Starting /dee2/code/volunteer_pipeline.sh SRR7814954 current disk space = 1515781545984 free memory = 1607691092 SRR7814954 SRAfilesize 92654162d10d9605cc38640ac2be2ff9 SRR7814954.sra SRR7814954.sra file validated SRR7814954 is paired end SRR7814954 is conventional basespace SRR7814954 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814954_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.393 37.0 37.0 37.0 37.0 37.0 2 36.383 37.0 37.0 37.0 37.0 37.0 3 36.4675 37.0 37.0 37.0 37.0 37.0 4 36.545 37.0 37.0 37.0 37.0 37.0 5 36.492 37.0 37.0 37.0 37.0 37.0 6 36.5905 37.0 37.0 37.0 37.0 37.0 7 36.3975 37.0 37.0 37.0 37.0 37.0 8 36.52 37.0 37.0 37.0 37.0 37.0 9 36.524 37.0 37.0 37.0 37.0 37.0 10-14 36.51559999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5052 37.0 37.0 37.0 37.0 37.0 20-24 36.4661 37.0 37.0 37.0 37.0 37.0 25-29 36.417500000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.458000000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4015 37.0 37.0 37.0 37.0 37.0 40-44 36.4208 37.0 37.0 37.0 37.0 37.0 45-49 36.3282 37.0 37.0 37.0 37.0 37.0 50-54 36.251 37.0 37.0 37.0 37.0 37.0 55-59 36.269400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.217499999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.176100000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.13850000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.077 37.0 37.0 37.0 37.0 37.0 80-84 36.096399999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.979600000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.0306 37.0 37.0 37.0 37.0 37.0 95-99 35.9736 37.0 37.0 37.0 37.0 37.0 100-104 35.9191 37.0 37.0 37.0 37.0 37.0 105-109 35.8931 37.0 37.0 37.0 37.0 37.0 110-114 35.8382 37.0 37.0 37.0 37.0 37.0 115-119 35.8258 37.0 37.0 37.0 37.0 37.0 120-124 35.6503 37.0 37.0 37.0 37.0 37.0 125-129 35.5675 37.0 37.0 37.0 37.0 37.0 130-134 35.4817 37.0 37.0 37.0 37.0 37.0 135-139 35.53339999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.5026 37.0 37.0 37.0 37.0 37.0 145-149 35.3536 37.0 37.0 37.0 34.6 37.0 150-151 34.54275 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 1.0 24 2.0 25 8.0 26 9.0 27 9.0 28 15.0 29 32.0 30 34.0 31 36.0 32 58.0 33 100.0 34 162.0 35 438.0 36 2836.0 37 258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.7314629258517 11.24749498997996 10.145290581162325 37.87575150300601 2 25.224999999999998 16.05 32.7 26.025 3 24.25 22.85 23.275000000000002 29.625 4 27.474999999999998 28.575 18.75 25.2 5 26.974999999999998 30.725 20.45 21.85 6 22.3 32.824999999999996 23.599999999999998 21.275 7 19.55 20.5 39.125 20.825 8 21.375 20.349999999999998 26.650000000000002 31.624999999999996 9 21.7 19.325 31.65 27.325 10-14 24.075 25.445 23.755000000000003 26.724999999999998 15-19 24.404999999999998 24.85 24.095 26.650000000000002 20-24 24.474999999999998 24.905 24.13 26.490000000000002 25-29 24.060000000000002 25.085 24.349999999999998 26.505000000000003 30-34 23.9 24.95 24.515 26.634999999999998 35-39 24.245 24.5 24.235 27.02 40-44 24.21 24.93 23.855 27.005000000000003 45-49 24.47 25.095 23.635 26.8 50-54 24.21 24.044999999999998 24.25 27.495000000000005 55-59 25.055 24.72 23.385 26.840000000000003 60-64 24.8 24.67 23.785 26.745 65-69 24.990000000000002 24.93 23.175 26.905 70-74 25.790000000000003 