Starting /dee2/code/volunteer_pipeline.sh SRR7814949 current disk space = 1515903057920 free memory = 1570799008 SRR7814949 SRAfilesize 519041785f9b78f5b32bf5bc7c6a15c5 SRR7814949.sra SRR7814949.sra file validated SRR7814949 is paired end SRR7814949 is conventional basespace SRR7814949 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814949_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2785 37.0 37.0 37.0 37.0 37.0 2 36.2585 37.0 37.0 37.0 37.0 37.0 3 36.4475 37.0 37.0 37.0 37.0 37.0 4 36.471 37.0 37.0 37.0 37.0 37.0 5 36.4595 37.0 37.0 37.0 37.0 37.0 6 36.4465 37.0 37.0 37.0 37.0 37.0 7 36.3545 37.0 37.0 37.0 37.0 37.0 8 36.497 37.0 37.0 37.0 37.0 37.0 9 36.485 37.0 37.0 37.0 37.0 37.0 10-14 36.4936 37.0 37.0 37.0 37.0 37.0 15-19 36.507 37.0 37.0 37.0 37.0 37.0 20-24 36.4046 37.0 37.0 37.0 37.0 37.0 25-29 36.4066 37.0 37.0 37.0 37.0 37.0 30-34 36.3909 37.0 37.0 37.0 37.0 37.0 35-39 36.3292 37.0 37.0 37.0 37.0 37.0 40-44 36.3488 37.0 37.0 37.0 37.0 37.0 45-49 36.2832 37.0 37.0 37.0 37.0 37.0 50-54 36.2701 37.0 37.0 37.0 37.0 37.0 55-59 36.246900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.2275 37.0 37.0 37.0 37.0 37.0 65-69 36.1974 37.0 37.0 37.0 37.0 37.0 70-74 36.1543 37.0 37.0 37.0 37.0 37.0 75-79 36.2054 37.0 37.0 37.0 37.0 37.0 80-84 36.069900000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.095 37.0 37.0 37.0 37.0 37.0 90-94 36.016 37.0 37.0 37.0 37.0 37.0 95-99 35.9679 37.0 37.0 37.0 37.0 37.0 100-104 35.959999999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.880700000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.857099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.8331 37.0 37.0 37.0 37.0 37.0 120-124 35.6499 37.0 37.0 37.0 37.0 37.0 125-129 35.593900000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.541399999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5434 37.0 37.0 37.0 37.0 37.0 140-144 35.4387 37.0 37.0 37.0 34.6 37.0 145-149 35.37500000000001 37.0 37.0 37.0 32.2 37.0 150-151 34.5655 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 2.0 24 2.0 25 6.0 26 6.0 27 4.0 28 12.0 29 27.0 30 34.0 31 42.0 32 65.0 33 89.0 34 176.0 35 471.0 36 2856.0 37 206.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.95987963891675 13.014042126379138 9.327983951855568 32.698094282848544 2 25.8 15.825 32.074999999999996 26.3 3 21.6 24.775 25.324999999999996 28.299999999999997 4 27.900000000000002 30.675 19.5 21.925 5 25.974999999999998 30.725 22.725 20.575 6 21.725 32.75 22.25 23.275000000000002 7 17.625 20.05 41.575 20.75 8 21.625 19.400000000000002 27.224999999999998 31.75 9 23.125 18.8 29.9 28.175 10-14 23.96 26.005 24.349999999999998 25.685000000000002 15-19 24.335 24.98 24.154999999999998 26.529999999999998 20-24 24.335 25.285000000000004 24.125 26.255 25-29 24.990000000000002 24.51 24.315 26.185000000000002 30-34 24.33 24.834999999999997 24.560000000000002 26.275 35-39 24.295 24.485 24.834999999999997 26.384999999999998 40-44 24.740000000000002 24.735 24.13 26.395000000000003 45-49 24.82 24.175 24.57 26.435 50-54 24.834999999999997 23.845 24.415 26.905 55-59 24.605 24.195 24.745 26.455000000000002 60-64 24.490000000000002 24.709999999999997 24.404999999999998 26.395000000000003 65-69 24.959999999999997 24.805 23.925 26.31 70-74 24.975 23.985 24.625 26.415 75-79 24.645 24.04 24.46 26.855 80-84 