Starting /dee2/code/volunteer_pipeline.sh SRR7814953 current disk space = 1515797032960 free memory = 1607697860 SRR7814953 SRAfilesize 559a9bd34a0902519b2d43015a584872 SRR7814953.sra SRR7814953.sra file validated SRR7814953 is paired end SRR7814953 is conventional basespace SRR7814953 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814953_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.32075 37.0 37.0 37.0 37.0 37.0 2 36.3525 37.0 37.0 37.0 37.0 37.0 3 36.522 37.0 37.0 37.0 37.0 37.0 4 36.575 37.0 37.0 37.0 37.0 37.0 5 36.55 37.0 37.0 37.0 37.0 37.0 6 36.526 37.0 37.0 37.0 37.0 37.0 7 36.4625 37.0 37.0 37.0 37.0 37.0 8 36.562 37.0 37.0 37.0 37.0 37.0 9 36.471 37.0 37.0 37.0 37.0 37.0 10-14 36.543600000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.495099999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.4435 37.0 37.0 37.0 37.0 37.0 25-29 36.41330000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.44500000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4317 37.0 37.0 37.0 37.0 37.0 40-44 36.3402 37.0 37.0 37.0 37.0 37.0 45-49 36.3284 37.0 37.0 37.0 37.0 37.0 50-54 36.3221 37.0 37.0 37.0 37.0 37.0 55-59 36.3096 37.0 37.0 37.0 37.0 37.0 60-64 36.2204 37.0 37.0 37.0 37.0 37.0 65-69 36.181000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1382 37.0 37.0 37.0 37.0 37.0 75-79 36.155800000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.0979 37.0 37.0 37.0 37.0 37.0 85-89 36.093 37.0 37.0 37.0 37.0 37.0 90-94 35.9882 37.0 37.0 37.0 37.0 37.0 95-99 35.970099999999995 37.0 37.0 37.0 37.0 37.0 100-104 35.949799999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.9396 37.0 37.0 37.0 37.0 37.0 110-114 35.888799999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.8518 37.0 37.0 37.0 37.0 37.0 120-124 35.7704 37.0 37.0 37.0 37.0 37.0 125-129 35.6534 37.0 37.0 37.0 37.0 37.0 130-134 35.612 37.0 37.0 37.0 37.0 37.0 135-139 35.55499999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.585300000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.4775 37.0 37.0 37.0 34.6 37.0 150-151 34.59825 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 1.0 24 3.0 25 7.0 26 7.0 27 10.0 28 14.0 29 23.0 30 30.0 31 42.0 32 54.0 33 91.0 34 167.0 35 400.0 36 2898.0 37 250.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.32464276761093 12.634745550263224 9.751817498119829 32.288794184006015 2 26.35 16.1 33.675 23.875 3 22.15 24.25 24.675 28.925 4 26.05 29.375 20.525 24.05 5 26.424999999999997 31.974999999999998 21.4 20.200000000000003 6 20.724999999999998 33.5 22.975 22.8 7 16.1 20.599999999999998 41.925000000000004 21.375 8 21.05 21.575 26.85 30.525000000000002 9 20.424999999999997 20.275000000000002 31.05 28.249999999999996 10-14 23.544999999999998 26.6 24.46 25.395 15-19 23.95 25.474999999999998 25.005 25.569999999999997 20-24 24.51 25.679999999999996 25.130000000000003 24.68 25-29 23.965 25.119999999999997 24.785 26.13 30-34 23.91 25.2 25.35 25.540000000000003 35-39 23.73 25.480000000000004 24.75 26.040000000000003 40-44 24.335 25.86 24.16 25.645 45-49 24.38 26.16 24.349999999999998 25.11 50-54 24.365000000000002 25.1 24.265 26.27 55-59 24.695 24.52 24.385 26.400000000000002 60-64 24.495 24.77 24.65 26.085 65-69 24.075 24.7 25.130000000000003 26.095000000000002 70-74 25.275 24.47 23.765 26.490000000000002 75-79 24.765 24.945 24.4 25.89 80-84 