Starting /dee2/code/volunteer_pipeline.sh SRR7814951 current disk space = 1545763139584 free memory = 1597761564 SRR7814951 SRAfilesize d9cb30521be658ab890cc0a29819a885 SRR7814951.sra SRR7814951.sra file validated SRR7814951 is paired end SRR7814951 is conventional basespace SRR7814951 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814951_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32825 37.0 37.0 37.0 37.0 37.0 2 36.375 37.0 37.0 37.0 37.0 37.0 3 36.4335 37.0 37.0 37.0 37.0 37.0 4 36.564 37.0 37.0 37.0 37.0 37.0 5 36.4745 37.0 37.0 37.0 37.0 37.0 6 36.4085 37.0 37.0 37.0 37.0 37.0 7 36.3465 37.0 37.0 37.0 37.0 37.0 8 36.4295 37.0 37.0 37.0 37.0 37.0 9 36.537 37.0 37.0 37.0 37.0 37.0 10-14 36.512800000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.440000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.4351 37.0 37.0 37.0 37.0 37.0 25-29 36.3937 37.0 37.0 37.0 37.0 37.0 30-34 36.4065 37.0 37.0 37.0 37.0 37.0 35-39 36.3793 37.0 37.0 37.0 37.0 37.0 40-44 36.3387 37.0 37.0 37.0 37.0 37.0 45-49 36.304899999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.230900000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.266 37.0 37.0 37.0 37.0 37.0 60-64 36.175200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.13719999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.0719 37.0 37.0 37.0 37.0 37.0 75-79 36.096000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.133300000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.031499999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.9777 37.0 37.0 37.0 37.0 37.0 95-99 35.965599999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.9 37.0 37.0 37.0 37.0 37.0 105-109 35.9308 37.0 37.0 37.0 37.0 37.0 110-114 35.8045 37.0 37.0 37.0 37.0 37.0 115-119 35.7937 37.0 37.0 37.0 37.0 37.0 120-124 35.642 37.0 37.0 37.0 37.0 37.0 125-129 35.5653 37.0 37.0 37.0 37.0 37.0 130-134 35.5467 37.0 37.0 37.0 37.0 37.0 135-139 35.528000000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.46470000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.3586 37.0 37.0 37.0 34.6 37.0 150-151 34.628 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 3.0 26 4.0 27 14.0 28 18.0 29 23.0 30 35.0 31 60.0 32 73.0 33 79.0 34 161.0 35 438.0 36 2849.0 37 237.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.760722347629795 11.43717080511663 9.781790820165538 37.020316027088036 2 24.625 17.125 33.175 25.074999999999996 3 23.0 22.45 23.799999999999997 30.75 4 27.450000000000003 29.275000000000002 19.075 24.2 5 26.35 31.05 21.775 20.825 6 21.45 34.025 23.0 21.525 7 16.875 20.200000000000003 41.65 21.275 8 21.025 21.3 27.0 30.675 9 21.75 20.125 29.799999999999997 28.325 10-14 23.44 26.07 24.560000000000002 25.929999999999996 15-19 23.565 24.425 25.27 26.740000000000002 20-24 23.419999999999998 25.05 24.9 26.63 25-29 24.03 24.645 24.88 26.445 30-34 23.015 25.215 24.935 26.834999999999997 35-39 24.2 24.805 24.755 26.240000000000002 40-44 24.224999999999998 24.94 24.404999999999998 26.43 45-49 24.169999999999998 24.925 24.595 26.31 50-54 23.86 25.080000000000002 24.875 26.185000000000002 55-59 23.705000000000002 24.635 24.759999999999998 26.900000000000002 60-64 24.645 24.5 24.765 26.090000000000003 65-69 23.86 24.325 25.224999999999998 26.590000000000003 70-74 24.33 24.635 24.485 26.55 75-79 24.64 24.51 24.625 26.224999999999998 80-84 