Starting /dee2/code/volunteer_pipeline.sh SRR7814952 current disk space = 2825397784576 free memory = 1575301932 SRR7814952_1.fastq is conventional basespace SRR7814952_1.fastq read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814952_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 53002999 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 5.3002999E7 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.99886651277381 13.489003692654947 8.90094100950935 31.611188785061895 2 24.905785887121876 17.14392954628135 33.16439614269789 24.78588842389889 3 22.3778469591881 24.40659065348359 24.92552732723671 28.2900350600916 4 26.484522130530763 30.665808174363868 20.811497855055332 22.038171840050033 5 25.0128412545109 32.60675117647588 22.159323475262223 20.221084093750996 6 21.39228197257291 33.391748266923535 22.913814744709068 22.302155015794483 7 17.11185059547291 20.137509577524092 41.66294439301444 21.087695433988557 8 20.763013806067843 20.876077219706 27.34658655824362 31.014322415982537 9 21.06816823704636 20.24512424287539 30.462081966343074 28.224625553735176 10-14 23.617960938398976 25.974460803623582 24.6265442451662 25.781034012811237 15-19 23.624705085083956 25.210599498341598 25.3167689624506 25.847926454123847 20-24 23.4997706450535 25.370118773845228 25.326968762654356 25.80314181844691 25-29 23.621075101806976 25.389903692053352 25.13820548154266 25.850815724597016 30-34 23.57301442508942 25.346599727309773 25.21321482205186 25.867171025548952 35-39 23.65103485488592 25.24661898078419 25.110449698611948 25.99189646571794 40-44 23.761349805885512 25.26375233974968 25.077603627673973 25.897294226690832 45-49 23.847306451470793 25.19043460163452 24.90152717584905 26.060731771045635 50-54 23.810560606202678 25.118241705530664 25.041321529749666 26.02987615851699 55-59 24.00872637414347 25.085497520621423 24.869379560956542 26.03639654427856 60-64 23.964389260313364 25.03545582392423 24.873059352735872 26.127095563026536 65-69 23.950414579371255 25.013221610346992 24.94256070302739 26.093803107254367 70-74 24.08018719953066 25.005076415232363 24.87361166557183 26.04112471966515 75-79 24.140493635086575 24.856565946391072 24.810630055103108 26.192310363419246 80-84 24.03842469366686 24.88171320268123 24.891920549627766 26.187941554024142 85-89 24.23073833991922 24.852778613527132 24.81662330088152 26.099859745672127 90-94 24.260377040174653 24.754252867842442 24.76374629292203 26.22162379906088 95-99 24.274480074488768 24.66996148919611 24.8530356672439 26.202522769071223 100-104 24.350859467404852 24.733225378435662 24.742617299824865 26.17329785433462 105-109 24.397784359334082 24.58706949770899 24.785094141559803 26.23005200139713 110-114 24.360178185389096 24.573728743160363 24.83105342775038 26.23503964370016 115-119 24.481392835903492 24.571899035373452 24.73997895854912 26.206729170173936 120-124 24.547373929091425 24.524056933161145 24.645363912215092 26.283205225532335 125-129 24.52419871562362 24.457646255073225 24.791319827015826 26.22683520228733 130-134 24.697021389299124 24.481790171910838 24.644117213065623 26.17707122572442 135-139 24.680352232151094 24.41109463279794 24.666077945251324 26.24247518979964 140-144 24.7252907330772 24.381986007999284 24.65713647637184 26.235586782551685 145-149 24.85173563801021 24.386888684668136 24.52848521570482 26.232890461616833 150-151 24.974305699192605 24.217604177454184 24.414909994055243 26.393180129297967 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 9766.0 1 6508.0 2 2717.0 3 2005.0 4 1774.5 5 1697.0 6 1591.0 7 1439.5 8 1406.0 9 1414.5 10 1391.0 11 1415.0 12 1449.5 13 1492.5 14 1528.5 15 1571.0 16 1623.5 17 1696.5 18 1851.5 19 2097.0 20 2434.5 21 2962.5 22 3923.0 23 5427.0 24 7626.5 25 11238.5 26 17388.0 27 26058.5 28 39636.5 29 58098.5 30 83060.5 31 118377.0 32 165438.5 33 229907.0 34 316952.5 35 427441.0 36 571965.0 37 756970.0 38 979260.5 39 1220668.0 40 1487676.5 41 1777391.5 42 2031196.5 43 2240216.0 44 2417648.0 45 2525644.5 46 2559303.0 47 2531631.0 48 2448993.5 49 2348218.5 50 2229325.5 51 2081583.0 52 1921536.0 53 1760036.5 54 1606683.0 55 1478206.0 56 1363255.0 57 1254820.0 58 1173982.0 59 1101612.0 60 1019356.5 61 930476.5 62 868347.0 63 848418.0 64 830674.5 65 788404.5 66 721860.5 67 653724.5 68 578406.5 69 489444.5 70 412341.0 71 352489.5 72 293214.5 73 232741.0 74 178782.5 75 129538.5 76 89118.5 77 60796.0 78 39255.0 79 24421.0 80 15158.0 81 8887.0 82 5334.5 83 3103.0 84 1418.0 85 697.5 86 338.0 87 194.5 88 118.5 89 79.5 90 58.5 91 36.5 92 26.5 93 22.5 94 18.0 95 17.5 96 23.0 97 40.0 98 106.5 99 113.5 100 43.