24.195 24.075 25.94 75-79 25.575 24.575 23.494999999999997 26.355 80-84 25.5 24.54 23.04 26.919999999999998 85-89 24.615000000000002 24.445 23.775 27.165 90-94 25.124999999999996 23.505000000000003 23.400000000000002 27.97 95-99 25.929999999999996 23.48 23.77 26.82 100-104 25.16 23.915 23.674999999999997 27.250000000000004 105-109 25.46 23.830000000000002 23.669999999999998 27.04 110-114 25.264999999999997 24.01 23.685000000000002 27.04 115-119 25.724999999999998 23.64 23.32 27.315 120-124 25.75 23.794999999999998 23.830000000000002 26.625 125-129 25.36 23.465 23.125 28.050000000000004 130-134 25.895000000000003 23.605 23.630000000000003 26.87 135-139 25.7 23.97 23.175 27.155 140-144 26.21 22.855 23.855 27.08 145-149 25.825 23.294999999999998 23.535 27.345000000000002 150-151 26.0125 23.625 22.9625 27.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 3.0 29 5.0 30 5.0 31 9.0 32 14.5 33 21.0 34 27.0 35 28.5 36 33.5 37 48.0 38 61.5 39 67.5 40 88.0 41 118.0 42 142.5 43 147.5 44 157.0 45 169.5 46 183.0 47 175.0 48 147.5 49 143.0 50 149.5 51 152.0 52 152.0 53 139.5 54 116.5 55 102.0 56 100.0 57 100.0 58 90.5 59 92.5 60 89.5 61 85.5 62 95.5 63 96.5 64 87.0 65 76.0 66 62.5 67 56.5 68 59.0 69 56.5 70 43.5 71 38.5 72 36.5 73 33.5 74 27.5 75 17.5 76 15.5 77 11.5 78 6.0 79 5.5 80 4.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.46816580872392 85.32499999999999 2 6.800325115144947 12.55 3 0.6502302898943376 1.7999999999999998 4 0.0541858574911948 0.2 5 0.0270929287455974 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.7749999999999999 0.0 0.0 0.0 0.0 124-125 1.0 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.125 0.0 0.0 0.0 0.0 130-131 1.225 0.0 0.0 0.0 0.0 132-133 1.4125 0.0 0.0 0.0 0.0 134-135 1.65 0.0 0.0 0.0 0.0 136-137 1.85 0.0 0.0 0.0 0.0 138-139 1.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCTCC 10 0.006830828 145.0 7 >>END_MODULE SRR7814954 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814954_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.546 37.0 37.0 37.0 37.0 37.0 2 36.218 37.0 37.0 37.0 37.0 37.0 3 36.281 37.0 37.0 37.0 37.0 37.0 4 36.3535 37.0 37.0 37.0 37.0 37.0 5 36.3645 37.0 37.0 37.0 37.0 37.0 6 36.2835 37.0 37.0 37.0 37.0 37.0 7 36.178 37.0 37.0 37.0 37.0 37.0 8 36.2615 37.0 37.0 37.0 37.0 37.0 9 36.2335 37.0 37.0 37.0 37.0 37.0 10-14 36.2488 37.0 37.0 37.0 37.0 37.0 15-19 36.1956 37.0 37.0 37.0 37.0 37.0 20-24 36.186099999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.12650000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1075 37.0 37.0 37.0 37.0 37.0 35-39 36.0153 37.0 37.0 37.0 37.0 37.0 40-44 35.9354 37.0 37.0 37.0 37.0 37.0 45-49 35.9431 37.0 37.0 37.0 37.0 37.0 50-54 35.8047 37.0 37.0 37.0 37.0 37.0 55-59 35.711 37.0 37.0 37.0 37.0 37.0 60-64 35.6983 37.0 37.0 37.0 37.0 37.0 65-69 35.676399999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.5849 37.0 37.0 37.0 37.0 37.0 75-79 35.5723 37.0 37.0 37.0 37.0 37.0 80-84 35.4376 37.0 37.0 37.0 37.0 37.0 85-89 35.4225 37.0 37.0 37.0 34.6 37.0 90-94 35.3335 37.0 37.0 37.0 37.0 37.0 95-99 35.0128 37.0 37.0 37.0 25.0 37.0 100-104 35.0997 37.0 37.0 37.0 25.0 37.0 105-109 34.8741 37.0 37.0 37.0 25.0 37.0 110-114 34.992999999999995 37.0 37.0 37.0 25.0 37.0 115-119 35.0115 37.0 37.0 37.0 29.8 37.0 120-124 34.7472 37.0 37.0 37.0 25.0 37.0 125-129 34.782500000000006 37.0 37.0 37.0 25.0 37.0 130-134 34.4295 37.0 37.0 37.0 25.0 37.0 135-139 34.3814 37.0 37.0 37.0 25.0 37.0 140-144 34.5116 37.0 37.0 37.0 25.0 37.0 145-149 34.34610000000001 37.0 37.0 37.0 25.0 37.0 150-151 33.65175 37.0 37.