24.605 24.29 24.625 26.479999999999997 85-89 24.654999999999998 24.75 23.955000000000002 26.640000000000004 90-94 24.675 24.375 24.16 26.790000000000003 95-99 25.61 24.36 24.435000000000002 25.595000000000002 100-104 25.305 24.425 24.18 26.090000000000003 105-109 24.39 24.265 24.45 26.895000000000003 110-114 25.019999999999996 23.51 24.755 26.715 115-119 24.68 23.82 25.019999999999996 26.479999999999997 120-124 25.64 23.474999999999998 24.295 26.590000000000003 125-129 25.045 23.47 24.555 26.93 130-134 25.215 24.485 23.95 26.35 135-139 25.629999999999995 24.02 24.465 25.885 140-144 25.72 23.955000000000002 24.27 26.055 145-149 25.515 24.215 23.91 26.36 150-151 25.2625 24.3125 22.9375 27.487499999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.0 22 0.5 23 1.0 24 1.0 25 2.0 26 3.0 27 2.5 28 3.0 29 5.5 30 7.5 31 14.5 32 23.5 33 24.0 34 29.5 35 38.0 36 42.5 37 66.5 38 85.0 39 91.5 40 97.5 41 117.5 42 134.0 43 155.0 44 169.5 45 164.0 46 166.5 47 158.0 48 168.0 49 178.5 50 171.0 51 158.5 52 149.5 53 146.5 54 125.0 55 111.5 56 109.5 57 108.0 58 99.5 59 76.5 60 72.0 61 69.0 62 62.5 63 62.5 64 65.5 65 61.5 66 59.5 67 55.0 68 46.5 69 48.0 70 38.5 71 28.5 72 29.0 73 25.5 74 18.5 75 12.5 76 8.0 77 10.5 78 7.5 79 2.0 80 2.5 81 1.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.975 #Duplication Level Percentage of deduplicated Percentage of total 1 92.03587931503125 84.65 2 7.284588203316118 13.4 3 0.5979885838543082 1.6500000000000001 4 0.08154389779831477 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.1625 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.5375000000000001 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.85 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 0.9874999999999999 0.0 0.0 0.0 0.0 130-131 1.1875 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.45 0.0 0.0 0.0 0.0 136-137 1.55 0.0 0.0 0.0 0.0 138-139 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAAGT 10 0.006830828 145.0 8 >>END_MODULE SRR7814953 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814953_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1205 37.0 37.0 37.0 37.0 37.0 2 35.586 37.0 37.0 37.0 37.0 37.0 3 35.8325 37.0 37.0 37.0 37.0 37.0 4 35.9495 37.0 37.0 37.0 37.0 37.0 5 36.037 37.0 37.0 37.0 37.0 37.0 6 35.7725 37.0 37.0 37.0 37.0 37.0 7 35.7045 37.0 37.0 37.0 37.0 37.0 8 35.8305 37.0 37.0 37.0 37.0 37.0 9 35.9225 37.0 37.0 37.0 37.0 37.0 10-14 35.8235 37.0 37.0 37.0 37.0 37.0 15-19 35.8542 37.0 37.0 37.0 37.0 37.0 20-24 35.7941 37.0 37.0 37.0 37.0 37.0 25-29 35.731100000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.6502 37.0 37.0 37.0 37.0 37.0 35-39 35.620000000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.554 37.0 37.0 37.0 37.0 37.0 45-49 35.4611 37.0 37.0 37.0 37.0 37.0 50-54 35.370999999999995 37.0 37.0 37.0 34.6 37.0 55-59 35.160799999999995 37.0 37.0 37.0 27.4 37.0 60-64 35.1202 37.0 37.0 37.0 25.0 37.0 65-69 35.166599999999995 37.0 37.0 37.0 29.8 37.0 70-74 34.9508 37.0 37.0 37.0 25.0 37.0 75-79 34.9273 37.0 37.0 37.0 25.0 37.0 80-84 34.834 37.0 37.0 37.0 25.0 37.0 85-89 34.795300000000005 37.0 37.0 37.0 25.0 37.0 90-94 34.615899999999996 37.0 37.0 37.0 25.0 37.0 95-99 34.313199999999995 37.0 37.0 37.0 25.0 37.0 100-104 34.4601 37.0 37.0 37.0 25.0 37.0 105-109 34.198699999999995 37.0 37.0 37.0 25.0 37.0 110-114 34.1127 37.0 37.0 37.0 