Starting /dee2/code/volunteer_pipeline.sh SRR7814950 current disk space = 1515870314496 free memory = 1570809220 SRR7814950 SRAfilesize 30f0309637105b0ab3a0c90d07ea4964 SRR7814950.sra SRR7814950.sra file validated SRR7814950 is paired end SRR7814950 is conventional basespace SRR7814950 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814950_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.377 37.0 37.0 37.0 37.0 37.0 2 36.31 37.0 37.0 37.0 37.0 37.0 3 36.4975 37.0 37.0 37.0 37.0 37.0 4 36.58 37.0 37.0 37.0 37.0 37.0 5 36.604 37.0 37.0 37.0 37.0 37.0 6 36.5725 37.0 37.0 37.0 37.0 37.0 7 36.549 37.0 37.0 37.0 37.0 37.0 8 36.6085 37.0 37.0 37.0 37.0 37.0 9 36.59 37.0 37.0 37.0 37.0 37.0 10-14 36.580200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.547 37.0 37.0 37.0 37.0 37.0 20-24 36.5109 37.0 37.0 37.0 37.0 37.0 25-29 36.4431 37.0 37.0 37.0 37.0 37.0 30-34 36.498599999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4258 37.0 37.0 37.0 37.0 37.0 40-44 36.466899999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.4124 37.0 37.0 37.0 37.0 37.0 50-54 36.3686 37.0 37.0 37.0 37.0 37.0 55-59 36.311 37.0 37.0 37.0 37.0 37.0 60-64 36.2897 37.0 37.0 37.0 37.0 37.0 65-69 36.2119 37.0 37.0 37.0 37.0 37.0 70-74 36.235099999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.1668 37.0 37.0 37.0 37.0 37.0 80-84 36.14020000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1225 37.0 37.0 37.0 37.0 37.0 90-94 36.02929999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.053000000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.009 37.0 37.0 37.0 37.0 37.0 105-109 35.98700000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.916700000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.8856 37.0 37.0 37.0 37.0 37.0 120-124 35.828500000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.703199999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.6413 37.0 37.0 37.0 37.0 37.0 135-139 35.6392 37.0 37.0 37.0 37.0 37.0 140-144 35.5608 37.0 37.0 37.0 37.0 37.0 145-149 35.4665 37.0 37.0 37.0 34.6 37.0 150-151 34.738749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 2.0 24 1.0 25 3.0 26 5.0 27 6.0 28 12.0 29 20.0 30 32.0 31 46.0 32 60.0 33 82.0 34 136.0 35 427.0 36 2903.0 37 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.556390977443606 12.330827067669173 10.977443609022556 34.13533834586466 2 25.474999999999998 16.625 30.65 27.250000000000004 3 23.525 24.375 23.575 28.525 4 27.55 30.049999999999997 19.675 22.725 5 26.075 30.65 22.125 21.15 6 21.825 32.65 22.75 22.775000000000002 7 17.275 19.3 40.575 22.85 8 20.349999999999998 21.175 27.05 31.424999999999997 9 20.525 19.6 29.75 30.125 10-14 23.990000000000002 26.325 23.48 26.205000000000002 15-19 23.985 24.525 24.610000000000003 26.88 20-24 24.095 25.11 24.654999999999998 26.14 25-29 24.195 25.36 24.125 26.32 30-34 24.34 25.019999999999996 24.14 26.5 35-39 24.34 24.529999999999998 24.595 26.534999999999997 40-44 24.93 24.64 23.995 26.435 45-49 24.795 24.585 23.59 27.029999999999998 50-54 23.93 24.560000000000002 24.46 27.05 55-59 24.48 24.490000000000002 23.669999999999998 27.36 60-64 24.69 24.785 23.48 27.045 65-69 24.485 24.665 23.84 27.01 70-74 24.785 23.830000000000002 23.97 27.415 75-79 25.115 24.05 23.724999999999998 27.11 80-84 24.115000000000002 