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.01368601803079105 2 0.01613116269137903 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 4.528045667755517E-6 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 8.603286768735482E-5 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 4.9053828067351435E-6 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.06398015327396851 125-129 0.0 130-134 0.0 135-139 1.886685694898132E-6 140-144 0.0 145-149 1.056543989142954E-5 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 5.3002999E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 30.465569879788923 #Duplication Level Percentage of deduplicated Percentage of total 1 58.108658919368416 17.703134089288387 2 17.30203811494019 10.542329025069634 3 7.544195526766758 6.89514648022511 4 4.175590693569752 5.088470002573824 5 2.6681769246009694 4.064376527403557 6 1.872426215765487 3.422671903269131 7 1.306057823433272 2.7852857120795957 8 1.0337694706067575 2.5195500837090057 9 0.794534332663923 2.178534711029778 >10 4.710195625814421 26.21942449201496 >50 0.3182494020068221 6.638380179023703 >100 0.15479224228965796 8.534445410646649 >500 0.008090592336404356 1.667738892317687 >1k 0.003142014861839794 1.5579586428123946 >5k 6.841751183718522E-5 0.1373688195509822 >10k+ 1.3683463643010199E-5 0.04518502898561929 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 7.169405640612902E-5 1.8866856948981322E-6 1.8866856948981322E-6 0.0 0.0 2 7.546742779592529E-5 9.43342847449066E-6 1.3206799864286925E-5 7.546742779592529E-6 1.1320114169388792E-5 3 7.924079918572154E-5 9.43342847449066E-6 1.3206799864286925E-5 7.546742779592529E-6 2.2640228338777584E-5 4 9.43342847449066E-5 1.5093485559185057E-5 1.3206799864286925E-5 1.5093485559185057E-5 2.830028542347198E-5 5 9.810765613470287E-5 2.0753542643879453E-5 4.339377098265704E-5 1.886685694898132E-5 3.773371389796264E-5 6 1.1320114169388792E-4 2.0753542643879453E-5 4.339377098265704E-5 2.2640228338777584E-5 3.773371389796264E-5 7 1.2452125586327672E-4 2.641359972857385E-5 5.0940513762249564E-5 2.2640228338777584E-5 4.71671423724533E-5 8 1.415014271173599E-4 2.641359972857385E-5 6.037394223674023E-5 3.396034250816638E-5 5.471388515204583E-5 9 1.5848159837144308E-4 2.641359972857385E-5 9.43342847449066E-5 4.339377098265704E-5 6.792068501633276E-5 10-11 1.8112182671022067E-4 5.094051376224957E-5 9.810765613470287E-5 4.339377098265704E-5 9.244759905000847E-5 12-13 2.14138826370938E-4 7.829745633827248E-5 1.2640794155817484E-4 4.339377098265704E-5 1.1791785593113325E-4 14-15 2.537592259637988E-4 1.0188102752449913E-4 1.301813129479711E-4 4.339377098265704E-5 1.4055808426991084E-4 16-17 3.084731111158446E-4 1.056543989142954E-4 1.3301134149031833E-4 5.943059938929116E-5 1.6131162691379028E-4 18-19 3.6601702481023763E-4 1.056543989142954E-4 1.4055808426991084E-4 7.358074210102715E-5 1.773484553204244E-4 20-21 4.499745382332045E-4 1.056543989142954E-4 1.528215412867487E-4 7.829745633827248E-5 1.9055525518471133E-4 22-23 5.414787944357639E-4 1.1037111315154073E-4 1.6508499830358655E-4 9.527762759235566E-5 2.1319548352348894E-4 24-25 6.216629364689346E-4 1.1320114169388792E-4 1.7923514101532255E-4 9.999434182960101E-5 2.5658925450614597E-4 26-27 7.207139354510865E-4 1.1603117023623513E-4 2.0470539789644733E-4 1.0093768467705007E-4 2.7073939721788194E-4 28-29 8.518385912465067E-4 1.2074788447348046E-4 2.1319548352348892E-4 1.0942777030409167E-4 2.726260829127801E-4 30-31 0.0010216403037873385 1.2074788447348046E-4 2.2168556915053053E-4 1.1508782738878606E-4 2.8394619708216887E-4 32-33 0.0011923853591756196 1.2640794155817486E-4 2.3111899762502119E-4 1.3489802718521645E-4 2.924362827092105E-4 34-35 0.001370677157343493 1.2829462725307298E-4 2.452691403367572E-4 1.3961474142246176E-4 2.971529969464558E-4 36-37 0.0015376488413419776 1.3678471288011457E-4 2.9526631125155765E-4 1.4621814135460526E-4 3.131898253530899E-4 38-39 0.0017659378104246516 1.4527479850715618E-4 3.2073656813268246E-4 1.5659491267654496E-4 3.3866008223421473E-4 40-41 0.0020178103506935524 1.4621814135460526E-4 3.2828331091227494E-4 1.7074505538828096E-4 3.499801964036035E-4 42-43 0.002288549747911434 1.471614842020543E-4 3.301699966071731E-4 2.0659208359134545E-4 3.70733739047483E-4 44-45 0.0025772126592308485 1.4904816989695242E-4 3.3583005369186754E-4 2.414957689469609E-4 3.7828048182707546E-4 46-47 0.0029205894557023087 