25.0 37.0 115-119 34.2182 37.0 37.0 37.0 25.0 37.0 120-124 33.830000000000005 37.0 37.0 37.0 25.0 37.0 125-129 33.9531 37.0 37.0 37.0 25.0 37.0 130-134 33.53099999999999 37.0 37.0 37.0 25.0 37.0 135-139 33.4277 37.0 37.0 37.0 22.2 37.0 140-144 33.634100000000004 37.0 37.0 37.0 25.0 37.0 145-149 33.2841 37.0 37.0 37.0 22.2 37.0 150-151 32.793 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 3.0 14 7.0 15 14.0 16 6.0 17 8.0 18 6.0 19 5.0 20 7.0 21 4.0 22 8.0 23 10.0 24 6.0 25 11.0 26 16.0 27 20.0 28 23.0 29 43.0 30 63.0 31 100.0 32 138.0 33 255.0 34 479.0 35 1178.0 36 1566.0 37 22.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.2 15.7 11.525 29.575000000000003 2 30.575000000000003 20.8 26.75 21.875 3 26.174999999999997 22.1 27.150000000000002 24.575 4 28.549999999999997 30.475 17.325 23.65 5 28.999999999999996 32.9 17.424999999999997 20.674999999999997 6 21.7 35.275 18.9 24.125 7 22.2 17.175 34.449999999999996 26.174999999999997 8 23.825 22.125 20.925 33.125 9 26.150000000000002 22.275 23.7 27.875 10-14 26.565 25.490000000000002 21.83 26.115 15-19 26.875 24.91 22.485 25.729999999999997 20-24 26.450000000000003 25.080000000000002 22.865 25.605 25-29 25.745 24.845 23.52 25.89 30-34 26.19 25.39 23.04 25.380000000000003 35-39 25.874999999999996 24.18 22.82 27.125 40-44 26.71 25.130000000000003 23.03 25.130000000000003 45-49 27.05 24.759999999999998 22.445 25.745 50-54 26.595000000000002 24.41 23.115 25.88 55-59 26.715 24.51 22.975 25.8 60-64 27.36 24.33 23.3 25.009999999999998 65-69 26.889999999999997 25.495 22.655 24.959999999999997 70-74 26.135 24.81 23.53 25.525 75-79 26.939999999999998 24.560000000000002 22.975 25.525 80-84 26.924999999999997 24.545 23.24 25.290000000000003 85-89 27.51 25.135 22.48 24.875 90-94 26.76 23.855 23.485 25.900000000000002 95-99 27.37 24.495 22.975 25.16 100-104 27.275 24.805 22.615 25.305 105-109 26.790000000000003 24.435000000000002 23.07 25.705 110-114 27.875 24.665 22.68 24.779999999999998 115-119 27.589999999999996 25.025 22.71 24.675 120-124 27.42 25.019999999999996 22.54 25.019999999999996 125-129 27.245 25.0 22.53 25.224999999999998 130-134 27.21 25.064999999999998 23.169999999999998 24.555 135-139 27.134999999999998 25.224999999999998 22.91 24.73 140-144 27.095000000000002 25.324999999999996 22.96 24.62 145-149 27.74 24.975 22.99 24.295 150-151 28.299999999999997 24.975 22.7 24.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.5 22 0.5 23 0.0 24 1.0 25 1.5 26 2.5 27 4.0 28 4.0 29 3.5 30 5.0 31 8.0 32 10.0 33 9.0 34 7.5 35 12.5 36 25.0 37 44.0 38 45.5 39 60.0 40 94.0 41 106.0 42 117.0 43 134.0 44 139.5 45 167.0 46 183.5 47 175.0 48 174.0 49 159.5 50 155.0 51 156.5 52 151.5 53 143.0 54 127.0 55 109.0 56 104.0 57 105.0 58 112.5 59 113.0 60 93.5 61 86.5 62 87.5 63 78.5 64 73.0 65 79.5 66 74.5 67 60.0 68 58.0 69 64.0 70 57.5 71 41.5 72 36.5 73 28.5 74 17.5 75 16.0 76 15.5 77 11.0 78 6.5 79 3.0 80 2.0 81 3.0 82 2.0 83 0.5 84 0.5 85 2.5 86 2.5 87 0.5 88 0.5 89 0.5 90 0.0 91 0.5 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 1.5 98 1.5 99 0.5 100 6.