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 4.0 15 6.0 16 6.0 17 5.0 18 3.0 19 3.0 20 6.0 21 5.0 22 11.0 23 15.0 24 10.0 25 17.0 26 14.0 27 8.0 28 15.0 29 26.0 30 27.0 31 50.0 32 69.0 33 136.0 34 281.0 35 804.0 36 2377.0 37 97.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.375 15.425 11.975 32.225 2 29.049999999999997 20.875 26.875 23.200000000000003 3 26.1 24.275 23.025000000000002 26.6 4 31.25 31.1 14.674999999999999 22.975 5 29.175 31.775 16.3 22.75 6 22.0 33.5 19.650000000000002 24.85 7 22.175 15.55 35.725 26.55 8 24.275 19.45 23.3 32.975 9 26.275 20.724999999999998 23.075000000000003 29.925 10-14 27.74 24.64 20.990000000000002 26.63 15-19 26.895000000000003 24.075 22.0 27.029999999999998 20-24 26.834999999999997 24.23 22.115000000000002 26.82 25-29 26.924999999999997 24.175 22.285 26.615 30-34 26.72 23.89 22.765 26.625 35-39 27.025 24.39 22.405 26.179999999999996 40-44 27.275 24.6 21.975 26.150000000000002 45-49 27.589999999999996 24.55 21.935 25.924999999999997 50-54 27.145000000000003 23.875 22.925 26.055 55-59 26.795 24.5 22.545 26.16 60-64 27.089999999999996 24.2 22.634999999999998 26.075 65-69 27.785 24.495 22.155 25.564999999999998 70-74 27.72 23.41 22.925 25.945 75-79 27.685 24.21 22.16 25.945 80-84 27.400000000000002 24.765 22.285 25.55 85-89 27.77 24.265 22.009999999999998 25.955000000000002 90-94 27.325 24.235 22.5 25.94 95-99 27.450000000000003 24.43 22.105 26.015 100-104 28.07 23.669999999999998 22.41 25.85 105-109 27.485 23.945 22.59 25.979999999999997 110-114 28.325 24.035 22.755 24.884999999999998 115-119 27.265 23.990000000000002 22.14 26.605 120-124 28.105000000000004 23.974999999999998 22.775000000000002 25.145 125-129 28.17 23.835 22.925 25.069999999999997 130-134 28.005000000000003 24.27 22.415 25.31 135-139 27.634999999999998 23.605 23.25 25.509999999999998 140-144 27.339999999999996 24.695 22.66 25.305 145-149 27.765 24.529999999999998 22.400000000000002 25.305 150-151 27.400000000000002 24.3125 23.3625 24.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 1.0 15 1.5 16 2.0 17 1.5 18 1.5 19 1.0 20 1.5 21 2.0 22 1.0 23 1.0 24 1.0 25 0.5 26 1.5 27 1.5 28 0.5 29 1.5 30 4.5 31 6.0 32 5.0 33 4.5 34 6.5 35 12.5 36 27.0 37 36.5 38 37.5 39 50.5 40 80.5 41 89.0 42 97.5 43 120.0 44 134.0 45 145.5 46 147.0 47 157.0 48 171.5 49 166.0 50 154.5 51 158.0 52 148.0 53 133.5 54 132.0 55 119.5 56 106.0 57 96.5 58 99.0 59 103.0 60 96.0 61 102.0 62 102.5 63 86.0 64 77.5 65 91.0 66 87.0 67 75.5 68 78.0 69 67.0 70 59.0 71 60.5 72 58.5 73 47.5 74 37.5 75 26.0 76 19.0 77 16.5 78 9.0 79 5.5 80 3.5 81 3.5 82 2.5 83 1.5 84 1.0 85 1.0 86 1.