1.499915127444015E-4 3.518668820985016E-4 2.480991688791044E-4 3.9431731023370964E-4 48-49 0.0032328359382079496 1.6036828406634123E-4 3.594136248780942E-4 2.584759402010441E-4 4.0941079579289466E-4 50-51 0.003622436534204414 1.698017125408319E-4 3.8677056745411705E-4 2.8017282569237263E-4 4.207309099622835E-4 52-53 0.003992226930404448 1.7263174108317908E-4 4.1412751003014E-4 3.1035979681074273E-4 4.3676773836891756E-4 54-55 0.004449748211417245 1.7923514101532255E-4 4.3959776691126476E-4 3.2073656813268246E-4 4.4337113830106105E-4 56-57 0.004936513120700963 1.839518552525679E-4 4.4337113830106105E-4 3.3488671084441844E-4 4.556345953178989E-4 58-59 0.005469501829509685 1.886685694898132E-4 4.5752128101279703E-4 3.396034250816638E-4 4.8487822358882E-4 60-61 0.006165688850927095 1.914985980321604E-4 4.6506802379238957E-4 3.499801964036035E-4 5.386487658934167E-4 62-63 0.006937343300140432 1.9998868365920201E-4 4.839348807413709E-4 3.5092353925105256E-4 5.622323370796434E-4 64-65 0.007748618148946628 2.2923231193012307E-4 5.603456513847453E-4 3.556402534882979E-4 5.84872565418421E-4 66-67 0.008690074310700797 2.5658925450614597E-4 5.707224227066849E-4 3.622436534204414E-4 6.037394223674023E-4 68-69 0.009745674956996301 2.7168274006533104E-4 5.810991940286246E-4 3.773371389796264E-4 6.301530220959761E-4 70-71 0.01088806314525712 2.811161685398217E-4 6.13172850841893E-4 4.018640530133021E-4 6.773201644684295E-4 72-73 0.012329491016159294 2.886629113194142E-4 6.254363078587307E-4 4.197875671148344E-4 7.037337641970032E-4 74-75 0.01410957896929568 2.933796255566595E-4 6.527932504347537E-4 4.3771108121636666E-4 7.301473639255772E-4 76-77 0.016177386490904035 2.943229684041086E-4 6.744901359260823E-4 4.622379952500423E-4 7.386374495526188E-4 78-79 0.018681961750881305 2.943229684041086E-4 7.018470785021051E-4 4.697847380296349E-4 7.556176208067019E-4 80-81 0.021849707032615268 2.943229684041086E-4 7.348640781628224E-4 4.829915378939218E-4 7.782578491454795E-4 82-83 0.02579665350634216 2.943229684041086E-4 7.603343350439472E-4 4.980850234531069E-4 7.961813632470118E-4 84-85 0.030737883341280366 2.9620965409900675E-4 7.716544492133361E-4 5.046884233852504E-4 8.103315059587477E-4 86-87 0.03680452119322531 2.990396826413539E-4 7.744844777556833E-4 5.207252517918844E-4 8.320283914500762E-4 88-89 0.04370696080801013 3.009263683362521E-4 7.85804591925072E-4 5.226119374867825E-4 8.518385912465066E-4 90-91 0.052149879292679266 3.028130540311502E-4 7.961813632470117E-4 5.339320516561713E-4 8.669320768056917E-4 92-93 0.0622134607892659 3.037563968785993E-4 8.15048220195993E-4 5.414787944357639E-4 8.839122480597749E-4 94-95 0.07461558920467878 3.065864254209465E-4 8.225949629755856E-4 5.480821943679074E-4 9.065524763985525E-4 96-97 0.08891100671492191 3.2356659667502966E-4 8.254249915179328E-4 5.490255372153565E-4 9.273060190424318E-4 98-99 0.10570156605666785 3.301699966071731E-4 8.2825502006028E-4 5.556289371474999E-4 9.508895902286586E-4 100-101 0.12569005765126612 3.414901107765619E-4 8.2825502006028E-4 5.641190227745414E-4 9.763598471097834E-4 102-103 0.1487378101001417 3.471501678612563E-4 8.2825502006028E-4 5.678923941643377E-4 9.9994341829601E-4 104-105 0.17570232205162578 3.471501678612563E-4 9.103258477883487E-4 5.744957940964812E-4 0.0010178669323975423 106-107 0.20594966711223267 3.471501678612563E-4 9.810765613470288E-4 5.782691654862775E-4 0.0010225836466347875 108-109 0.2392138225989816 3.471501678612563E-4 0.001015036903855195 5.810991940286247E-4 0.0010461672178210142 110-111 0.2767041540423024 3.471501678612563E-4 0.0010348471036516255 5.829858797235228E-4 0.001071637474702139 112-113 0.3183489673857889 3.490368535561544E-4 0.0010471105606684634 5.8581590826587E-4 0.0010867309602613242 114-115 0.36573685198454525 3.518668820985016E-4 0.0010518272749057086 5.867592511133191E-4 0.001098994417278162 116-117 0.41798012221912195 3.546969106408488E-4 0.0010584306748378522 5.867592511133191E-4 0.0011169179313796941 118-119 0.47518820585982313 3.57526939183196E-4 0.0010631473890750974 5.867592511133191E-4 0.0011405015025659207 120-121 0.5372007346225824 3.584702820306451E-4 0.0010659774176174446 5.867592511133191E-4 0.0011546516452776569 122-123 0.6056449749192494 3.7545045328472827E-4 0.0010735241603970372 5.867592511133191E-4 0.001173518502226638 124-125 0.6821198928762502 3.8582722460666805E-4 0.0010820142460240788 5.971360224352588E-4 0.0011820085878536798 126-127 0.7669481117474126 3.8960059599646424E-4 0.0010867309602613242 