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.725 #Duplication Level Percentage of deduplicated Percentage of total 1 92.259471245571 84.625 2 6.9773780321613526 12.8 3 0.5723630417007358 1.575 4 0.1362769146906514 0.5 5 0.0 0.0 6 0.027255382938130283 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027255382938130283 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.4125 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5125 0.0 0.0 0.0 0.0 122-123 0.5625 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.1125 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.4 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138-139 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTTGA 10 0.006830828 145.0 3 CCCCCCC 35 0.0035366106 20.714287 125-129 >>END_MODULE Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932786 spots for SRR7814953.sra Written 1932786 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra Read 1932783 spots for SRR7814953.sra Written 1932783 spots for SRR7814953.sra SRR ids: ['SRR7814953.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z25dshth SRR7814953.sra spots: 38655663 blocks: [[1, 1932783], [1932784, 3865566], [3865567, 5798349], [5798350, 7731132], [7731133, 9663915], [9663916, 11596698], [11596699, 13529481], [13529482, 15462264], [15462265, 17395047], [17395048, 19327830], [19327831, 21260613], [21260614, 23193396], [23193397, 25126179], [25126180, 27058962], [27058963, 28991745], [28991746, 30924528], [30924529, 32857311], [32857312, 34790094], [34790095, 36722877], [36722878, 38655663]] SRR7814953 file size 13077435 SRR7814953 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814953 SRR7814953_1.fastq SRR7814953_2.fastq Input file: SRR7814953_1.fastq Paired file: SRR7814953_2.fastq trimmed: SRR7814953-trimmed-pair1.fastq, SRR7814953-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:42:11 2024 >> started Thu Dec 12 02:43:16 2024 >> done (64.977s) 38655663 read pairs processed; of these: 114 ( 0.00%) short read pairs filtered out after trimming by size control 5248 ( 0.01%) empty read pairs filtered out after trimming by size control 38650301 (99.99%) read pairs available; of these: 1252590 ( 3.24%) trimmed read pairs available after processing 37397711 (96.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 21 0.00% 20 19 0.00% 21 29 0.00% 22 18 0.00% 23 44 0.00% 24 30 0.00% 25 41 0.00% 26 43 0.00% 27 50 0.00% 28 49 0.00% 29 40 0.00% 30 64 0.00% 31 57 0.00% 32 85 0.00% 33 66 0.00% 34 64 0.00% 35 71 0.00% 36 72 0.00% 37 87 0.00% 38 96 0.00% 39 79 0.00% 40 95 0.00% 41 83 0.00% 42 94 0.00% 43 92 0.00% 44 100 0.00% 45 82 0.00% 46 139 0.00% 47 98 0.00% 48 127 0.00% 49 111 0.00% 50 122 0.00% 51 121 0.00% 52 122 0.00% 53 140 0.00% 54 146 0.00% 55 140 0.00% 56 145 0.00% 57 149 0.00% 58 176 0.00% 59 157 0.00% 60 205 0.00% 61 203 0.00% 62 196 0.00% 63 245 0.00% 64 201 0.00% 65 240 0.00% 66 250 0.00% 67 303 0.00% 68 303 0.00% 69 351 0.00% 70 317 0.00% 71 361 0.00% 72 435 0.00% 73 519 0.00% 74 502 0.00% 75 512 0.00% 76 559 0.00% 77 651 0.00% 78 719 0.00% 79 838 0.00% 80 843 0.00% 81 903 0.00% 82 1085 0.00% 83 1202 0.00% 84 1261 0.00% 85 1421 0.00% 86 1570 0.00% 87 1661 0.00% 88 1801 0.00% 89 2012 0.01% 90 2349 0.01% 91 2393 0.01% 92 2820 0.01% 93 2993 0.01% 94 3329 0.01% 95 3410 0.01% 96 3835 0.01% 97 4072 0.01% 98 4556 0.01% 99 4805 0.01% 100 5196 0.01% 101 5335 0.01% 102 6039 0.02% 103 6366 0.02% 104 6866 0.02% 105 7384 0.02% 106 7847 0.02% 107 8125 0.02% 108 8434 0.02% 109 9012 0.02% 110 9734 0.03% 111 10275 0.03% 112 10896 0.03% 113 11568 0.03% 114 12446 0.03% 115 13045 0.03% 116 13746 0.04% 117 