37.0 37.0 65-69 35.62670000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.4588 37.0 37.0 37.0 37.0 37.0 75-79 35.4973 37.0 37.0 37.0 37.0 37.0 80-84 35.3298 37.0 37.0 37.0 34.6 37.0 85-89 35.3611 37.0 37.0 37.0 34.6 37.0 90-94 35.1752 37.0 37.0 37.0 29.8 37.0 95-99 34.9024 37.0 37.0 37.0 25.0 37.0 100-104 34.83239999999999 37.0 37.0 37.0 25.0 37.0 105-109 34.649699999999996 37.0 37.0 37.0 25.0 37.0 110-114 34.7259 37.0 37.0 37.0 25.0 37.0 115-119 34.7607 37.0 37.0 37.0 25.0 37.0 120-124 34.4344 37.0 37.0 37.0 25.0 37.0 125-129 34.5298 37.0 37.0 37.0 25.0 37.0 130-134 34.1558 37.0 37.0 37.0 25.0 37.0 135-139 33.8839 37.0 37.0 37.0 25.0 37.0 140-144 34.24399999999999 37.0 37.0 37.0 25.0 37.0 145-149 33.873799999999996 37.0 37.0 37.0 25.0 37.0 150-151 33.348 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 1.0 16 0.0 17 1.0 18 0.0 19 3.0 20 2.0 21 3.0 22 3.0 23 7.0 24 7.0 25 13.0 26 13.0 27 15.0 28 25.0 29 45.0 30 46.0 31 76.0 32 99.0 33 206.0 34 401.0 35 982.0 36 1992.0 37 53.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.725 13.450000000000001 11.325000000000001 36.5 2 28.849999999999998 19.875 29.925 21.349999999999998 3 24.9 23.95 25.775 25.374999999999996 4 29.475 29.875 17.025000000000002 23.625 5 28.599999999999998 32.425 18.4 20.575 6 22.6 34.35 19.05 24.0 7 22.325 14.025000000000002 36.8 26.85 8 22.575 20.974999999999998 23.075000000000003 33.375 9 24.075 19.625 26.3 30.0 10-14 26.57 24.25 22.58 26.6 15-19 26.025 24.13 23.35 26.495 20-24 26.590000000000003 24.515 22.814999999999998 26.08 25-29 26.135 24.34 22.96 26.565 30-34 26.38 24.52 23.544999999999998 25.555 35-39 26.555 24.36 23.47 25.615 40-44 26.805 24.085 23.16 25.95 45-49 26.775 24.395 23.225 25.605 50-54 26.334999999999997 24.785 22.625 26.255 55-59 26.6 24.2 22.93 26.27 60-64 26.325 24.34 23.425 25.91 65-69 26.619999999999997 24.19 23.35 25.840000000000003 70-74 26.715 23.71 23.244999999999997 26.33 75-79 26.415 24.085 23.380000000000003 26.119999999999997 80-84 26.179999999999996 24.15 23.630000000000003 26.040000000000003 85-89 26.72 24.245 23.055 25.979999999999997 90-94 26.22 24.560000000000002 23.57 25.650000000000002 95-99 26.39 24.48 23.665 25.465 100-104 26.43 24.5 23.41 25.66 105-109 26.69 24.07 23.200000000000003 26.040000000000003 110-114 27.150000000000002 24.52 22.695 25.635 115-119 26.834999999999997 24.759999999999998 23.05 25.355 120-124 27.315 24.59 23.095 25.0 125-129 26.77 24.654999999999998 23.474999999999998 25.1 130-134 27.334999999999997 24.625 23.04 25.0 135-139 26.525 25.064999999999998 23.05 25.36 140-144 26.69 25.290000000000003 22.869999999999997 25.15 145-149 27.37 24.735 23.24 24.654999999999998 150-151 28.037499999999998 24.85 22.9375 24.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 1.0 24 0.5 25 1.5 26 1.5 27 1.5 28 5.5 29 7.0 30 6.0 31 5.0 32 7.5 33 16.5 34 22.0 35 27.5 36 39.5 37 50.0 38 60.0 39 88.5 40 98.0 41 95.5 42 123.5 43 144.5 44 148.0 45 150.5 46 159.0 47 154.5 48 142.0 49 132.0 50 127.0 51 131.5 52 125.5 53 107.5 54 102.5 55 105.0 56 94.0 57 98.0 58 115.5 59 113.5 60 97.5 61 78.0 62 95.5 63 107.5 64 94.0 65 95.5 66 98.5 67 91.5 68 88.0 69 79.0 70 57.0 71 46.5 72 37.5 73 36.0 74 25.5 75 13.5 76 14.5 77 11.0 78 6.5 79 4.0 80 2.5 81 2.