6.093994794520967E-4 0.0011933287020230686 128-129 0.8564251241708041 3.943173102337096E-4 0.001099937760125611 6.112861651469948E-4 0.0012065355018873554 130-131 0.9515886072786184 4.028073958607512E-4 0.0011188046170745923 6.282663364010779E-4 0.0012395525015480727 132-133 1.0549233261310365 4.216742528097325E-4 0.0011216346456169395 6.376997648755686E-4 0.0012499292728700125 134-135 1.1688225415320368 4.358243955214685E-4 0.0011810652450062308 6.726034502311841E-4 0.0012555893299547069 136-137 1.2929240098281984 4.4620116684340825E-4 0.0012140822446669482 6.773201644684295E-4 0.0012678527869715447 138-139 1.42411847299433 4.603513095551442E-4 0.0012320057587684803 6.924136500276144E-4 0.0012886063296154242 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 417205 0.0 15.57919 1 TTTTTTA 63895 0.0 15.145513 4 TTTTTAA 41595 0.0 11.902801 5 CGGGACT 19150 0.0 11.018353 1 GTCGGAT 22780 0.0 10.758593 1 GTCGGTT 16425 0.0 10.374208 1 GTCGATT 25270 0.0 10.100199 1 GGGAAAT 41490 0.0 9.891576 1 GTTTATT 35110 0.0 9.871645 1 GTCGAAT 24385 0.0 9.693649 1 GTCGTAT 13750 0.0 9.544834 1 GTCGCAT 19335 0.0 9.450372 1 GTCGTTT 14825 0.0 9.439632 1 GTCAGAT 47610 0.0 9.381559 1 GTTTTAT 29050 0.0 9.110437 1 GCGTAAT 14235 0.0 9.015883 1 GTCCGAT 16195 0.0 8.999276 1 GTCACTT 30060 0.0 8.997303 1 GTCAAAT 42150 0.0 8.893761 1 GCCAATT 52185 0.0 8.892559 1 >>END_MODULE SRR7814952 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814952_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 53002999 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10-14 30.0 30.0 30.0 30.0 30.0 30.0 15-19 30.0 30.0 30.0 30.0 30.0 30.0 20-24 30.0 30.0 30.0 30.0 30.0 30.0 25-29 30.0 30.0 30.0 30.0 30.0 30.0 30-34 30.0 30.0 30.0 30.0 30.0 30.0 35-39 30.0 30.0 30.0 30.0 30.0 30.0 40-44 30.0 30.0 30.0 30.0 30.0 30.0 45-49 30.0 30.0 30.0 30.0 30.0 30.0 50-54 30.0 30.0 30.0 30.0 30.0 30.0 55-59 30.0 30.0 30.0 30.0 30.0 30.0 60-64 30.0 30.0 30.0 30.0 30.0 30.0 65-69 30.0 30.0 30.0 30.0 30.0 30.0 70-74 30.0 30.0 30.0 30.0 30.0 30.0 75-79 30.0 30.0 30.0 30.0 30.0 30.0 80-84 30.0 30.0 30.0 30.0 30.0 30.0 85-89 30.0 30.0 30.0 30.0 30.0 30.0 90-94 30.0 30.0 30.0 30.0 30.0 30.0 95-99 30.0 30.0 30.0 30.0 30.0 30.0 100-104 30.0 30.0 30.0 30.0 30.0 30.0 105-109 30.0 30.0 30.0 30.0 30.0 30.0 110-114 30.0 30.0 30.0 30.0 30.0 30.0 115-119 30.0 30.0 30.0 30.0 30.0 30.0 120-124 30.0 30.0 30.0 30.0 30.0 30.0 125-129 30.0 30.0 30.0 30.0 30.0 30.0 130-134 30.0 30.0 30.0 30.0 30.0 30.0 135-139 30.0 30.0 30.0 30.0 30.0 30.0 140-144 30.0 30.0 30.0 30.0 30.0 30.0 145-149 30.0 30.0 30.0 30.0 30.0 30.0 150-151 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 5.3002999E7 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.92432424630602 16.055714003111007 10.614255676400838 28.405706074182135 2 29.337000345961556 20.908381052174047 27.664851568115985 22.089767033748412 3 25.29767985392676 23.832649544981408 26.624850039145898 24.244820561945936 4 28.524453870996997 31.15641814909379 17.58986505650369 22.72926292340552 5 27.662651692595734 33.27285310780245 17.879260001872723 21.185235197729092 6 23.15481808868966 34.11538279183033 18.83373618160738 23.896062937872628 7 22.087333209201994 16.34642032236704 35.95345614311371 25.612790325317253 8 23.47402455472378 20.760830910718845 22.40766036653888 33.357484168018495 9 24.56544581562262 21.72860067785976 24.463777983581647 29.242175522935977 10-14 26.266273904204716 25.122472937929906 22.330036673017215 26.281216484848162 15-19 26.231188163522596 24.662328635404197 23.24188410546354 25.864599095609663 20-24 25.934676639712407 25.050847028486068 23.31951631642579 25.694960015375734 25-29 26.079252987175312 25.014267966233383 23.263267046455237 25.643212000136067 30-34 25.98581865150687 25.056845179647286 23.416603275599556 25.540732893246286 35-39 26.063786076321975 25.046844349009973 23.248282766300417 25.641086808367636 40-44 26.212717510569544 25.00306029853141 23.246591386272314 25.537630804626733 45-49 26.230308213314498 25.03265975572439 23.30400134528237 25.433030685678748 50-54 26.272193013078372 25.186627269902218 23.307462281521087 25.23371743549832 55-59 26.480828377277295 25.087681170644704 23.194363775529002 25.237126676549 60-64 26.487298991992343 25.109854921925802 23.31978401217535 25.083062073906504 65-69 26.53317711324221 25.13438456567335 23.289768943074336 25.042669378010103 70-74 26.608546810719147 25.100653266808543 23.299901577267352 24.990898345204958 75-79 26.552811473931882 25.080169142881896 23.367792829986847 