24.29 25.215 24.560000000000002 25.935000000000002 85-89 24.495 23.735 25.025 26.745 90-94 24.654999999999998 23.919999999999998 24.345 27.08 95-99 24.335 23.93 24.715 27.02 100-104 24.895 23.36 25.115 26.63 105-109 24.66 23.810000000000002 24.665 26.865 110-114 24.185000000000002 24.035 24.585 27.195000000000004 115-119 25.180000000000003 23.875 24.310000000000002 26.634999999999998 120-124 25.145 23.53 24.635 26.69 125-129 24.884999999999998 23.875 24.044999999999998 27.195000000000004 130-134 25.080000000000002 23.745 24.585 26.590000000000003 135-139 25.15 23.49 24.05 27.310000000000002 140-144 25.019999999999996 23.735 24.5 26.745 145-149 25.430000000000003 23.799999999999997 23.885 26.884999999999998 150-151 25.3 23.275000000000002 24.5375 26.887499999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 2.5 29 5.0 30 5.5 31 8.0 32 11.5 33 16.0 34 19.5 35 28.0 36 41.0 37 51.0 38 66.5 39 81.0 40 99.5 41 127.5 42 145.0 43 160.0 44 184.5 45 201.0 46 194.0 47 191.0 48 177.0 49 164.5 50 171.0 51 150.5 52 150.5 53 133.5 54 102.5 55 112.5 56 106.0 57 98.0 58 97.0 59 84.5 60 74.5 61 69.5 62 72.5 63 70.5 64 58.0 65 55.0 66 64.0 67 69.5 68 64.0 69 48.0 70 35.0 71 27.5 72 18.0 73 20.0 74 19.5 75 10.5 76 9.5 77 10.0 78 6.5 79 2.0 80 0.5 81 1.5 82 1.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.8 #Duplication Level Percentage of deduplicated Percentage of total 1 91.96623093681917 84.425 2 7.27124183006536 13.350000000000001 3 0.6535947712418301 1.7999999999999998 4 0.08169934640522876 0.3 5 0.027233115468409588 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.44999999999999996 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.5375000000000001 0.0 0.0 0.0 0.0 126-127 0.6625 0.0 0.0 0.0 0.0 128-129 0.7625 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.8999999999999999 0.0 0.0 0.0 0.0 134-135 1.0125 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7814951 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814951_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.192 37.0 37.0 37.0 37.0 37.0 2 35.8875 37.0 37.0 37.0 37.0 37.0 3 35.9665 37.0 37.0 37.0 37.0 37.0 4 35.9735 37.0 37.0 37.0 37.0 37.0 5 35.9635 37.0 37.0 37.0 37.0 37.0 6 35.902 37.0 37.0 37.0 37.0 37.0 7 35.865 37.0 37.0 37.0 37.0 37.0 8 36.047 37.0 37.0 37.0 37.0 37.0 9 35.9975 37.0 37.0 37.0 37.0 37.0 10-14 35.8909 37.0 37.0 37.0 37.0 37.0 15-19 35.803200000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.8071 37.0 37.0 37.0 37.0 37.0 25-29 35.7257 37.0 37.0 37.0 37.0 37.0 30-34 35.695800000000006 37.0 37.0 37.0 37.0 37.0 35-39 35.6379 37.0 37.0 37.0 37.0 37.0 40-44 35.6035 37.0 37.0 37.0 37.0 37.0 45-49 35.5135 37.0 37.0 37.0 37.0 37.0 50-54 35.3755 37.0 37.0 37.0 37.0 37.0 55-59 35.2417 37.0 37.0 37.0 34.6 37.0 60-64 35.17550000000001 37.0 37.0 37.0 32.2 37.0 65-69 35.2864 37.0 37.0 37.0 34.6 37.0 70-74 35.075900000000004 37.0 37.0 37.0 25.0 37.0 75-79 35.028200000000005 37.0 37.0 37.0 25.0 37.0 80-84 34.882999999999996 37.0 37.0 37.0 25.0 37.0 85-89 34.9639 37.0 37.0 37.0 25.0 37.0 90-94 34.843199999999996 37.0 37.0 37.0 25.0 37.0 95-99 34.424899999999994 37.0 37.0 37.0 25.0 37.0 100-104 34.5393 37.0 37.0 37.0 25.0 37.0 105-109 34.24979999999999 37.0 37.0 37.0 25.0 37.0 110-114 34.3495 37.0 37.0 37.0 25.0 37.0 115-119 34.3662 37.0 37.0 37.0 25.0 37.0 120-124 34.039 37.0 37.0 37.0 25.0 37.0 125-129 34.0871 37.0 37.0 37.0 25.0 37.0 130-134 33.7451 37.0 37.0 37.0 25.0 37.0 135-139 33.553799999999995 37.0 37.0 37.0 25.0 37.0 140-144 33.748 37.0 37.0 37.0 25.0 37.0 145-149 33.5278 37.0 37.0 37.0 25.0 37.0 150-151 32.89675 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 6.0 14 12.0 15 10.0 16 8.0 17 3.0 18 2.0 19 6.0 20 4.0 21 14.0 22 8.0 23 10.0 24 14.0 25 7.0 26 11.0 27 14.0 28 20.0 29 44.0 30 54.0 31 95.0 32 116.0 33 215.0 34 464.0 35 1097.0 36 1734.0 37 30.