Starting /dee2/code/volunteer_pipeline.sh SRR7814955 current disk space = 1515738877952 free memory = 1607688168 SRR7814955 SRAfilesize e7a3738be1d895f4a4e60b2002a0c54b SRR7814955.sra SRR7814955.sra file validated SRR7814955 is paired end SRR7814955 is conventional basespace SRR7814955 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814955_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.382 37.0 37.0 37.0 37.0 37.0 2 36.41 37.0 37.0 37.0 37.0 37.0 3 36.467 37.0 37.0 37.0 37.0 37.0 4 36.5075 37.0 37.0 37.0 37.0 37.0 5 36.5175 37.0 37.0 37.0 37.0 37.0 6 36.502 37.0 37.0 37.0 37.0 37.0 7 36.463 37.0 37.0 37.0 37.0 37.0 8 36.5835 37.0 37.0 37.0 37.0 37.0 9 36.578 37.0 37.0 37.0 37.0 37.0 10-14 36.5642 37.0 37.0 37.0 37.0 37.0 15-19 36.518 37.0 37.0 37.0 37.0 37.0 20-24 36.4957 37.0 37.0 37.0 37.0 37.0 25-29 36.442800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4836 37.0 37.0 37.0 37.0 37.0 35-39 36.449799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.46 37.0 37.0 37.0 37.0 37.0 45-49 36.372 37.0 37.0 37.0 37.0 37.0 50-54 36.2944 37.0 37.0 37.0 37.0 37.0 55-59 36.3091 37.0 37.0 37.0 37.0 37.0 60-64 36.2675 37.0 37.0 37.0 37.0 37.0 65-69 36.225199999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.214999999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.1697 37.0 37.0 37.0 37.0 37.0 80-84 36.132600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.1284 37.0 37.0 37.0 37.0 37.0 90-94 36.0287 37.0 37.0 37.0 37.0 37.0 95-99 36.0019 37.0 37.0 37.0 37.0 37.0 100-104 35.9477 37.0 37.0 37.0 37.0 37.0 105-109 35.908699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.921400000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.7995 37.0 37.0 37.0 37.0 37.0 120-124 35.6993 37.0 37.0 37.0 37.0 37.0 125-129 35.62669999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.5733 37.0 37.0 37.0 37.0 37.0 135-139 35.629999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.53410000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.4052 37.0 37.0 37.0 34.6 37.0 150-151 34.671499999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 2.0 25 5.0 26 8.0 27 10.0 28 11.0 29 28.0 30 41.0 31 42.0 32 49.0 33 93.0 34 160.0 35 415.0 36 2854.0 37 281.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.04008016032064 13.001002004008017 10.270541082164328 31.688376753507015 2 25.4 17.25 32.25 25.1 3 21.325 24.474999999999998 25.0 29.2 4 26.6 29.475 20.175 23.75 5 23.775 32.1 22.125 22.0 6 21.8 33.575 23.5 21.125 7 17.575 21.55 39.25 21.625 8 21.55 22.400000000000002 26.5 29.549999999999997 9 21.425 20.325 30.2 28.050000000000004 10-14 23.395 25.995 24.425 26.185000000000002 15-19 23.405 25.255 24.735 26.605 20-24 23.294999999999998 25.845000000000002 24.58 26.279999999999998 25-29 23.705000000000002 25.5 23.7 27.095000000000002 30-34 23.724999999999998 26.064999999999998 23.225 26.985 35-39 24.435000000000002 24.759999999999998 24.565 26.240000000000002 40-44 24.22 24.695 23.705000000000002 27.38 45-49 24.085 25.11 23.565 27.24 50-54 23.255 25.019999999999996 24.615000000000002 27.11 55-59 23.82 24.585 23.974999999999998 27.62 60-64 24.349999999999998 24.795 23.27 27.584999999999997 65-69 23.98 25.019999999999996 23.74 27.26 70-74 24.46 24.62 23.845 27.075 75-79 24.32 24.69 23.57 27.42 80-84 24.365000000000002 25.014999999999997 23.919999999999998 26.700000000000003 85-89 25.165 24.395 23.330000000000002 27.11 90-94 24.98 23.82 23.665 27.534999999999997 95-99 24.83 24.279999999999998 23.369999999999997 27.52 100-104 24.11 24.605 23.36 27.925 105-109 24.965 24.310000000000002 