24.245 24.345 27.295 85-89 24.985 23.885 24.169999999999998 26.96 90-94 24.94 23.91 23.895 27.255000000000003 95-99 24.68 23.275000000000002 24.4 27.644999999999996 100-104 24.81 24.055 24.22 26.915 105-109 24.9 23.645 24.104999999999997 27.35 110-114 24.825 23.580000000000002 23.935000000000002 27.66 115-119 25.369999999999997 23.325000000000003 23.54 27.765 120-124 25.564999999999998 23.13 23.625 27.68 125-129 25.195 23.39 23.645 27.77 130-134 25.669999999999998 23.345 24.044999999999998 26.939999999999998 135-139 25.995 23.47 23.365 27.169999999999998 140-144 25.490000000000002 23.330000000000002 23.54 27.639999999999997 145-149 25.72 22.775000000000002 23.810000000000002 27.694999999999997 150-151 26.05 22.9875 23.1 27.8625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 2.0 29 3.5 30 5.5 31 7.5 32 10.5 33 15.5 34 21.5 35 31.5 36 39.5 37 52.5 38 74.0 39 86.5 40 99.5 41 121.5 42 138.5 43 148.5 44 147.0 45 147.5 46 156.5 47 182.5 48 198.0 49 185.5 50 165.0 51 143.5 52 142.5 53 133.0 54 122.0 55 106.0 56 90.0 57 93.5 58 92.5 59 85.0 60 86.0 61 92.5 62 79.5 63 68.5 64 65.5 65 70.0 66 66.0 67 56.5 68 60.0 69 53.0 70 49.5 71 44.5 72 34.0 73 36.0 74 31.5 75 18.0 76 9.5 77 6.5 78 7.5 79 7.0 80 4.5 81 1.5 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.67121791370836 83.92500000000001 2 7.5095576187875475 13.750000000000002 3 0.7373020207536866 2.025 4 0.0819224467504096 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.23750000000000002 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.6375 0.0 0.0 0.0 0.0 120-121 0.7124999999999999 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.55 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.7374999999999998 0.0 0.0 0.0 0.0 136-137 1.8625 0.0 0.0 0.0 0.0 138-139 2.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGACAA 10 0.006830828 145.0 2 >>END_MODULE SRR7814950 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814950_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.475 37.0 37.0 37.0 37.0 37.0 2 36.147 37.0 37.0 37.0 37.0 37.0 3 36.253 37.0 37.0 37.0 37.0 37.0 4 36.091 37.0 37.0 37.0 37.0 37.0 5 36.272 37.0 37.0 37.0 37.0 37.0 6 36.0545 37.0 37.0 37.0 37.0 37.0 7 36.058 37.0 37.0 37.0 37.0 37.0 8 36.1925 37.0 37.0 37.0 37.0 37.0 9 36.2575 37.0 37.0 37.0 37.0 37.0 10-14 36.1723 37.0 37.0 37.0 37.0 37.0 15-19 36.0988 37.0 37.0 37.0 37.0 37.0 20-24 36.0279 37.0 37.0 37.0 37.0 37.0 25-29 35.9393 37.0 37.0 37.0 37.0 37.0 30-34 35.893899999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.925200000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.821 37.0 37.0 37.0 37.0 37.0 45-49 35.803000000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.662 37.0 37.0 37.0 37.0 37.0 55-59 35.583800000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.478300000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.492200000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.5154 37.0 37.0 37.0 37.0 37.0 75-79 35.3692 37.0 37.0 37.0 37.0 37.0 80-84 35.3472 37.0 37.0 37.0 34.6 37.0 85-89 35.4233 37.0 37.0 37.0 34.6 37.0 90-94 35.17059999999999 37.0 37.0 37.0 27.4 37.0 95-99 34.84740000000001 37.0 37.0 37.0 25.0 37.0 100-104 34.9242 37.0 37.0 37.0 25.0 37.0 105-109 34.722699999999996 37.0 37.0 37.0 25.0 37.0 110-114 34.7938 37.0 37.0 37.0 25.0 37.0 115-119 