24.999226553199378 80-84 26.557565921883025 25.13626747799686 23.32406662498475 24.98209997513537 85-89 26.750429689093068 25.095100700612754 23.22386647040699 24.930603139887182 90-94 26.601238545011384 25.1022675150891 23.380200807127913 24.9162931327716 95-99 26.71122930232684 25.14702385048061 23.324455282237896 24.817291564954655 100-104 26.717355370778172 25.147517784795536 23.318454489716707 24.81667235470959 105-109 26.59209604347105 25.11390798848948 23.463786643468985 24.830209324570482 110-114 26.691011366624018 25.2965622649141 23.278274503847022 24.734151864614855 115-119 26.81149306287367 25.292273367399453 23.26696872378863 24.629264845938245 120-124 26.72968938984 25.254122318625782 23.370683987145707 24.645504304388513 125-129 26.665779043936737 25.358227748584568 23.40077851066503 24.575214696813667 130-134 26.849617320710472 25.29805643639146 23.378411097077734 24.47391514582033 135-139 26.80515210708276 25.374138664974964 23.50952962039181 24.31117960755046 140-144 26.817086331284763 25.422913899645565 23.43159223877124 24.328407530298428 145-149 26.886978225515122 25.487429116982607 23.330277971629492 24.295314685872775 150-151 27.23166758922453 25.210483844508495 23.319704041652436 24.23814452461454 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3915.0 1 3212.0 2 2700.0 3 3272.5 4 4311.5 5 5538.0 6 6803.0 7 8050.5 8 9096.0 9 10168.5 10 11277.0 11 12288.0 12 13069.5 13 13614.5 14 14091.0 15 14504.0 16 14780.0 17 15006.5 18 15325.0 19 15410.0 20 15741.0 21 16303.5 22 16871.0 23 17815.5 24 19218.5 25 21353.5 26 24978.5 27 30426.5 28 37316.5 29 47549.0 30 63424.0 31 82982.0 32 109655.0 33 150423.5 34 208898.5 35 290330.0 36 404039.0 37 552303.5 38 734335.0 39 962348.5 40 1218831.5 41 1478529.0 42 1728697.0 43 1946895.0 44 2121872.0 45 2243070.0 46 2301891.5 47 2301346.5 48 2235194.0 49 2117561.5 50 1997902.0 51 1930785.0 52 1843082.5 53 1700888.0 54 1604194.5 55 1514893.0 56 1403188.5 57 1360852.0 58 1390201.5 59 1347690.5 60 1238777.0 61 1165360.0 62 1124905.0 63 1090401.0 64 1037250.0 65 983774.5 66 943165.5 67 898459.0 68 828382.0 69 733461.0 70 635214.0 71 540947.5 72 455022.5 73 372244.5 74 286188.0 75 210153.0 76 152674.5 77 107503.0 78 72773.0 79 49047.0 80 32282.0 81 22268.5 82 16950.0 83 13138.5 84 10188.5 85 8689.5 86 8154.0 87 7719.0 88 7366.0 89 7231.0 90 6981.5 91 6859.0 92 6911.5 93 6953.5 94 7065.0 95 7206.0 96 7478.5 97 8013.5 98 9110.0 99 11808.5 100 41718.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0016678301542899488 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 2.0036602079818164E-4 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 3.962039959286077E-5 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 9.13155876330696E-5 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 4.641246809449405E-5 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 5.99966050977606E-5 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 3.1696319674288616E-5 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 5.3002999E7 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 33.21730076959098 #Duplication Level Percentage of deduplicated Percentage of total 1 61.87599906770011 20.553536714507253 2 15.336122725327005 10.18849202413093 3 7.132958074836646 7.108128412461946 4 3.9481759919472608 5.245909976631615 5 2.5969978889642307 4.313262998785884 6 1.7765154577618953 3.5406628969382696 7 1.2876777719652543 2.994122589198065 8 0.930964099572422 2.4739291600950866 9 0.7406248811594965 2.2141403491425815 >10 3.9883748035725115 23.68630775573175 >50 0.24833957206837884 5.638411027104424 >100 0.12687178634429136 7.671109100289455 >500 0.00708484316583956 1.597300773527488 >1k 0.003062423273064135 1.7827302111582275 >5k 1.3712109521358564E-4 0.30694717905403507 >10k+ 9.34912463818856E-5 0.6850088312432736 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 114488 0.21600287183749733 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 7.169405640612902E-5 0.0 0.0 0.0 3.7733713897962644E-6 2 7.546742779592529E-5 3.7733713897962644E-6 5.660057084694396E-6 0.0 3.7733713897962644E-6 3 7.924079918572154E-5 3.7733713897962644E-6 7.546742779592529E-6 0.0 1.3206799864286925E-5 4 9.244759905000847E-5 3.7733713897962644E-6 2.0753542643879453E-5 0.0 1.5093485559185057E-5 5 9.43342847449066E-5 3.7733713897962644E-6 2.641359972857385E-5 0.0 1.886685694898132E-5 6 1.0754108460919353E-4 3.7733713897962644E-6 2.830028542347198E-5 1.8866856948981322E-6 2.4526914033675718E-5 7 1.1131445599898979E-4 