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.699999999999996 13.425 11.774999999999999 33.1 2 29.75 21.55 27.675 21.025 3 25.775 24.275 24.425 25.525 4 28.7 30.7 17.925 22.675 5 29.025000000000002 34.0 16.650000000000002 20.325 6 23.45 34.225 20.3 22.025 7 22.95 15.275 35.199999999999996 26.575 8 22.975 22.075 22.15 32.800000000000004 9 24.45 21.8 25.5 28.249999999999996 10-14 27.305 24.959999999999997 21.584999999999997 26.150000000000002 15-19 26.810000000000002 24.43 22.64 26.119999999999997 20-24 26.295 24.765 23.04 25.900000000000002 25-29 26.855 24.709999999999997 22.925 25.509999999999998 30-34 27.505000000000003 24.4 22.715 25.380000000000003 35-39 26.905 24.73 22.875 25.490000000000002 40-44 27.08 24.42 22.515 25.985000000000003 45-49 26.779999999999998 25.47 21.9 25.85 50-54 26.825 24.495 23.205000000000002 25.474999999999998 55-59 27.145000000000003 24.55 22.615 25.69 60-64 27.095000000000002 24.89 22.6 25.415 65-69 26.895000000000003 24.82 22.945 25.34 70-74 26.82 24.975 23.48 24.725 75-79 27.145000000000003 25.235000000000003 22.86 24.759999999999998 80-84 27.37 24.985 22.53 25.115 85-89 27.495000000000005 24.86 22.93 24.715 90-94 27.055 24.605 22.905 25.435000000000002 95-99 27.450000000000003 24.565 22.605 25.380000000000003 100-104 27.96 24.555 22.220000000000002 25.264999999999997 105-109 27.089999999999996 24.959999999999997 22.509999999999998 25.44 110-114 26.75 24.945 22.919999999999998 25.385 115-119 28.000000000000004 24.615000000000002 22.939999999999998 24.445 120-124 27.245 25.224999999999998 22.875 24.654999999999998 125-129 27.205000000000002 24.834999999999997 22.564999999999998 25.395 130-134 27.189999999999998 24.87 22.759999999999998 25.180000000000003 135-139 26.715 25.014999999999997 23.25 25.019999999999996 140-144 26.615 25.75 23.265 24.37 145-149 27.685 24.834999999999997 22.555 24.925 150-151 27.6875 24.762500000000003 23.525 24.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 2.0 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.0 15 1.5 16 2.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.0 27 1.5 28 1.5 29 2.0 30 5.0 31 8.0 32 6.5 33 6.0 34 13.5 35 19.5 36 28.0 37 39.5 38 54.0 39 72.5 40 84.0 41 105.0 42 128.0 43 140.0 44 143.0 45 156.0 46 168.5 47 164.0 48 153.0 49 152.0 50 156.0 51 163.5 52 151.5 53 124.0 54 119.5 55 113.0 56 110.5 57 101.5 58 90.5 59 102.0 60 100.5 61 90.5 62 84.0 63 79.5 64 77.5 65 72.0 66 82.5 67 83.0 68 68.5 69 65.5 70 57.0 71 47.0 72 39.0 73 33.0 74 28.0 75 21.5 76 17.5 77 10.5 78 6.0 79 4.5 80 4.0 81 1.5 82 1.0 83 1.5 84 1.0 85 0.5 86 0.0 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 1.0 96 0.5 97 0.0 98 1.0 99 3.0 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.7 #Duplication Level Percentage of deduplicated Percentage of total 1 92.23009814612868 84.575 2 6.9792802617230105 12.8 3 0.5997818974918212 1.6500000000000001 4 0.13631406761177753 