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.95 #Duplication Level Percentage of deduplicated Percentage of total 1 92.3599782490484 84.925 2 6.905927134312126 12.7 3 0.5709624796084829 1.575 4 0.08156606851549755 0.3 5 0.02718868950516585 0.125 6 0.02718868950516585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02718868950516585 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 6 0.15 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.6125 0.0 0.0 0.0 0.0 118-119 0.7124999999999999 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.8 0.0 0.0 0.0 0.0 124-125 1.0125 0.0 0.0 0.0 0.0 126-127 1.1125 0.0 0.0 0.0 0.0 128-129 1.175 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.5 0.0 0.0 0.0 0.0 134-135 1.7625000000000002 0.0 0.0 0.0 0.0 136-137 1.9625 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTCTT 10 0.006830828 145.0 4 >>END_MODULE Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741977 spots for SRR7814954.sra Written 1741977 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra Read 1741970 spots for SRR7814954.sra Written 1741970 spots for SRR7814954.sra SRR ids: ['SRR7814954.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ztw4iap SRR7814954.sra spots: 34839407 blocks: [[1, 1741970], [1741971, 3483940], [3483941, 5225910], [5225911, 6967880], [6967881, 8709850], [8709851, 10451820], [10451821, 12193790], [12193791, 13935760], [13935761, 15677730], [15677731, 17419700], [17419701, 19161670], [19161671, 20903640], [20903641, 22645610], [22645611, 24387580], [24387581, 26129550], [26129551, 27871520], [27871521, 29613490], [29613491, 31355460], [31355461, 33097430], [33097431, 34839407]] SRR7814954 file size 11784231 SRR7814954 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814954 SRR7814954_1.fastq SRR7814954_2.fastq Input file: SRR7814954_1.fastq Paired file: SRR7814954_2.fastq trimmed: SRR7814954-trimmed-pair1.fastq, SRR7814954-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:40:35 2024 >> started Thu Dec 12 02:41:12 2024 >> done (36.453s) 34839407 read pairs processed; of these: 90 ( 0.00%) short read pairs filtered out after trimming by size control 3223 ( 0.01%) empty read pairs filtered out after trimming by size control 34836094 (99.99%) read pairs available; of these: 1334358 ( 3.83%) trimmed read pairs available after processing 33501736 (96.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 20 0.00% 20 22 0.00% 21 24 0.00% 22 37 0.00% 23 53 0.00% 24 39 0.00% 25 62 0.00% 26 52 0.00% 27 57 0.00% 28 51 0.00% 29 50 0.00% 30 81 0.00% 31 79 0.00% 32 99 0.00% 33 67 0.00% 34 76 0.00% 35 103 0.00% 36 68 0.00% 37 86 0.00% 38 124 0.00% 39 108 0.00% 40 87 0.00% 41 102 0.00% 42 125 0.00% 43 106 0.00% 44 88 0.00% 45 146 0.00% 46 129 0.00% 47 117 0.00% 48 138 0.00% 49 147 0.00% 50 159 0.00% 51 142 0.00% 52 146 0.00% 53 158 0.00% 54 179 0.00% 55 202 0.00% 56 193 0.00% 57 174 0.00% 58 192 0.00% 59 199 0.00% 60 228 0.00% 61 244 0.00% 62 267 0.00% 63 238 0.00% 64 303 0.00% 65 290 0.00% 66 268 0.00% 67 310 0.00% 68 351 0.00% 69 362 0.00% 70 422 0.00% 71 443 0.00% 72 510 0.00% 73 529 0.00% 74 551 0.00% 75 599 0.00% 76 631 0.00% 77 738 0.00% 78 762 0.00% 79 908 0.00% 80 919 0.00% 81 1018 0.00% 82 1172 0.00% 83 1240 0.00% 84 1458 0.00% 85 1527 0.00% 86 1657 0.00% 87 1802 0.01% 88 2014 0.01% 89 2176 0.01% 90 2481 0.01% 91 2694 0.01% 92 2957 0.01% 93 3190 0.01% 94 3673 0.01% 95 3802 0.01% 96 4166 0.01% 97 4508 0.01% 98 4919 0.01% 99 5183 0.01% 100 5677 0.02% 101 5940 0.02% 102 6634 0.02% 103 7117 0.02% 104 7603 0.02% 105 8063 0.02% 106 8525 0.02% 107 8897 0.03% 108 9358 0.03% 109 9970 0.03% 110 10617 0.03% 111 11670 0.03% 112 12055 