5.660057084694396E-6 2.830028542347198E-5 1.8866856948981322E-6 2.4526914033675718E-5 8 1.226345701683786E-4 5.660057084694396E-6 2.830028542347198E-5 1.8866856948981322E-6 6.226062793163836E-5 9 1.3584137003266552E-4 5.660057084694396E-6 4.1507085287758905E-5 1.8866856948981322E-6 6.792068501633276E-5 10-11 1.499915127444015E-4 6.603399932143462E-6 4.5280456677555174E-5 1.8866856948981322E-6 6.980737071123088E-5 12-13 1.7168839823573E-4 7.546742779592529E-6 5.0940513762249564E-5 1.8866856948981322E-6 7.263739925357808E-5 14-15 2.056487407438964E-4 1.2263457016837859E-5 5.0940513762249564E-5 3.7733713897962644E-6 7.924079918572154E-5 16-17 2.537592259637988E-4 2.2640228338777584E-5 5.188385660969863E-5 4.71671423724533E-6 8.678754196531408E-5 18-19 3.197932252852334E-4 2.2640228338777584E-5 6.509065647398557E-5 5.660057084694396E-6 9.716431328725381E-5 20-21 4.103541386403437E-4 2.2640228338777584E-5 7.735411349082342E-5 5.660057084694396E-6 1.1037111315154073E-4 22-23 5.178952232495372E-4 2.2640228338777584E-5 9.527762759235566E-5 5.660057084694396E-6 1.1320114169388792E-4 24-25 6.273229935536289E-4 2.2640228338777584E-5 1.1225779884643886E-4 5.660057084694396E-6 1.1697451308368419E-4 26-27 7.688244206709888E-4 2.641359972857385E-5 1.3395468433776737E-4 5.660057084694396E-6 1.301813129479711E-4 28-29 9.688131043301908E-4 3.0186971118370115E-5 1.4904816989695242E-4 5.660057084694396E-6 1.5753825552399404E-4 30-31 0.0012037054733450084 3.2073656813268246E-5 1.85838540947466E-4 5.660057084694396E-6 1.85838540947466E-4 32-33 0.0014518046422241125 3.2073656813268246E-5 2.0187536935410014E-4 5.660057084694396E-6 1.9527196942195667E-4 34-35 0.0017234873822894437 3.490368535561544E-5 2.1036545498114175E-4 6.603399932143462E-6 1.9904534081175294E-4 36-37 0.0020008301794394692 3.962039959286077E-5 2.2074222630308145E-4 7.546742779592529E-6 2.1319548352348894E-4 38-39 0.002345150318758378 4.1507085287758905E-5 2.3489236901481746E-4 7.546742779592529E-6 2.2262891199797957E-4 40-41 0.002699847229399227 4.43371138301061E-5 2.358357118622665E-4 8.490085627041595E-6 2.2640228338777584E-4 42-43 0.0030809577397686496 4.71671423724533E-5 2.4055242609951185E-4 9.43342847449066E-6 2.2828896908267396E-4 44-45 0.003523385535222262 4.71671423724533E-5 2.4338245464185904E-4 9.43342847449066E-6 2.4149576894696092E-4 46-47 0.003994113616099346 4.71671423724533E-5 2.471558260316553E-4 9.43342847449066E-6 2.499858545740025E-4 48-49 0.004427107983078467 4.71671423724533E-5 2.5281588311634967E-4 1.0376771321939726E-5 2.5658925450614597E-4 50-51 0.0049742468345989254 5.28271994571477E-5 2.6413599728573845E-4 1.3206799864286925E-5 2.669660258280857E-4 52-53 0.005480821943679074 5.8487256541842095E-5 2.7168274006533104E-4 1.5093485559185057E-5 2.8017282569237263E-4 54-55 0.006079844651809231 6.226062793163836E-5 2.9337962555665956E-4 1.5093485559185057E-5 2.99983025488803E-4 56-57 0.006690187474108777 6.792068501633276E-5 3.2356659667502966E-4 1.5093485559185057E-5 3.113031396581918E-4 58-59 0.007402411323932821 6.792068501633276E-5 3.2733996806482595E-4 1.698017125408319E-5 3.2922665375972405E-4 60-61 0.00826085331511147 6.886402786378182E-5 3.3111333945462214E-4 2.0753542643879453E-5 3.509235392510526E-4 62-63 0.00921268624818758 7.358074210102715E-5 3.3205668230207124E-4 2.5470256881124782E-5 3.613003105729923E-4 64-65 0.01018055600967032 7.358074210102715E-5 3.367733965393166E-4 3.0186971118370115E-5 3.801671675219736E-4 66-67 0.011246533427287764 7.924079918572154E-5 3.471501678612563E-4 3.2073656813268246E-5 3.9620399592860773E-4 68-69 0.012505896128632267 8.5844199117865E-5 3.584702820306451E-4 3.2073656813268246E-5 4.4903119538575544E-4 70-71 0.013871856571738516 8.773088481276315E-5 3.8488388175921895E-4 3.301699966071731E-5 4.773314808092274E-4 72-73 0.015530253297553974 8.961757050766127E-5 3.8960059599646424E-4 3.396034250816638E-5 5.028017376903521E-4 74-75 0.017527310105603648 9.244759905000847E-5 4.0658076725054747E-4 3.396034250816638E-5 5.28271994571477E-4 76-77 0.01982906665337937 9.339094189745754E-5 4.3676773836891756E-4 3.396034250816638E-5 5.518555657577037E-4 78-79 0.022619474796133705 9.622097043980474E-5 4.4525782399595915E-4 3.396034250816638E-5 5.71665765554134E-4 80-81 0.026040979303831466 9.810765613470287E-5 4.5657793816534793E-4 3.396034250816638E-5 5.763824797913794E-4 82-83 0.030180367718437972 1.056543989142954E-4 4.71671423724533E-4 3.396034250816638E-5 5.84872565418421E-4 84-85 0.035381960179272115 1.1037111315154073E-4 