23.200000000000003 27.525 110-114 24.7 23.425 24.279999999999998 27.595 115-119 25.415 23.595 23.335 27.655 120-124 25.324999999999996 23.455000000000002 23.630000000000003 27.589999999999996 125-129 25.540000000000003 23.805 23.035 27.62 130-134 24.94 23.68 23.549999999999997 27.83 135-139 24.845 23.69 23.455000000000002 28.01 140-144 25.53 23.18 23.365 27.925 145-149 25.064999999999998 23.335 23.455000000000002 28.144999999999996 150-151 26.337500000000002 23.1375 23.3375 27.187499999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 1.0 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 0.5 24 0.0 25 1.5 26 4.0 27 5.0 28 6.0 29 6.5 30 6.5 31 12.0 32 20.0 33 21.5 34 25.5 35 31.5 36 52.5 37 71.5 38 74.0 39 96.5 40 115.5 41 115.5 42 130.5 43 142.0 44 136.5 45 141.0 46 158.5 47 167.5 48 158.5 49 151.5 50 151.0 51 148.5 52 150.5 53 131.0 54 116.0 55 110.0 56 101.0 57 106.5 58 97.0 59 94.0 60 88.5 61 71.0 62 72.0 63 78.5 64 69.0 65 60.0 66 63.0 67 62.0 68 59.0 69 54.0 70 43.5 71 41.5 72 41.5 73 36.0 74 30.5 75 23.0 76 13.5 77 9.5 78 7.0 79 3.0 80 2.0 81 1.0 82 2.0 83 2.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.36749794464237 83.35000000000001 2 7.782954234036723 14.2 3 0.7399287476020828 2.025 4 0.0822143052891203 0.3 5 0.027404768429706773 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0125 0.0 0.0 82-83 0.0 0.0 0.025 0.0 0.0 84-85 0.0 0.0 0.025 0.0 0.0 86-87 0.025 0.0 0.025 0.0 0.0 88-89 0.025 0.0 0.025 0.0 0.0 90-91 0.025 0.0 0.025 0.0 0.0 92-93 0.07500000000000001 0.0 0.025 0.0 0.0 94-95 0.125 0.0 0.025 0.0 0.0 96-97 0.125 0.0 0.025 0.0 0.0 98-99 0.16249999999999998 0.0 0.025 0.0 0.0 100-101 0.1875 0.0 0.025 0.0 0.0 102-103 0.21250000000000002 0.0 0.025 0.0 0.0 104-105 0.225 0.0 0.025 0.0 0.0 106-107 0.32499999999999996 0.0 0.025 0.0 0.0 108-109 0.475 0.0 0.025 0.0 0.0 110-111 0.5 0.0 0.025 0.0 0.0 112-113 0.55 0.0 0.025 0.0 0.0 114-115 0.6125 0.0 0.025 0.0 0.0 116-117 0.7625 0.0 0.025 0.0 0.0 118-119 0.925 0.0 0.025 0.0 0.0 120-121 1.0 0.0 0.025 0.0 0.0 122-123 1.0875 0.0 0.025 0.0 0.0 124-125 1.1625 0.0 0.025 0.0 0.0 126-127 1.3625 0.0 0.025 0.0 0.0 128-129 1.5375 0.0 0.025 0.0 0.0 130-131 1.8375 0.0 0.025 0.0 0.0 132-133 1.9874999999999998 0.0 0.025 0.0 0.0 134-135 2.1375 0.0 0.025 0.0 0.0 136-137 2.3875 0.0 0.025 0.0 0.0 138-139 2.75 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0035366106 20.714287 30-34 >>END_MODULE SRR7814955 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7814955_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.12 37.0 37.0 37.0 37.0 37.0 2 35.705 37.0 37.0 37.0 37.0 37.0 3 35.7295 37.0 37.0 37.0 37.0 37.0 4 35.7825 37.0 37.0 37.0 37.0 37.0 5 35.8 37.0 37.0 37.0 37.0 37.0 6 35.5755 37.0 37.0 37.0 37.0 37.0 7 35.5125 37.0 37.0 37.0 37.0 37.0 8 35.605 37.0 37.0 37.0 37.0 37.0 9 35.6125 37.0 37.0 37.0 37.0 37.0 10-14 35.6009 37.0 37.0 37.0 37.0 37.0 15-19 35.585300000000004 37.0 37.0 37.0 37.0 37.0 20-24 35.5593 37.0 37.0 37.0 37.0 37.0 25-29 35.4478 37.0 37.0 37.0 37.0 37.0 30-34 35.4268 37.0 37.0 37.0 37.0 37.0 35-39 35.3449 37.0 37.0 37.0 37.0 37.0 40-44 35.2869 37.0 37.0 37.0 37.0 37.0 45-49 35.2291 37.0 37.0 37.0 37.0 37.0 50-54 35.075599999999994 37.0 37.0 37.0 29.8 37.0 55-59 34.96810000000001 37.0 37.0 37.0 25.0 37.0 60-64 34.9453 37.0 37.0 37.0 25.0 37.0 65-69 34.9139 37.0 37.0 37.0 25.0 37.0 70-74 34.8665 37.0 37.0 37.0 25.0 37.0 75-79 34.716899999999995 37.0 37.0 37.0 25.0 37.0 80-84 34.57619999999999 37.0 37.0 37.0 25.0 37.0 85-89 34.60790000000001 37.0 37.0 37.0 25.0 37.0 90-94 34.449 37.0 37.0 37.0 25.0 37.0 95-99 34.101800000000004 37.0 37.0 37.0 25.0 37.0 100-104 34.181400000000004 37.0 37.0 37.0 25.0 37.0 105-109 33.8863 37.0 37.0 37.0 25.0 37.0 110-114 34.0206 37.0 37.0 37.0 25.0 37.0 115-119 34.068799999999996 37.0 37.0 37.0 25.0 37.0 120-124 33.67960000000001 37.0 37.0 37.0 22.2 37.0 125-129 33.7729 37.0 37.0 37.0 25.0 37.0 130-134 33.374700000000004 37.0 37.0 37.0 22.2 37.0 135-139 33.2237 37.0 37.0 37.0 19.4 37.0 140-144 33.499 37.0 37.0 37.0 25.0 37.0 145-149 33.1545 37.0 37.0 37.0 19.4 37.0 150-151 32.68125 37.0 31.0 37.0 18.