34.8317 37.0 37.0 37.0 25.0 37.0 120-124 34.485400000000006 37.0 37.0 37.0 25.0 37.0 125-129 34.6263 37.0 37.0 37.0 25.0 37.0 130-134 34.2257 37.0 37.0 37.0 25.0 37.0 135-139 34.1418 37.0 37.0 37.0 25.0 37.0 140-144 34.3677 37.0 37.0 37.0 25.0 37.0 145-149 34.017100000000006 37.0 37.0 37.0 25.0 37.0 150-151 33.59975 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 13.0 15 7.0 16 13.0 17 4.0 18 1.0 19 2.0 20 3.0 21 7.0 22 10.0 23 10.0 24 8.0 25 10.0 26 7.0 27 16.0 28 22.0 29 25.0 30 30.0 31 64.0 32 70.0 33 155.0 34 338.0 35 969.0 36 2158.0 37 55.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.125 14.075 11.675 31.125000000000004 2 30.925000000000004 19.125 25.924999999999997 24.025 3 28.050000000000004 22.875 25.525 23.549999999999997 4 30.0 30.225 16.875 22.900000000000002 5 28.849999999999998 31.75 17.349999999999998 22.05 6 24.575 33.125 17.7 24.6 7 23.849999999999998 16.375 33.875 25.900000000000002 8 25.424999999999997 20.0 20.724999999999998 33.85 9 25.0 23.474999999999998 22.475 29.049999999999997 10-14 27.525 24.995 21.255 26.224999999999998 15-19 27.325 23.925 21.790000000000003 26.96 20-24 26.950000000000003 23.974999999999998 22.005 27.07 25-29 27.295 24.33 22.07 26.305 30-34 27.345000000000002 24.435000000000002 22.42 25.8 35-39 27.169999999999998 23.849999999999998 22.915 26.064999999999998 40-44 27.915 23.849999999999998 22.68 25.555 45-49 27.315 23.845 22.785 26.055 50-54 27.200000000000003 24.59 22.405 25.805 55-59 27.405 24.09 22.3 26.205000000000002 60-64 27.925 24.47 22.23 25.374999999999996 65-69 27.975 24.605 22.259999999999998 25.16 70-74 27.865000000000002 24.9 22.525000000000002 24.709999999999997 75-79 27.72 24.215 23.0 25.064999999999998 80-84 27.37 24.815 22.134999999999998 25.679999999999996 85-89 27.860000000000003 24.455 22.314999999999998 25.369999999999997 90-94 27.189999999999998 24.490000000000002 22.78 25.540000000000003 95-99 27.655 24.805 22.245 25.295 100-104 27.639999999999997 23.97 23.09 25.3 105-109 27.389999999999997 24.455 22.675 25.480000000000004 110-114 28.499999999999996 24.48 22.095000000000002 24.925 115-119 28.015 24.665 22.715 24.605 120-124 27.63 24.224999999999998 22.770000000000003 25.374999999999996 125-129 27.825 24.905 22.605 24.665 130-134 27.68 24.69 22.545 25.085 135-139 28.37 24.465 22.54 24.625 140-144 28.425 24.465 22.665 24.445 145-149 27.605 24.825 22.57 25.0 150-151 28.487499999999997 24.4875 22.912499999999998 24.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 0.5 25 0.5 26 0.5 27 0.5 28 0.5 29 3.0 30 6.0 31 5.0 32 5.5 33 5.5 34 10.5 35 13.0 36 18.0 37 31.0 38 46.5 39 66.5 40 69.0 41 71.5 42 101.0 43 130.0 44 142.5 45 148.5 46 156.5 47 171.5 48 183.0 49 175.0 50 155.5 51 140.5 52 133.0 53 142.5 54 142.0 55 124.0 56 121.5 57 116.0 58 105.0 59 101.0 60 85.5 61 73.5 62 87.0 63 95.0 64 86.0 65 89.0 66 86.5 67 72.0 68 64.5 69 60.5 70 52.0 71 47.0 72 46.5 73 50.5 74 41.5 75 25.5 76 20.5 77 15.0 78 12.5 79 9.5 80 5.0 81 2.0 82 2.5 83 2.0 84 0.0 85 1.0 86 2.0 87 1.0 88 0.5 89 1.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 1.0 98 1.5 99 1.