25.15 24.01 23.985 26.855 85-89 24.805 24.2 23.59 27.405 90-94 24.740000000000002 23.895 24.48 26.884999999999998 95-99 25.06 23.52 24.66 26.76 100-104 25.485000000000003 23.69 23.835 26.99 105-109 25.34 24.11 23.69 26.86 110-114 25.25 23.59 24.19 26.97 115-119 26.064999999999998 23.605 23.86 26.47 120-124 25.455 23.435 23.825 27.284999999999997 125-129 25.495 24.195 23.385 26.924999999999997 130-134 25.715 23.685000000000002 23.505000000000003 27.095000000000002 135-139 25.6 23.73 23.335 27.334999999999997 140-144 25.259999999999998 23.44 24.13 27.169999999999998 145-149 25.380000000000003 22.814999999999998 24.2 27.605 150-151 26.0125 23.200000000000003 23.8625 26.924999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 2.5 27 4.5 28 6.5 29 4.0 30 6.0 31 10.5 32 14.0 33 13.5 34 16.5 35 27.0 36 43.0 37 56.5 38 60.0 39 77.0 40 115.5 41 133.0 42 145.5 43 173.0 44 175.5 45 174.0 46 170.5 47 152.5 48 149.5 49 139.5 50 135.0 51 140.0 52 129.5 53 130.0 54 119.0 55 99.5 56 99.5 57 92.5 58 94.5 59 99.5 60 93.0 61 86.0 62 89.0 63 93.5 64 85.5 65 81.0 66 73.5 67 75.5 68 70.0 69 50.5 70 37.5 71 31.0 72 33.5 73 29.5 74 19.5 75 12.5 76 5.5 77 4.5 78 4.0 79 4.0 80 3.5 81 1.0 82 0.5 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.625 #Duplication Level Percentage of deduplicated Percentage of total 1 91.97817189631651 84.275 2 7.03956343792633 12.9 3 0.8731241473396999 2.4 4 0.08185538881309685 0.3 5 0.027285129604365622 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCTTCCCAGAAGATCTCTGGTGATAGTATCCACAAATTCCCGAGAGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0625 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.2625 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.45 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.7125 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.1749999999999998 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.4375 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138-139 1.6749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814949 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814949_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.437 37.0 37.0 37.0 37.0 37.0 2 36.1855 37.0 37.0 37.0 37.0 37.0 3 36.2305 37.0 37.0 37.0 37.0 37.0 4 36.285 37.0 37.0 37.0 37.0 37.0 5 36.3265 37.0 37.0 37.0 37.0 37.0 6 36.198 37.0 37.0 37.0 37.0 37.0 7 36.2045 37.0 37.0 37.0 37.0 37.0 8 36.23 37.0 37.0 37.0 37.0 37.0 9 36.2995 37.0 37.0 37.0 37.0 37.0 10-14 36.2194 37.0 37.0 37.0 37.0 37.0 15-19 36.2057 37.0 37.0 37.0 37.0 37.0 20-24 36.1567 37.0 37.0 37.0 37.0 37.0 25-29 36.1306 37.0 37.0 37.0 37.0 37.0 30-34 36.105000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0403 37.0 37.0 37.0 37.0 37.0 40-44 35.9905 37.0 37.0 37.0 37.0 37.0 45-49 35.984899999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.8206 37.0 37.0 37.0 37.0 37.0 55-59 35.739799999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.7412 37.0 37.0 37.0 37.0 37.0 65-69 35.7219 37.0 37.0 37.0 37.0 37.0 70-74 35.6318 37.0 37.0 37.0 37.0 37.0 75-79 35.634299999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.44670000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.5107 37.0 37.0 37.0 34.6 37.0 90-94 35.428200000000004 37.0 37.0 37.0 37.0 37.0 95-99 35.0339 37.0 37.0 37.0 27.4 37.0 100-104 35.048500000000004 37.0 37.0 37.0 25.0 