4.829915378939218E-4 3.396034250816638E-5 5.99966050977606E-4 86-87 0.041722167456977294 1.1508782738878606E-4 4.914816235209634E-4 3.396034250816638E-5 6.169462222316892E-4 88-89 0.04885666941223458 1.1886119877858233E-4 5.009150519954541E-4 3.396034250816638E-5 6.235496221638326E-4 90-91 0.05761938112218895 1.2074788447348046E-4 5.084617947750466E-4 3.396034250816638E-5 6.273229935536289E-4 92-93 0.06792823175911235 1.226345701683786E-4 5.244986231816807E-4 3.396034250816638E-5 6.527932504347537E-4 94-95 0.08054638568659106 1.2829462725307298E-4 5.301586802663751E-4 3.584702820306451E-5 6.726034502311841E-4 96-97 0.09505405533751024 1.2923797010052203E-4 5.471388515204583E-4 3.7733713897962636E-5 6.763768216209804E-4 98-99 0.1120644135627118 1.3489802718521645E-4 5.660057084694396E-4 4.1507085287758905E-5 6.820368787056748E-4 100-101 0.13219346324158 1.3678471288011457E-4 5.688357370117868E-4 4.1507085287758905E-5 6.990170499597579E-4 102-103 0.15533932334659026 1.3772805572756364E-4 5.905326225031153E-4 4.1507085287758905E-5 7.112805069765958E-4 104-105 0.1823330789263453 1.3961474142246176E-4 6.112861651469948E-4 4.245042813520797E-5 7.263739925357809E-4 106-107 0.21264362795773123 1.5093485559185057E-4 6.188329079265874E-4 4.339377098265704E-5 7.461841923322112E-4 108-109 0.2460096644720047 1.5187819843929965E-4 6.207195936214855E-4 4.339377098265704E-5 7.603343350439472E-4 110-111 0.2835254661722066 1.528215412867487E-4 6.244929650112818E-4 4.528045667755517E-5 7.735411349082341E-4 112-113 0.32513726251603237 1.528215412867487E-4 6.339263934857723E-4 5.0940513762249564E-5 7.85804591925072E-4 114-115 0.3726270281423132 1.528215412867487E-4 6.518499075873047E-4 5.0940513762249564E-5 8.188215915857893E-4 116-117 0.4250882105746507 1.5470822698164684E-4 6.8675359294292E-4 5.0940513762249564E-5 8.508952483990576E-4 118-119 0.482525526527282 1.5659491267654496E-4 6.943003357225126E-4 5.0940513762249564E-5 8.612720197209974E-4 120-121 0.5445550354612954 1.5659491267654496E-4 6.980737071123088E-4 5.188385660969863E-5 8.754221624327333E-4 122-123 0.6128341907596587 1.5659491267654496E-4 7.159972212138412E-4 5.660057084694396E-5 9.018357621613071E-4 124-125 0.6887355562654106 1.6602834115103562E-4 7.188272497561884E-4 5.8487256541842095E-5 9.216459619577375E-4 126-127 0.7726487325745474 1.7923514101532255E-4 7.273173353832299E-4 6.226062793163836E-5 9.28249361889881E-4 128-129 0.8610022236666268 1.7923514101532255E-4 7.527875922643547E-4 6.414731362653649E-5 9.42399504601617E-4 130-131 0.9542922278794074 1.801784838627716E-4 7.659943921286416E-4 6.414731362653649E-5 9.99000075448561E-4 132-133 1.0560194905197724 1.8112182671022067E-4 7.688244206709889E-4 6.414731362653649E-5 0.0010197536180924405 134-135 1.168104657625128 1.8772522664236413E-4 7.725977920607851E-4 6.414731362653649E-5 0.0010678641033123426 136-137 1.289796828288905 1.9338528372705852E-4 7.763711634505814E-4 6.414731362653649E-5 0.0010867309602613242 138-139 1.4184018153387887 1.943286265745076E-4 7.810878776878267E-4 6.603399932143463E-5 0.0011074845029052035 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGCT 59365 0.0 16.87806 1 TTGGCTT 74550 0.0 12.905071 2 CTTAAAA 25685 0.0 12.250535 1 TAAAAGC 26200 0.0 11.89883 3 GCGAAAC 22895 0.0 11.336717 1 TTAAAAG 28320 0.0 11.238501 2 GTTTAAT 28210 0.0 10.819917 1 TTAATAC 16875 0.0 10.611831 3 AGCCTAG 26725 0.0 10.525852 9 GGCTTCT 87055 0.0 10.218519 4 TGGCTTC 98415 0.0 9.98931 3 GCTTCTC 96320 0.0 9.627004 5 TAATACC 18360 0.0 9.279665 4 CCTTAAC 25275 0.0 9.179175 1 AATCCCC 37905 0.0 9.142575 5 CGTTAGG 19085 0.0 9.041114 45-49 CTTAACT 22240 0.0 8.964685 2 ATCGCAC 19620 0.0 8.572867 6 TCGTTAG 19390 0.0 8.554908 45-49 GCCTAGA 23335 0.0 8.475782 10-14 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814952 SRR7814952_1.fastq SRR7814952_2.fastq Input file: SRR7814952_1.fastq Paired file: SRR7814952_2.fastq trimmed: SRR7814952-trimmed-pair1.fastq, SRR7814952-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 11:17:08 2025 >> started Thu Apr 10 11:18:10 2025 >> done (62.172s) 53002999 read pairs processed; of these: 147 ( 0.00%) short read pairs filtered out after trimming by size control 6744 ( 0.01%) empty read pairs filtered out after trimming by size control 52996108 (99.99%) read pairs available; of these: 1346317 ( 2.54%) trimmed read pairs available after processing 51649791 (97.