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 91.85124418922615 83.975 2 7.246376811594203 13.25 3 0.7109652720809406 1.95 4 0.10937927262783702 0.4 5 0.05468963631391851 0.25 6 0.0 0.0 7 0.027344818156959255 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 5 0.125 No Hit CCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTCTTCCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.1125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.23750000000000002 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.6625 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.8375 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.2125 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 1.9125 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593330 spots for SRR7814950.sra Written 1593330 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra Read 1593318 spots for SRR7814950.sra Written 1593318 spots for SRR7814950.sra SRR ids: ['SRR7814950.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v07yx4si SRR7814950.sra spots: 31866372 blocks: [[1, 1593318], [1593319, 3186636], [3186637, 4779954], [4779955, 6373272], [6373273, 7966590], [7966591, 9559908], [9559909, 11153226], [11153227, 12746544], [12746545, 14339862], [14339863, 15933180], [15933181, 17526498], [17526499, 19119816], [19119817, 20713134], [20713135, 22306452], [22306453, 23899770], [23899771, 25493088], [25493089, 27086406], [27086407, 28679724], [28679725, 30273042], [30273043, 31866372]] SRR7814950 file size 10776767 SRR7814950 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814950 SRR7814950_1.fastq SRR7814950_2.fastq Input file: SRR7814950_1.fastq Paired file: SRR7814950_2.fastq trimmed: SRR7814950-trimmed-pair1.fastq, SRR7814950-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:38:19 2024 >> started Thu Dec 12 02:38:58 2024 >> done (38.942s) 31866372 read pairs processed; of these: 73 ( 0.00%) short read pairs filtered out after trimming by size control 6644 ( 0.02%) empty read pairs filtered out after trimming by size control 31859655 (99.98%) read pairs available; of these: 1081130 ( 3.39%) trimmed read pairs available after processing 30778525 (96.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 11 0.00% 20 14 0.00% 21 15 0.00% 22 21 0.00% 23 35 0.00% 24 20 0.00% 25 36 0.00% 26 35 0.00% 27 32 0.00% 28 39 0.00% 29 30 0.00% 30 35 0.00% 31 45 0.00% 32 57 0.00% 33 43 0.00% 34 49 0.00% 35 44 0.00% 36 68 0.00% 37 69 0.00% 38 82 0.00% 39 73 0.00% 40 61 0.00% 41 59 0.00% 42 82 0.00% 43 66 0.00% 44 88 0.00% 45 91 0.00% 46 103 0.00% 47 80 0.00% 48 100 0.00% 49 130 0.00% 50 92 0.00% 51 108 0.00% 52 111 0.00% 53 128 0.00% 54 125 0.00% 55 145 0.00% 56 122 0.00% 57 126 0.00% 58 113 0.00% 59 135 0.00% 60 193 0.00% 61 227 0.00% 62 186 0.00% 63 182 0.00% 64 181 0.00% 65 190 0.00% 66 214 0.00% 67 247 0.00% 68 255 0.00% 69 280 0.00% 70 318 0.00% 71 343 0.00% 72 344 0.00% 73 413 0.00% 74 391 0.00% 75 444 0.00% 76 466 0.00% 77 533 0.00% 78 582 0.00% 79 745 0.00% 80 694 0.00% 81 808 0.00% 82 932 0.00% 83 999 0.00% 84 1137 0.00% 85 1252 0.00% 86 1363 0.00% 87 1407 0.00% 88 1582 0.00% 89 1809 0.01% 90 1994 0.01% 91 2112 0.01% 92 2289 0.01% 93 2523 0.01% 94 2856 0.01% 95 3058 0.01% 96 3398 0.01% 97 3459 0.01% 98 3738 0.01% 99 4145 0.01% 100 4342 0.01% 101 4618 0.01% 102 5271 0.02% 103 5556 0.02% 104 5985 0.02% 105 6224 0.02% 106 6493 0.02% 107 6848 0.02% 108 7176 0.02% 109 7760 0.02% 110 8069 0.03% 111 8879 0.03% 112 9589 0.03% 113 9875 0.03% 114 10580 0.03% 115 