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 13.0 14 14.0 15 11.0 16 12.0 17 5.0 18 5.0 19 12.0 20 13.0 21 16.0 22 18.0 23 18.0 24 17.0 25 12.0 26 22.0 27 23.0 28 32.0 29 41.0 30 47.0 31 67.0 32 117.0 33 221.0 34 499.0 35 1101.0 36 1630.0 37 31.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.824999999999996 14.649999999999999 11.799999999999999 28.725 2 31.424999999999997 20.3 24.65 23.625 3 28.349999999999998 21.025 25.275 25.35 4 30.875000000000004 29.349999999999998 16.275000000000002 23.5 5 28.849999999999998 33.775 16.8 20.575 6 24.95 32.925 17.75 24.375 7 23.875 16.275000000000002 33.025 26.825 8 25.3 19.55 20.175 34.975 9 26.700000000000003 22.725 21.525 29.049999999999997 10-14 27.51 24.154999999999998 21.15 27.185 15-19 27.744999999999997 23.73 22.245 26.279999999999998 20-24 27.145000000000003 24.295 22.189999999999998 26.369999999999997 25-29 27.529999999999998 24.215 22.37 25.885 30-34 27.625 24.675 21.805 25.895000000000003 35-39 27.61 24.47 21.755 26.165 40-44 27.245 24.41 22.57 25.775 45-49 27.639999999999997 23.97 22.005 26.384999999999998 50-54 28.415000000000003 24.169999999999998 21.575 25.840000000000003 55-59 28.134999999999998 24.03 21.58 26.255 60-64 28.044999999999998 24.060000000000002 22.045 25.85 65-69 27.715 24.365000000000002 22.445 25.474999999999998 70-74 27.68 24.3 22.18 25.840000000000003 75-79 28.285 24.135 22.095000000000002 25.485000000000003 80-84 28.110000000000003 24.51 22.2 25.180000000000003 85-89 28.799999999999997 24.58 21.92 24.7 90-94 28.765 24.725 21.315 25.195 95-99 28.845 24.145 21.59 25.419999999999998 100-104 28.065 23.974999999999998 22.15 25.81 105-109 28.88 24.355 21.77 24.995 110-114 28.185 24.54 22.439999999999998 24.834999999999997 115-119 27.834999999999997 23.715 22.81 25.64 120-124 28.565 23.84 22.585 25.009999999999998 125-129 28.675 24.75 22.74 23.835 130-134 28.205000000000002 24.404999999999998 22.564999999999998 24.825 135-139 28.645 24.195 23.035 24.125 140-144 28.595 24.740000000000002 22.245 24.42 145-149 28.33 24.585 22.57 24.515 150-151 29.075 24.45 21.8 24.675 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 1.0 8 0.5 9 0.5 10 1.5 11 2.0 12 1.0 13 0.0 14 1.5 15 2.0 16 1.0 17 1.0 18 1.5 19 1.5 20 2.0 21 2.0 22 2.0 23 2.5 24 1.0 25 2.0 26 3.5 27 1.5 28 1.5 29 3.5 30 4.5 31 5.0 32 5.5 33 7.0 34 11.0 35 15.5 36 22.5 37 36.0 38 42.5 39 45.5 40 61.0 41 86.5 42 103.0 43 110.5 44 127.0 45 134.5 46 143.0 47 157.0 48 150.5 49 142.5 50 137.5 51 157.5 52 161.0 53 137.5 54 129.0 55 119.5 56 109.0 57 110.5 58 110.5 59 102.0 60 107.5 61 108.0 62 104.0 63 99.5 64 88.0 65 78.5 66 80.5 67 84.5 68 78.0 69 67.5 70 57.5 71 53.0 72 51.5 73 47.0 74 35.5 75 22.5 76 22.0 77 21.5 78 14.0 79 8.5 80 6.0 81 5.0 82 3.5 83 1.5 84 0.5 85 1.5 86 3.0 87 2.0 88 0.5 89 1.0 90 1.5 91 0.5 92 2.0 93 2.5 94 1.0 95 3.0 96 3.0 97 1.0 98 0.5 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.175 #Duplication Level Percentage of deduplicated Percentage of total 1 92.10309843707157 83.975 2 6.90978886756238 12.6 3 0.7129147244310392 1.95 4 