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 31 0.00% 20 27 0.00% 21 33 0.00% 22 31 0.00% 23 27 0.00% 24 30 0.00% 25 40 0.00% 26 39 0.00% 27 40 0.00% 28 58 0.00% 29 59 0.00% 30 57 0.00% 31 56 0.00% 32 69 0.00% 33 69 0.00% 34 57 0.00% 35 73 0.00% 36 67 0.00% 37 92 0.00% 38 82 0.00% 39 93 0.00% 40 87 0.00% 41 79 0.00% 42 124 0.00% 43 96 0.00% 44 109 0.00% 45 124 0.00% 46 125 0.00% 47 102 0.00% 48 102 0.00% 49 148 0.00% 50 131 0.00% 51 110 0.00% 52 124 0.00% 53 151 0.00% 54 160 0.00% 55 151 0.00% 56 167 0.00% 57 172 0.00% 58 196 0.00% 59 215 0.00% 60 239 0.00% 61 245 0.00% 62 246 0.00% 63 238 0.00% 64 241 0.00% 65 280 0.00% 66 305 0.00% 67 310 0.00% 68 344 0.00% 69 335 0.00% 70 378 0.00% 71 448 0.00% 72 429 0.00% 73 548 0.00% 74 520 0.00% 75 583 0.00% 76 665 0.00% 77 728 0.00% 78 762 0.00% 79 960 0.00% 80 906 0.00% 81 1126 0.00% 82 1223 0.00% 83 1339 0.00% 84 1571 0.00% 85 1670 0.00% 86 1781 0.00% 87 1888 0.00% 88 2044 0.00% 89 2375 0.00% 90 2502 0.00% 91 2728 0.01% 92 3025 0.01% 93 3433 0.01% 94 3609 0.01% 95 3847 0.01% 96 4293 0.01% 97 4546 0.01% 98 4831 0.01% 99 5515 0.01% 100 5790 0.01% 101 6110 0.01% 102 6907 0.01% 103 7264 0.01% 104 7722 0.01% 105 8313 0.02% 106 8388 0.02% 107 8955 0.02% 108 9631 0.02% 109 10276 0.02% 110 10348 0.02% 111 11315 0.02% 112 12200 0.02% 113 12800 0.02% 114 13680 0.03% 115 14211 0.03% 116 14718 0.03% 117 15700 0.03% 118 16243 0.03% 119 16711 0.03% 120 17785 0.03% 121 18463 0.03% 122 19637 0.04% 123 20554 0.04% 124 21945 0.04% 125 22741 0.04% 126 24052 0.05% 127 23932 0.05% 128 24739 0.05% 129 25711 0.05% 130 26636 0.05% 131 27911 0.05% 132 29314 0.06% 133 30947 0.06% 134 32248 0.06% 135 33816 0.06% 136 34671 0.07% 137 35396 0.07% 138 36266 0.07% 139 37518 0.07% 140 38664 0.07% 141 39947 0.08% 142 42039 0.08% 143 43482 0.08% 144 45926 0.09% 145 48013 0.09% 146 49531 0.09% 147 51081 0.10% 148 51486 0.10% 149 52571 0.10% 150 55135 0.10% 151 51649791 97.46% 52996108 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=4.64 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=4.1 sequence=TGCCGCACTTGCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=260.64 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=32.1 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=13 prefix-density=0.53 prefix-fanout=3.5 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=168.71 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=22.4 sequence=CGCCGCCGCCGGAGCCGAGAACGGAGGCTGCAAGTG SRR7814952 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 11:19:08 Started mapping on | Apr 10 11:19:08 Finished on | Apr 10 11:36:23 Mapping speed, Million of reads per hour | 184.33 Number of input reads | 52996108 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 46079765 Uniquely mapped reads % | 86.95% Average mapped length | 299.92 Number of splices: Total | 47821479 Number of splices: Annotated (sjdb) | 44909347 Number of splices: GT/AG | 47217952 Number of splices: GC/AG | 537185 Number of splices: AT/AC | 27865 Number of splices: Non-canonical | 38477 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.50 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431158 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 38691 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.57% % of reads unmapped: other | 0.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6485185 6485185 6485185 N_multimapping 431158 431158 431158 N_noFeature 1289317 44866103 1676234 N_ambiguous 988211 7397 166188 UnstrandedReadsAssigned:43802237 PositiveStrandReadsAssigned:1206265 NegativeStrandReadsAssigned:44237343 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814952 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814952-trimmed-pair1.fastq SRR7814952-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,996,108 reads, 45,499,725 reads pseudoaligned [quant] estimated average fragment length: 323.381 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR7814952.ke.tsv 35125 SRR7814952.se.tsv 88098 total ==> SRR7814952.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 614.702 0 0 PNS24247 1044 721.619 231.256 9.41314 PNS24249 1928 1605.62 292.986 5.35987 PNS24246 1044 721.619 231.256 9.41314 PNS24248 1044 721.619 231.256 9.41314 PNS24244 1471 1148.62 432.247 11.0537 PNS24243 293 71.9193 0 0 KQK14069 1603 1280.62 26888.1 616.724 KQK14071 474 192.06 175.864 26.8962 ==> SRR7814952.se.tsv <== BRADI_1g14170v3 27087 BRADI_1g53295v3 732 BRADI_1g59795v3 942 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 2070 BRADI_1g74790v3 931 BRADI_1g09890v3 0 BRADI_1g77505v3 490 BRADI_1g48960v3 2 SRR7814952 completed mapping pipeline successfully