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 1.0 96 0.5 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.499323043596 85.39999999999999 2 6.796642296236122 12.55 3 0.6498781478472786 1.7999999999999998 4 0.027078256160303276 0.1 5 0.0 0.0 6 0.027078256160303276 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.5375 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.7 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.3625 0.0 0.0 0.0 0.0 136-137 1.4249999999999998 0.0 0.0 0.0 0.0 138-139 1.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra Read 1959962 spots for SRR7814948.sra Written 1959962 spots for SRR7814948.sra SRR ids: ['SRR7814948.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j_12eqsm SRR7814948.sra spots: 39199240 blocks: [[1, 1959962], [1959963, 3919924], [3919925, 5879886], [5879887, 7839848], [7839849, 9799810], [9799811, 11759772], [11759773, 13719734], [13719735, 15679696], [15679697, 17639658], [17639659, 19599620], [19599621, 21559582], [21559583, 23519544], [23519545, 25479506], [25479507, 27439468], [27439469, 29399430], [29399431, 31359392], [31359393, 33319354], [33319355, 35279316], [35279317, 37239278], [37239279, 39199240]] SRR7814948 file size 13261635 SRR7814948 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814948 SRR7814948_1.fastq SRR7814948_2.fastq Input file: SRR7814948_1.fastq Paired file: SRR7814948_2.fastq trimmed: SRR7814948-trimmed-pair1.fastq, SRR7814948-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:37:04 2024 >> started Thu Dec 12 02:37:51 2024 >> done (47.235s) 39199240 read pairs processed; of these: 80 ( 0.00%) short read pairs filtered out after trimming by size control 2314 ( 0.01%) empty read pairs filtered out after trimming by size control 39196846 (99.99%) read pairs available; of these: 888823 ( 2.27%) trimmed read pairs available after processing 38308023 (97.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 12 0.00% 21 18 0.00% 22 20 0.00% 23 18 0.00% 24 32 0.00% 25 20 0.00% 26 34 0.00% 27 39 0.00% 28 30 0.00% 29 30 0.00% 30 44 0.00% 31 35 0.00% 32 41 0.00% 33 37 0.00% 34 46 0.00% 35 52 0.00% 36 51 0.00% 37 54 0.00% 38 59 0.00% 39 46 0.00% 40 47 0.00% 41 53 0.00% 42 57 0.00% 43 46 0.00% 44 58 0.00% 45 67 0.00% 46 75 0.00% 47 61 0.00% 48 84 0.00% 49 74 0.00% 50 87 0.00% 51 73 0.00% 52 93 0.00% 53 89 0.00% 54 99 0.00% 55 140 0.00% 56 132 0.00% 57 115 0.00% 58 124 0.00% 59 139 0.00% 60 147 0.00% 61 160 0.00% 62 142 0.00% 63 139 0.00% 64 176 0.00% 65 184 0.00% 66 182 0.00% 67 201 0.00% 68 204 0.00% 69 270 0.00% 70 272 0.00% 71 284 0.00% 72 332 0.00% 73 356 0.00% 74 384 0.00% 75 426 0.00% 76 457 0.00% 77 501 0.00% 78 581 0.00% 79 643 0.00% 80 716 0.00% 81 773 0.00% 82 833 0.00% 83 968 0.00% 84 1053 0.00% 85 1132 0.00% 86 1153 0.00% 87 1345 0.00% 88 1447 0.00% 89 1743 0.00% 90 1712 0.00% 91 1917 0.00% 92 2114 0.01% 93 2280 0.01% 94 2390 0.01% 95 2642 0.01% 96 2832 0.01% 97 3211 0.01% 98 3244 0.01% 99 3789 0.01% 100 3943 0.01% 101 4078 0.01% 102 4415 0.01% 103 4815 0.01% 104 5053 0.01% 105 5385 0.01% 106 5849 0.01% 107 5917 0.02% 108 6404 0.02% 109 6816 0.02% 110 6857 0.02% 111 7476 0.02% 112 7874 0.02% 113 8471 0.02% 114 8838 0.02% 115 9617 0.02% 116 9792 0.02% 117 10144 0.03% 118 10581 0.03% 119 11018 0.03% 120 11386 0.03% 121 12036 0.03% 122 12966 0.03% 