0.16451878256100905 0.6 5 0.027419797093501508 0.125 6 0.0 0.0 7 0.027419797093501508 0.17500000000000002 8 0.0 0.0 9 0.027419797093501508 0.22499999999999998 >10 0.027419797093501508 0.35000000000000003 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 14 0.35000000000000003 No Hit AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 9 0.22499999999999998 No Hit CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 7 0.17500000000000002 No Hit CCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTCTTCCTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.6125 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.1375 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.5125 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 1.9500000000000002 0.0 0.0 0.0 0.0 134-135 2.05 0.0 0.0 0.0 0.0 136-137 2.2750000000000004 0.0 0.0 0.0 0.0 138-139 2.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGTAG 10 0.006830828 145.0 8 >>END_MODULE Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634240 spots for SRR7814955.sra Written 1634240 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra Read 1634231 spots for SRR7814955.sra Written 1634231 spots for SRR7814955.sra SRR ids: ['SRR7814955.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e8_gf_kl SRR7814955.sra spots: 32684629 blocks: [[1, 1634231], [1634232, 3268462], [3268463, 4902693], [4902694, 6536924], [6536925, 8171155], [8171156, 9805386], [9805387, 11439617], [11439618, 13073848], [13073849, 14708079], [14708080, 16342310], [16342311, 17976541], [17976542, 19610772], [19610773, 21245003], [21245004, 22879234], [22879235, 24513465], [24513466, 26147696], [26147697, 27781927], [27781928, 29416158], [29416159, 31050389], [31050390, 32684629]] SRR7814955 file size 11054047 SRR7814955 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7814955 SRR7814955_1.fastq SRR7814955_2.fastq Input file: SRR7814955_1.fastq Paired file: SRR7814955_2.fastq trimmed: SRR7814955-trimmed-pair1.fastq, SRR7814955-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Dec 12 02:40:51 2024 >> started Thu Dec 12 02:41:32 2024 >> done (41.540s) 32684629 read pairs processed; of these: 92 ( 0.00%) short read pairs filtered out after trimming by size control 5881 ( 0.02%) empty read pairs filtered out after trimming by size control 32678656 (99.98%) read pairs available; of these: 1424133 ( 4.36%) trimmed read pairs available after processing 31254523 (95.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 18 0.00% 20 19 0.00% 21 29 0.00% 22 26 0.00% 23 38 0.00% 24 30 0.00% 25 40 0.00% 26 41 0.00% 27 48 0.00% 28 54 0.00% 29 44 0.00% 30 58 0.00% 31 62 0.00% 32 88 0.00% 33 61 0.00% 34 52 0.00% 35 81 0.00% 36 66 0.00% 37 95 0.00% 38 105 0.00% 39 97 0.00% 40 90 0.00% 41 107 0.00% 42 125 0.00% 43 97 0.00% 44 91 0.00% 45 109 0.00% 46 109 0.00% 47 121 0.00% 48 118 0.00% 49 143 0.00% 50 157 0.00% 51 140 0.00% 52 145 0.00% 53 182 0.00% 54 154 0.00% 55 207 0.00% 56 189 0.00% 57 204 0.00% 58 198 0.00% 59 210 0.00% 60 219 0.00% 61 255 0.00% 62 271 0.00% 63 297 0.00% 64 284 0.00% 65 295 0.00% 66 311 0.00% 67 309 0.00% 68 362 0.00% 69 385 0.00% 70 402 0.00% 71 485 0.00% 72 507 0.00% 73 598 0.00% 74 611 0.00% 75 620 0.00% 76 662 0.00% 77 790 0.00% 78 843 0.00% 79 980 0.00% 80 1125 0.00% 81 1176 0.00% 82 1329 0.00% 83 1530 0.00% 84 1657 0.01% 85 1840 0.01% 86 1899 0.01% 87 2037 0.01% 88 2195 0.01% 89 2345 0.01% 90 2627 0.01% 91 3013 0.01% 92 3379 0.01% 93 3802 0.01% 94 4106 0.01% 95 4448 0.01% 96 4521 0.01% 97 5021 0.02% 98 5411 0.02% 99 5724 0.02% 100 6069 0.02% 101 6854 