37.0 105-109 34.7998 37.0 37.0 37.0 25.0 37.0 110-114 34.9423 37.0 37.0 37.0 25.0 37.0 115-119 34.9027 37.0 37.0 37.0 25.0 37.0 120-124 34.6512 37.0 37.0 37.0 25.0 37.0 125-129 34.772299999999994 37.0 37.0 37.0 25.0 37.0 130-134 34.2822 37.0 37.0 37.0 25.0 37.0 135-139 34.1857 37.0 37.0 37.0 25.0 37.0 140-144 34.3898 37.0 37.0 37.0 25.0 37.0 145-149 34.0937 37.0 37.0 37.0 25.0 37.0 150-151 33.5945 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 6.0 16 3.0 17 3.0 18 0.0 19 2.0 20 3.0 21 6.0 22 6.0 23 10.0 24 8.0 25 11.0 26 13.0 27 8.0 28 13.0 29 36.0 30 39.0 31 69.0 32 100.0 33 158.0 34 331.0 35 920.0 36 2188.0 37 64.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.85 15.475 11.15 27.525 2 28.675 20.025000000000002 27.05 24.25 3 26.400000000000002 23.425 27.375 22.8 4 28.7 29.525000000000002 16.900000000000002 24.875 5 29.099999999999998 33.300000000000004 15.275 22.325 6 22.85 34.0 18.075 25.074999999999996 7 21.9 16.3 35.199999999999996 26.6 8 23.65 20.3 21.475 34.575 9 24.7 21.9 23.3 30.099999999999998 10-14 26.150000000000002 24.3 22.24 27.310000000000002 15-19 27.279999999999998 23.455000000000002 23.165 26.1 20-24 27.060000000000002 24.060000000000002 22.74 26.14 25-29 26.565 24.5 22.465 26.47 30-34 27.200000000000003 23.955000000000002 22.435 26.41 35-39 26.474999999999998 24.975 22.185 26.365 40-44 26.900000000000002 24.64 22.275 26.185000000000002 45-49 27.205000000000002 25.0 22.215 25.580000000000002 50-54 27.075 24.51 22.57 25.845000000000002 55-59 27.785 23.79 22.040000000000003 26.384999999999998 60-64 27.27 24.01 22.7 26.02 65-69 27.639999999999997 23.82 22.745 25.795 70-74 26.895000000000003 24.455 22.43 26.22 75-79 27.145000000000003 24.11 22.53 26.215 80-84 26.55 24.33 22.455 26.665 85-89 27.305 23.525 22.865 26.305 90-94 27.075 23.885 22.405 26.634999999999998 95-99 26.71 24.69 22.215 26.384999999999998 100-104 27.505000000000003 24.14 22.5 25.855 105-109 26.795 24.13 22.415 26.66 110-114 27.555000000000003 23.785 22.884999999999998 25.775 115-119 27.355 24.75 22.264999999999997 25.629999999999995 120-124 27.79 23.995 22.435 25.779999999999998 125-129 27.235 24.585 22.295 25.885 130-134 27.465 24.385 22.31 25.840000000000003 135-139 26.87 24.375 22.96 25.795 140-144 27.37 24.305 22.66 25.665 145-149 27.715 24.59 22.25 25.445 150-151 28.375 24.4875 22.0625 25.074999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 1.5 16 1.5 17 1.0 18 2.0 19 1.0 20 1.0 21 1.5 22 1.0 23 0.5 24 1.5 25 1.5 26 1.5 27 2.0 28 1.5 29 2.5 30 2.5 31 3.0 32 5.0 33 6.5 34 15.0 35 22.0 36 25.5 37 38.0 38 50.5 39 62.5 40 75.0 41 91.0 42 109.5 43 133.5 44 139.0 45 127.0 46 139.5 47 153.5 48 150.5 49 160.5 50 155.5 51 137.5 52 128.0 53 120.5 54 119.5 55 109.0 56 105.5 57 109.5 58 109.0 59 108.0 60 96.0 61 97.0 62 113.0 63 110.0 64 100.0 65 95.0 66 97.0 67 97.0 68 88.5 69 75.5 70 62.5 71 51.0 72 46.0 73 39.5 74 26.5 75 22.0 76 18.0 77 10.0 78 4.0 79 2.0 80 3.0 81 2.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 1.