0.5 5 0.02726281352235551 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02726281352235551 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit CAGAAACATCCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.125 0.0 0.0 0.0 0.0 110-111 0.2375 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.3875 0.0 0.0 0.0 0.0 120-121 0.42500000000000004 0.0 0.0 0.0 0.0 122-123 0.5 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.125 0.0 0.0 0.0 0.0 138-139 1.2000000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGAAT 10 0.006830828 145.0 1 >>END_MODULE Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100123 spots for SRR7814951.sra Written 2100123 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra Read 2100109 spots for SRR7814951.sra Written 2100109 spots for SRR7814951.sra SRR ids: ['SRR7814951.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zgf7358j SRR7814951.sra spots: 42002194 blocks: [[1, 2100109], [2100110, 4200218], [4200219, 6300327], [6300328, 8400436], [8400437, 10500545], [10500546, 12600654], [12600655, 14700763], [14700764, 16800872], [16800873, 18900981], [18900982, 21001090], [21001091, 23101199], [23101200, 25201308], [25201309, 27301417], [27301418, 29401526], [29401527, 31501635], [31501636, 33601744], [33601745, 35701853], [35701854, 37801962], [37801963, 39902071], [39902072, 42002194]] SRR7814951 file size 14211464 SRR7814951 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814951 SRR7814951_1.fastq SRR7814951_2.fastq Input file: SRR7814951_1.fastq Paired file: SRR7814951_2.fastq trimmed: SRR7814951-trimmed-pair1.fastq, SRR7814951-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 05:31:48 2024 >> started Sat Dec 7 05:32:35 2024 >> done (47.510s) 42002194 read pairs processed; of these: 108 ( 0.00%) short read pairs filtered out after trimming by size control 7309 ( 0.02%) empty read pairs filtered out after trimming by size control 41994777 (99.98%) read pairs available; of these: 1243800 ( 2.96%) trimmed read pairs available after processing 40750977 (97.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 22 0.00% 20 20 0.00% 21 33 0.00% 22 44 0.00% 23 38 0.00% 24 47 0.00% 25 52 0.00% 26 53 0.00% 27 50 0.00% 28 83 0.00% 29 52 0.00% 30 68 0.00% 31 89 0.00% 32 96 0.00% 33 77 0.00% 34 88 0.00% 35 87 0.00% 36 80 0.00% 37 98 0.00% 38 142 0.00% 39 94 0.00% 40 104 0.00% 41 122 0.00% 42 128 0.00% 43 117 0.00% 44 132 0.00% 45 123 0.00% 46 173 0.00% 47 126 0.00% 48 148 0.00% 49 157 0.00% 50 160 0.00% 51 165 0.00% 52 188 0.00% 53 170 0.00% 54 203 0.00% 55 200 0.00% 56 211 0.00% 57 207 0.00% 58 227 0.00% 59 266 0.00% 60 224 0.00% 61 281 0.00% 62 254 0.00% 63 259 0.00% 64 263 0.00% 65 279 0.00% 66 347 0.00% 67 337 0.00% 68 369 0.00% 69 408 0.00% 70 434 0.00% 71 506 0.00% 72 599 0.00% 73 572 0.00% 74 544 0.00% 75 617 0.00% 76 667 0.00% 77 729 0.00% 78 810 0.00% 79 940 0.00% 80 984 0.00% 81 1082 0.00% 82 1217 0.00% 83 1272 0.00% 84 1401 0.00% 85 1537 0.00% 86 1676 0.00% 87 1861 0.00% 88 1971 0.00% 89 2169 0.01% 90 2336 0.01% 91 2661 0.01% 92 2983 0.01% 93 3188 0.01% 94 3644 0.01% 95 3814 0.01% 96 4216 0.01% 97 4308 0.01% 98 4712 0.01% 99 5107 0.01% 100 5406 0.01% 101 5761 0.01% 102 6259 0.01% 103 6799 0.02% 104 7073 0.02% 105 7653 0.02% 106 8069 0.02% 107 8344 0.02% 108 8868 0.02% 109 9128 0.02% 110 9841 0.02% 111 10468 0.02% 112 11234 0.03% 113 