0.02% 102 7221 0.02% 103 7976 0.02% 104 8365 0.03% 105 9099 0.03% 106 9476 0.03% 107 9459 0.03% 108 10133 0.03% 109 10821 0.03% 110 11364 0.03% 111 12111 0.04% 112 12985 0.04% 113 13983 0.04% 114 14981 0.05% 115 15541 0.05% 116 15823 0.05% 117 16558 0.05% 118 17088 0.05% 119 17848 0.05% 120 18588 0.06% 121 19753 0.06% 122 20884 0.06% 123 22168 0.07% 124 23563 0.07% 125 24516 0.08% 126 25456 0.08% 127 25590 0.08% 128 26519 0.08% 129 27120 0.08% 130 28130 0.09% 131 29429 0.09% 132 30833 0.09% 133 32831 0.10% 134 33736 0.10% 135 35813 0.11% 136 36747 0.11% 137 37247 0.11% 138 38638 0.12% 139 39627 0.12% 140 40466 0.12% 141 41937 0.13% 142 43772 0.13% 143 45205 0.14% 144 47976 0.15% 145 50272 0.15% 146 52384 0.16% 147 52537 0.16% 148 52925 0.16% 149 54249 0.17% 150 58733 0.18% 151 31254523 95.64% 32678656 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=30 prefix-density=0.77 prefix-fanout=3.5 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=20 fanout-score=191.68 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=29.5 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=1.62 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=18 prefix-density=1.82 prefix-fanout=3.0 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=47.87 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=1.8 sequence=GCAGCAGAAACATCCTTAACTGAGCTCCTCACTCACTCACTGCAGCTAGCCTCTTCTTCCTCAGTCGTCAGAAAGAATGTCTTGCTG SRR7814955 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 12 02:42:16 Started mapping on | Dec 12 02:42:16 Finished on | Dec 12 02:47:30 Mapping speed, Million of reads per hour | 374.66 Number of input reads | 32678656 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 29650432 Uniquely mapped reads % | 90.73% Average mapped length | 299.12 Number of splices: Total | 23698938 Number of splices: Annotated (sjdb) | 22260713 Number of splices: GT/AG | 23416378 Number of splices: GC/AG | 246438 Number of splices: AT/AC | 12057 Number of splices: Non-canonical | 24065 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270978 % of reads mapped to multiple loci | 0.83% Number of reads mapped to too many loci | 22588 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.80% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2757246 2757246 2757246 N_multimapping 270978 270978 270978 N_noFeature 544185 28669573 930116 N_ambiguous 676952 4491 83631 UnstrandedReadsAssigned:28429295 PositiveStrandReadsAssigned:976368 NegativeStrandReadsAssigned:28636685 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR7814955 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR7814955-trimmed-pair1.fastq SRR7814955-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,678,656 reads, 29,677,141 reads pseudoaligned [quant] estimated average fragment length: 281.234 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52973 SRR7814955.ke.tsv 35125 SRR7814955.se.tsv 88098 total ==> SRR7814955.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.204 214.358 11.9264 PNS24247 1044 763.766 40.1478 1.91915 PNS24249 1928 1647.77 109.983 2.4369 PNS24246 1044 763.766 40.1478 1.91915 PNS24248 1044 763.766 40.1478 1.91915 PNS24244 1471 1190.77 318.216 9.75669 PNS24243 293 78.935 1 0.462528 KQK14069 1603 1322.77 26811.4 740.021 KQK14071 474 212.788 82.0235 14.0734 ==> SRR7814955.se.tsv <== BRADI_1g14170v3 26199 BRADI_1g53295v3 353 BRADI_1g59795v3 312 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 1021 BRADI_1g74790v3 453 BRADI_1g09890v3 0 BRADI_1g77505v3 517 BRADI_1g48960v3 0 SRR7814955 completed mapping pipeline successfully