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.11606898439638 84.125 2 6.706816315357241 12.25 3 0.903367095537914 2.475 4 0.16424856282507527 0.6 5 0.08212428141253764 0.375 6 0.0 0.0 7 0.027374760470845878 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGATCA 7 0.17500000000000002 No Hit CCCAAACCTCTCTCCCCCCTCGACTCCTTCCCGTCCAGATATCATATTCC 5 0.125 No Hit GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 5 0.125 No Hit AGTGATACCATTTCTGAATGAGAGTATGTTCCATTTGGAAGTTCAGATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.2875 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.7625 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.2000000000000002 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.5750000000000002 0.0 0.0 0.0 0.0 138-139 1.6749999999999998 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGACC 10 0.006830828 145.0 6 CTCTCAC 10 0.006830828 145.0 1 CTGACCT 10 0.006830828 145.0 7 CACTGAC 10 0.006830828 145.0 5 CTCACTG 10 0.006830828 145.0 3 TCTCACT 10 0.006830828 145.0 2 >>END_MODULE Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225271 spots for SRR7814949.sra Written 2225271 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra Read 2225267 spots for SRR7814949.sra Written 2225267 spots for SRR7814949.sra SRR ids: ['SRR7814949.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h7vpy3qo SRR7814949.sra spots: 44505344 blocks: [[1, 2225267], [2225268, 4450534], [4450535, 6675801], [6675802, 8901068], [8901069, 11126335], [11126336, 13351602], [13351603, 15576869], [15576870, 17802136], [17802137, 20027403], [20027404, 22252670], [22252671, 24477937], [24477938, 26703204], [26703205, 28928471], [28928472, 31153738], [31153739, 33379005], [33379006, 35604272], [35604273, 37829539], [37829540, 40054806], [40054807, 42280073], [42280074, 44505344]] SRR7814949 file size 15059700 SRR7814949 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814949 SRR7814949_1.fastq SRR7814949_2.fastq Input file: SRR7814949_1.fastq Paired file: SRR7814949_2.fastq trimmed: SRR7814949-trimmed-pair1.fastq, SRR7814949-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:38:26 2024 >> started Thu Dec 12 02:39:18 2024 >> done (51.718s) 44505344 read pairs processed; of these: 123 ( 0.00%) short read pairs filtered out after trimming by size control 5596 ( 0.01%) empty read pairs filtered out after trimming by size control 44499625 (99.99%) read pairs available; of these: 1226699 ( 2.76%) trimmed read pairs available after processing 43272926 (97.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 15 0.00% 20 21 0.00% 21 21 0.00% 22 33 0.00% 23 31 0.00% 24 34 0.00% 25 34 0.00% 26 30 0.00% 27 40 0.00% 28 37 0.00% 29 38 0.00% 30 46 0.00% 31 52 0.00% 32 67 0.00% 33 57 0.00% 34 68 0.00% 35 67 0.00% 36 59 0.00% 37 78 0.00% 38 81 0.00% 39 69 0.00% 40 81 0.00% 41 70 0.00% 42 85 0.00% 43 75 0.00% 44 101 0.00% 45 93 0.00% 46 95 0.00% 47 89 0.00% 48 109 0.00% 49 110 0.00% 50 109 0.00% 51 105 0.00% 52 119 0.00% 53 124 0.00% 54 126 0.00% 55 148 0.00% 56 156 0.00% 57 163 0.00% 58 171 0.00% 59 192 0.00% 60 196 0.00% 61 193 0.00% 62 224 0.00% 63 259 0.00% 64 222 0.00% 65 239 0.00% 66 258 0.00% 67 273 0.00% 68 297 0.00% 69 334 0.00% 70 344 0.00% 71 390 0.00% 72 446 0.00% 73 447 0.00% 74 480 0.00% 75 554 0.00% 76 582 0.00% 77 683 0.00% 78 750 0.00% 79 861 0.00% 80 867 0.00% 81 941 0.00% 82 1106 0.00% 83 1253 0.00% 84 1377 0.00% 85 1502 0.00% 86 1559 0.00% 87 1712 0.00% 88 1920 0.00% 89 1999 0.00% 90 2270 0.01% 91 2459 0.01% 92 2714 0.01% 93 2949 0.01% 94 3302 0.01% 95 3656 0.01% 96 4030 0.01% 97 4120 0.01% 98 4438 0.01% 99 4816 0.01% 100 5220 0.01% 101 5618 0.01% 102 6130 0.01% 103 6558 0.01% 