Starting /dee2/code/volunteer_pipeline.sh SRR7865985 current disk space = 1523696324608 free memory = 1569023956 SRR7865985 SRAfilesize 215e41cdaf4b7887b5690c6f8198b32f SRR7865985.sra SRR7865985.sra file validated SRR7865985 is single end SRR7865985 is conventional basespace SRR7865985 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865985_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68725 34.0 31.0 34.0 31.0 34.0 2 32.3485 34.0 31.0 34.0 31.0 34.0 3 32.72875 34.0 31.0 34.0 31.0 34.0 4 36.344 37.0 37.0 37.0 35.0 37.0 5 36.3205 37.0 37.0 37.0 35.0 37.0 6 36.258 37.0 37.0 37.0 35.0 37.0 7 36.1895 37.0 37.0 37.0 35.0 37.0 8 36.143 37.0 37.0 37.0 35.0 37.0 9 37.89525 39.0 38.0 39.0 35.0 39.0 10 38.02375 39.0 38.0 39.0 35.0 39.0 11 38.0735 39.0 39.0 39.0 35.0 39.0 12 38.098 39.0 39.0 39.0 35.0 39.0 13 37.9745 39.0 38.0 39.0 35.0 39.0 14 39.52675 41.0 40.0 41.0 37.0 41.0 15 39.4995 41.0 39.0 41.0 36.0 41.0 16 39.47125 41.0 39.0 41.0 36.0 41.0 17 39.474 41.0 39.0 41.0 36.0 41.0 18 39.3745 41.0 39.0 41.0 36.0 41.0 19 39.3535 41.0 39.0 41.0 36.0 41.0 20 39.25425 41.0 39.0 41.0 36.0 41.0 21 39.2465 41.0 39.0 41.0 36.0 41.0 22 39.03 40.0 39.0 41.0 35.0 41.0 23 39.053 40.0 39.0 41.0 36.0 41.0 24 39.004 40.0 39.0 41.0 35.0 41.0 25 38.87325 40.0 38.0 41.0 35.0 41.0 26 38.788 40.0 38.0 41.0 35.0 41.0 27 38.70875 40.0 38.0 41.0 35.0 41.0 28 38.5005 40.0 38.0 41.0 34.0 41.0 29 38.304 40.0 38.0 41.0 34.0 41.0 30 37.794 40.0 38.0 41.0 32.0 41.0 31 37.938 40.0 38.0 41.0 33.0 41.0 32 37.30175 40.0 37.0 41.0 31.0 41.0 33 37.44225 40.0 37.0 41.0 32.0 41.0 34 37.1965 40.0 37.0 41.0 31.0 41.0 35 37.472 40.0 37.0 41.0 32.0 41.0 36 37.48475 40.0 37.0 41.0 32.0 41.0 37 37.71475 40.0 38.0 41.0 33.0 41.0 38 37.76075 40.0 38.0 41.0 33.0 41.0 39 37.79925 40.0 38.0 41.0 33.0 41.0 40 37.74825 40.0 37.0 41.0 33.0 41.0 41 37.57525 40.0 37.0 41.0 33.0 41.0 42 37.5585 40.0 37.0 41.0 33.0 41.0 43 37.36275 40.0 37.0 41.0 33.0 41.0 44 37.11025 40.0 36.0 41.0 32.0 41.0 45 36.88675 40.0 36.0 41.0 32.0 41.0 46 36.69025 39.0 35.0 41.0 31.0 41.0 47 36.37 39.0 35.0 41.0 31.0 41.0 48 36.25875 39.0 35.0 41.0 31.0 41.0 49 36.095 39.0 35.0 41.0 31.0 41.0 50 35.67675 38.0 35.0 41.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 1.0 15 1.0 16 1.0 17 5.0 18 4.0 19 3.0 20 8.0 21 11.0 22 8.0 23 13.0 24 10.0 25 11.0 26 12.0 27 24.0 28 24.0 29 32.0 30 33.0 31 46.0 32 83.0 33 98.0 34 117.0 35 172.0 36 251.0 37 419.0 38 783.0 39 1825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.26890335503255 11.016524787180773 10.315473209814723 49.399098647971954 2 24.668367346938773 17.52551020408163 29.28571428571429 28.520408163265305 3 25.825 17.8 21.95 34.425 4 30.5 22.400000000000002 16.85 30.25 5 32.300000000000004 25.775 18.5 23.425 6 26.825 30.675 19.8 22.7 7 23.825 19.475 35.0 21.7 8 23.425 21.224999999999998 27.825 27.525 9 22.975 19.900000000000002 30.275000000000002 26.85 10 23.400000000000002 32.4 22.05 22.15 11 29.175 24.575 18.625 27.625 12 26.525 20.95 23.05 29.475 13 24.8 23.65 