11268 0.04% 116 11393 0.04% 117 12327 0.04% 118 12594 0.04% 119 13058 0.04% 120 13782 0.04% 121 14470 0.05% 122 15656 0.05% 123 16124 0.05% 124 17238 0.05% 125 18033 0.06% 126 18468 0.06% 127 19274 0.06% 128 19803 0.06% 129 20860 0.07% 130 21572 0.07% 131 22447 0.07% 132 23462 0.07% 133 24727 0.08% 134 26301 0.08% 135 27403 0.09% 136 27927 0.09% 137 28655 0.09% 138 30134 0.09% 139 30899 0.10% 140 31898 0.10% 141 32881 0.10% 142 34532 0.11% 143 35564 0.11% 144 37142 0.12% 145 38858 0.12% 146 40775 0.13% 147 41386 0.13% 148 41859 0.13% 149 43236 0.14% 150 46641 0.15% 151 30778525 96.61% 31859655 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=7.76 fanout-score-rank=18 prefix-density=0.86 prefix-fanout=5.1 sequence=CCGCACTTGCAGCCTCCGTTCTCGGCTCCGGCGGCGGCG criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=205.26 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=30.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=3.98 fanout-score-rank=26 prefix-density=1.19 prefix-fanout=3.4 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=26 fanout-score=124.79 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=18.9 sequence=CGCCGCCGCCGC SRR7814950 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:39:55 Started mapping on | Dec 12 02:39:57 Finished on | Dec 12 02:47:12 Mapping speed, Million of reads per hour | 263.67 Number of input reads | 31859655 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 28402895 Uniquely mapped reads % | 89.15% Average mapped length | 299.72 Number of splices: Total | 25620809 Number of splices: Annotated (sjdb) | 24031080 Number of splices: GT/AG | 25320214 Number of splices: GC/AG | 265085 Number of splices: AT/AC | 13661 Number of splices: Non-canonical | 21849 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275553 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 26915 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.36% % of reads unmapped: other | 0.54% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3181207 3181207 3181207 N_multimapping 275553 275553 275553 N_noFeature 542518 27498668 855986 N_ambiguous 673957 4456 85687 UnstrandedReadsAssigned:27186420 PositiveStrandReadsAssigned:899771 NegativeStrandReadsAssigned:27461222 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814950 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814950-trimmed-pair1.fastq SRR7814950-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,859,655 reads, 28,222,135 reads pseudoaligned [quant] estimated average fragment length: 291.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 SRR7814950.ke.tsv 35125 SRR7814950.se.tsv 88098 total ==> SRR7814950.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 646.153 27.4357 1.68318 PNS24247 1044 753.77 102.443 5.38759 PNS24249 1928 1637.77 149.17 3.61058 PNS24246 1044 753.77 102.443 5.38759 PNS24248 1044 753.77 102.443 5.38759 PNS24244 1471 1180.77 280.065 9.40249 PNS24243 293 75.0891 0 0 KQK14069 1603 1312.77 19015.5 574.206 KQK14071 474 206.194 126.265 24.2748 ==> SRR7814950.se.tsv <== BRADI_1g14170v3 19092 BRADI_1g53295v3 464 BRADI_1g59795v3 433 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 1539 BRADI_1g74790v3 326 BRADI_1g09890v3 0 BRADI_1g77505v3 418 BRADI_1g48960v3 0 SRR7814950 completed mapping pipeline successfully