104 6893 0.02% 105 7471 0.02% 106 7878 0.02% 107 8181 0.02% 108 8507 0.02% 109 8910 0.02% 110 9591 0.02% 111 10215 0.02% 112 11049 0.02% 113 11582 0.03% 114 12523 0.03% 115 13158 0.03% 116 13350 0.03% 117 14387 0.03% 118 14233 0.03% 119 15143 0.03% 120 16033 0.04% 121 16439 0.04% 122 17533 0.04% 123 18761 0.04% 124 19782 0.04% 125 20981 0.05% 126 21555 0.05% 127 21992 0.05% 128 23035 0.05% 129 23594 0.05% 130 24443 0.05% 131 25219 0.06% 132 26693 0.06% 133 28098 0.06% 134 29220 0.07% 135 30789 0.07% 136 31854 0.07% 137 32348 0.07% 138 33581 0.08% 139 34745 0.08% 140 35398 0.08% 141 36852 0.08% 142 38256 0.09% 143 39416 0.09% 144 41928 0.09% 145 43779 0.10% 146 45116 0.10% 147 46437 0.10% 148 47145 0.11% 149 47983 0.11% 150 50760 0.11% 151 43272926 97.24% 44499625 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=18 prefix-density=0.91 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=14.37 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.8 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.33 fanout-score-rank=33 prefix-density=0.62 prefix-fanout=1.2 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=103.63 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=6.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR7814949 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:40:09 Started mapping on | Dec 12 02:40:09 Finished on | Dec 12 02:43:44 Mapping speed, Million of reads per hour | 745.11 Number of input reads | 44499625 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 41344955 Uniquely mapped reads % | 92.91% Average mapped length | 299.92 Number of splices: Total | 43096568 Number of splices: Annotated (sjdb) | 40854491 Number of splices: GT/AG | 42504279 Number of splices: GC/AG | 545547 Number of splices: AT/AC | 13583 Number of splices: Non-canonical | 33159 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 490230 % of reads mapped to multiple loci | 1.10% Number of reads mapped to too many loci | 52357 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2664440 2664440 2664440 N_multimapping 490230 490230 490230 N_noFeature 1192447 40025569 1520902 N_ambiguous 1163301 5992 173701 UnstrandedReadsAssigned:38989207 PositiveStrandReadsAssigned:1313394 NegativeStrandReadsAssigned:39650352 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814949 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814949-trimmed-pair1.fastq SRR7814949-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 44,499,625 reads, 40,217,708 reads pseudoaligned [quant] estimated average fragment length: 319.156 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR7814949.ke.tsv 35125 SRR7814949.se.tsv 88098 total ==> SRR7814949.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 618.699 0 0 PNS24247 1044 725.844 88.4407 3.78195 PNS24249 1928 1609.84 106.402 2.0515 PNS24246 1044 725.844 88.4407 3.78195 PNS24248 1044 725.844 88.4407 3.78195 PNS24244 1471 1152.84 224.276 6.03837 PNS24243 293 73.3157 0 0 KQK14069 1603 1284.84 2794.6 67.5113 KQK14071 474 195.711 19.2271 3.04934 ==> SRR7814949.se.tsv <== BRADI_1g14170v3 2832 BRADI_1g53295v3 284 BRADI_1g59795v3 1040 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 668 BRADI_1g74790v3 417 BRADI_1g09890v3 0 BRADI_1g77505v3 564 BRADI_1g48960v3 0 SRR7814949 completed mapping pipeline successfully