123 13399 0.03% 124 14248 0.04% 125 15147 0.04% 126 15539 0.04% 127 15901 0.04% 128 16469 0.04% 129 17160 0.04% 130 17641 0.05% 131 18338 0.05% 132 19356 0.05% 133 20277 0.05% 134 21057 0.05% 135 22094 0.06% 136 22604 0.06% 137 23209 0.06% 138 24334 0.06% 139 25105 0.06% 140 25473 0.06% 141 26631 0.07% 142 27864 0.07% 143 28791 0.07% 144 30136 0.08% 145 31310 0.08% 146 32357 0.08% 147 32842 0.08% 148 34179 0.09% 149 34984 0.09% 150 36867 0.09% 151 38308023 97.73% 39196846 reads passed initial QC criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=32 prefix-density=0.71 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=30 fanout-score=40.25 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=9.6 sequence=GGCGGCGGCGGCCTCGCCGTCGCTGGTGTACTTCCCCAGCTGCGCCAGGGAGTTTGCCTTGGCGCGCAGCAGCAGTGCCTCCTGCGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=8.53 fanout-score-rank=6 prefix-density=0.60 prefix-fanout=5.2 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=137.68 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=6.5 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR7814948 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:39:27 Started mapping on | Dec 12 02:39:28 Finished on | Dec 12 02:44:22 Mapping speed, Million of reads per hour | 479.96 Number of input reads | 39196846 Average input read length | 301 UNIQUE READS: Uniquely mapped reads number | 37092222 Uniquely mapped reads % | 94.63% Average mapped length | 300.25 Number of splices: Total | 39013030 Number of splices: Annotated (sjdb) | 36793746 Number of splices: GT/AG | 38492687 Number of splices: GC/AG | 473530 Number of splices: AT/AC | 16282 Number of splices: Non-canonical | 30531 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 441443 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 40515 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.42% % of reads unmapped: other | 0.72% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1663181 1663181 1663181 N_multimapping 441443 441443 441443 N_noFeature 1367818 35989490 1652292 N_ambiguous 982916 6096 164139 UnstrandedReadsAssigned:34741488 PositiveStrandReadsAssigned:1096636 NegativeStrandReadsAssigned:35275791 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814948 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814948-trimmed-pair1.fastq SRR7814948-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,196,846 reads, 35,640,350 reads pseudoaligned [quant] estimated average fragment length: 326.913 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,168 rounds 52973 SRR7814948.ke.tsv 35125 SRR7814948.se.tsv 88098 total ==> SRR7814948.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 611.126 0 0 PNS24247 1044 718.087 164.857 8.47499 PNS24249 1928 1602.09 163.541 3.76833 PNS24246 1044 718.087 164.857 8.47499 PNS24248 1044 718.087 164.857 8.47499 PNS24244 1471 1145.09 185.887 5.99266 PNS24243 293 69.6054 0 0 KQK14069 1603 1277.09 3421.84 98.9118 KQK14071 474 189.513 22.9127 4.46318 ==> SRR7814948.se.tsv <== BRADI_1g14170v3 3521 BRADI_1g53295v3 214 BRADI_1g59795v3 1571 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 371 BRADI_1g74790v3 301 BRADI_1g09890v3 0 BRADI_1g77505v3 466 BRADI_1g48960v3 0 SRR7814948 completed mapping pipeline successfully