0.03% 113 12878 0.04% 114 13773 0.04% 115 14252 0.04% 116 14850 0.04% 117 15512 0.04% 118 16391 0.05% 119 16668 0.05% 120 17664 0.05% 121 18563 0.05% 122 19596 0.06% 123 20116 0.06% 124 21490 0.06% 125 22313 0.06% 126 23310 0.07% 127 24061 0.07% 128 24826 0.07% 129 25829 0.07% 130 26872 0.08% 131 27755 0.08% 132 29518 0.08% 133 30475 0.09% 134 31626 0.09% 135 33353 0.10% 136 34805 0.10% 137 35214 0.10% 138 36455 0.10% 139 37922 0.11% 140 38317 0.11% 141 39845 0.11% 142 41848 0.12% 143 42638 0.12% 144 45072 0.13% 145 47207 0.14% 146 48468 0.14% 147 49646 0.14% 148 49936 0.14% 149 51821 0.15% 150 55534 0.16% 151 33501736 96.17% 34836094 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=2.8 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=113.54 fanout-score-rank=1 prefix-density=0.57 prefix-fanout=16.2 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAG criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.77 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=23 fanout-score=107.32 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=17.3 sequence=CCGCCGCCGCCG SRR7814954 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:42:34 Started mapping on | Dec 12 02:42:35 Finished on | Dec 12 02:49:13 Mapping speed, Million of reads per hour | 315.10 Number of input reads | 34836094 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 30578844 Uniquely mapped reads % | 87.78% Average mapped length | 292.43 Number of splices: Total | 25323605 Number of splices: Annotated (sjdb) | 23739701 Number of splices: GT/AG | 25000370 Number of splices: GC/AG | 292366 Number of splices: AT/AC | 12245 Number of splices: Non-canonical | 18624 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.00% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 203371 % of reads mapped to multiple loci | 0.58% Number of reads mapped to too many loci | 27260 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.13% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4053879 4053879 4053879 N_multimapping 203371 203371 203371 N_noFeature 551629 29636579 862285 N_ambiguous 740989 4663 111057 UnstrandedReadsAssigned:29286226 PositiveStrandReadsAssigned:937602 NegativeStrandReadsAssigned:29605502 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR7814954 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814954-trimmed-pair1.fastq SRR7814954-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,836,094 reads, 31,399,547 reads pseudoaligned [quant] estimated average fragment length: 280.543 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 SRR7814954.ke.tsv 35125 SRR7814954.se.tsv 88098 total ==> SRR7814954.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.898 0 0 PNS24247 1044 764.457 165.16 8.28072 PNS24249 1928 1648.46 218.338 5.07654 PNS24246 1044 764.457 165.16 8.28072 PNS24248 1044 764.457 165.16 8.28072 PNS24244 1471 1191.46 506.183 16.2834 PNS24243 293 80.4306 2 0.953072 KQK14069 1603 1323.46 27477.1 795.751 KQK14071 474 214.621 641.336 114.533 ==> SRR7814954.se.tsv <== BRADI_1g14170v3 28823 BRADI_1g53295v3 76 BRADI_1g59795v3 354 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 1963 BRADI_1g74790v3 662 BRADI_1g09890v3 0 BRADI_1g77505v3 264 BRADI_1g48960v3 1 SRR7814954 completed mapping pipeline successfully