11764 0.03% 114 12641 0.03% 115 13227 0.03% 116 13683 0.03% 117 14158 0.03% 118 14935 0.04% 119 15548 0.04% 120 16102 0.04% 121 17067 0.04% 122 18147 0.04% 123 19007 0.05% 124 20387 0.05% 125 20654 0.05% 126 21585 0.05% 127 21933 0.05% 128 22911 0.05% 129 23652 0.06% 130 24581 0.06% 131 26247 0.06% 132 27277 0.06% 133 28103 0.07% 134 29629 0.07% 135 30816 0.07% 136 32121 0.08% 137 32258 0.08% 138 34073 0.08% 139 34769 0.08% 140 35726 0.09% 141 36932 0.09% 142 39086 0.09% 143 39794 0.09% 144 41932 0.10% 145 43689 0.10% 146 45412 0.11% 147 45786 0.11% 148 46971 0.11% 149 48459 0.12% 150 51500 0.12% 151 40750977 97.04% 41994777 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=7.92 fanout-score-rank=13 prefix-density=0.76 prefix-fanout=5.0 sequence=CCGCACTTGCAGCCTCCGTTCTCGGCTCCGGCGGCGGCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=316.15 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=23.7 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=15 prefix-density=1.00 prefix-fanout=3.5 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.20 sequence-density-rank=17 fanout-score=61.62 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=12.6 sequence=CCGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR7814951 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 05:33:34 Started mapping on | Dec 07 05:33:34 Finished on | Dec 07 05:46:19 Mapping speed, Million of reads per hour | 197.62 Number of input reads | 41994777 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 37107115 Uniquely mapped reads % | 88.36% Average mapped length | 299.83 Number of splices: Total | 36158110 Number of splices: Annotated (sjdb) | 33822465 Number of splices: GT/AG | 35723016 Number of splices: GC/AG | 386352 Number of splices: AT/AC | 19247 Number of splices: Non-canonical | 29495 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 338071 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 26092 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.26% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4549591 4549591 4549591 N_multimapping 338071 338071 338071 N_noFeature 911558 36016486 1289624 N_ambiguous 835255 5838 128364 UnstrandedReadsAssigned:35360302 PositiveStrandReadsAssigned:1084791 NegativeStrandReadsAssigned:35689127 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814951 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814951-trimmed-pair1.fastq SRR7814951-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,994,777 reads, 36,597,432 reads pseudoaligned [quant] estimated average fragment length: 304.87 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,418 rounds 52973 SRR7814951.ke.tsv 35125 SRR7814951.se.tsv 88098 total ==> SRR7814951.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 632.813 31.9121 1.71834 PNS24247 1044 740.13 154.538 7.11471 PNS24249 1928 1624.13 190.692 4.00075 PNS24246 1044 740.13 154.538 7.11471 PNS24248 1044 740.13 154.538 7.11471 PNS24244 1471 1167.13 343.783 10.0368 PNS24243 293 72.7491 0 0 KQK14069 1603 1299.13 31098.9 815.686 KQK14071 474 198.315 181.809 31.2385 ==> SRR7814951.se.tsv <== BRADI_1g14170v3 31299 BRADI_1g53295v3 789 BRADI_1g59795v3 678 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 1907 BRADI_1g74790v3 597 BRADI_1g09890v3 0 BRADI_1g77505v3 463 BRADI_1g48960v3 0 SRR7814951 completed mapping pipeline successfully