14154 0.04% 118 14672 0.04% 119 15487 0.04% 120 16204 0.04% 121 17226 0.04% 122 17499 0.05% 123 18912 0.05% 124 20293 0.05% 125 21157 0.05% 126 21797 0.06% 127 22587 0.06% 128 22947 0.06% 129 24292 0.06% 130 24858 0.06% 131 25907 0.07% 132 27671 0.07% 133 28796 0.07% 134 29790 0.08% 135 31535 0.08% 136 32750 0.08% 137 33229 0.09% 138 34528 0.09% 139 35789 0.09% 140 36574 0.09% 141 38064 0.10% 142 40312 0.10% 143 40777 0.11% 144 43190 0.11% 145 45254 0.12% 146 47044 0.12% 147 47707 0.12% 148 48112 0.12% 149 49383 0.13% 150 51973 0.13% 151 37397711 96.76% 38650301 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=27 prefix-density=0.55 prefix-fanout=3.2 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=214.06 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=20.1 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=3.27 fanout-score-rank=21 prefix-density=1.35 prefix-fanout=1.6 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=191.26 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=11.0 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTCGAGCACTCGACCGAAGATGTCTTGCTGCGGAGGAAACTGCAACTGCGGGTCATCCTGCAAGTGCGGCA SRR7814953 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:44:22 Started mapping on | Dec 12 02:44:22 Finished on | Dec 12 03:07:46 Mapping speed, Million of reads per hour | 99.10 Number of input reads | 38650301 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 30872777 Uniquely mapped reads % | 79.88% Average mapped length | 299.62 Number of splices: Total | 27378455 Number of splices: Annotated (sjdb) | 25633232 Number of splices: GT/AG | 27037097 Number of splices: GC/AG | 299144 Number of splices: AT/AC | 15131 Number of splices: Non-canonical | 27083 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265634 % of reads mapped to multiple loci | 0.69% Number of reads mapped to too many loci | 24076 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 18.85% % of reads unmapped: other | 0.52% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7511890 7511890 7511890 N_multimapping 265634 265634 265634 N_noFeature 710274 29891472 1101810 N_ambiguous 703339 5416 115500 UnstrandedReadsAssigned:29459164 PositiveStrandReadsAssigned:975889 NegativeStrandReadsAssigned:29655467 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814953 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814953-trimmed-pair1.fastq SRR7814953-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 38,650,301 reads, 30,634,185 reads pseudoaligned [quant] estimated average fragment length: 304.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,274 rounds 52973 SRR7814953.ke.tsv 35125 SRR7814953.se.tsv 88098 total ==> SRR7814953.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 633.229 7.06186e-05 4.31433e-06 PNS24247 1044 740.674 146.377 7.64541 PNS24249 1928 1624.67 162.528 3.87005 PNS24246 1044 740.674 146.377 7.64541 PNS24248 1044 740.674 146.377 7.64541 PNS24244 1471 1167.67 323.341 10.7126 PNS24243 293 74.8835 0 0 KQK14069 1603 1299.67 37803.6 1125.26 KQK14071 474 199.745 17.4675 3.38307 ==> SRR7814953.se.tsv <== BRADI_1g14170v3 36854 BRADI_1g53295v3 354 BRADI_1g59795v3 352 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 814 BRADI_1g74790v3 460 BRADI_1g09890v3 0 BRADI_1g77505v3 397 BRADI_1g48960v3 0 SRR7814953 completed mapping pipeline successfully