25.124999999999996 26.424999999999997 14 26.924999999999997 23.175 22.775000000000002 27.125 15 25.624999999999996 24.525 21.85 28.000000000000004 16 25.8 24.75 22.025 27.425 17 26.700000000000003 24.05 21.875 27.375 18 27.675 23.625 23.65 25.05 19 26.875 23.400000000000002 22.85 26.875 20 28.475 23.075000000000003 22.25 26.200000000000003 21 27.775 23.45 22.075 26.700000000000003 22 27.85 23.225 22.175 26.75 23 26.625 22.8 22.7 27.875 24 26.275 23.575 23.225 26.924999999999997 25 25.224999999999998 25.15 22.375 27.250000000000004 26 26.025 23.325000000000003 23.025000000000002 27.625 27 25.874999999999996 24.6 22.55 26.974999999999998 28 26.25 23.400000000000002 23.075000000000003 27.275 29 26.900000000000002 22.725 22.075 28.299999999999997 30 26.174999999999997 21.65 23.925 28.249999999999996 31 27.700000000000003 21.8 22.275 28.225 32 26.85 23.1 22.425 27.625 33 27.325 22.45 22.1 28.125 34 26.325 24.025 21.75 27.900000000000002 35 25.35 24.5 22.075 28.075 36 27.175 23.925 23.674999999999997 25.224999999999998 37 26.424999999999997 22.125 23.925 27.525 38 25.474999999999998 23.875 23.7 26.950000000000003 39 26.950000000000003 23.425 22.55 27.075 40 27.224999999999998 23.0 22.275 27.500000000000004 41 28.375 21.175 23.400000000000002 27.05 42 27.55 23.375 22.7 26.375 43 26.8 23.325000000000003 22.125 27.750000000000004 44 28.9 22.175 21.575 27.35 45 27.425 22.6 23.025000000000002 26.950000000000003 46 25.4 22.6 22.725 29.275000000000002 47 27.900000000000002 22.425 22.325 27.35 48 26.974999999999998 22.45 22.525000000000002 28.050000000000004 49 26.1 22.275 24.95 26.674999999999997 50 25.8 22.625 23.125 28.449999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 3.5 28 6.0 29 6.5 30 7.0 31 11.5 32 16.0 33 24.5 34 33.0 35 43.5 36 54.0 37 62.5 38 71.0 39 100.5 40 130.0 41 127.0 42 124.0 43 168.0 44 212.0 45 220.5 46 229.0 47 230.0 48 231.0 49 275.5 50 320.0 51 360.5 52 401.0 53 383.0 54 365.0 55 375.5 56 386.0 57 350.5 58 315.0 59 272.0 60 229.0 61 209.0 62 189.0 63 160.0 64 131.0 65 138.0 66 145.0 67 119.0 68 93.0 69 89.5 70 86.0 71 75.5 72 65.0 73 64.0 74 63.0 75 51.5 76 40.0 77 37.5 78 35.0 79 23.5 80 12.0 81 9.5 82 7.0 83 4.5 84 2.0 85 2.0 86 2.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.15 #Duplication Level Percentage of deduplicated Percentage of total 1 90.59093516924843 78.95 2 6.798623063683305 11.85 3 1.4343086632243258 3.75 4 0.5450372920252439 1.9 5 0.34423407917383825 1.5 6 0.08605851979345956 0.44999999999999996 7 0.08605851979345956 0.525 8 0.0 0.0 9 0.028686173264486515 0.22499999999999998 >10 0.08605851979345956 0.8500000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTGATTCTGGCTCAGAACGAACGCTGGCGGCATGCCTAACACATGCAA 12 0.3 No Hit CTGTGTTTTTGCTAAACAGTCGCTACCCCCTGGCCTGTGCCCCCCACAAC 12 0.3 No Hit CTGAAACATCTCAGTAGCTGGAGGAAAAGACATCAACCGAGATTCCGTAA 10 0.25 No Hit CTTTAAAGAAAGCGTAACAGCTCACTGGTCTAAACAAGGGTTCCTGCGGC 9 0.22499999999999998 No Hit GTCCCGCCCTACTCAAGTCCTGATGTTTCACTTTCGCATACGGGGCTGTC 7 0.17500000000000002 No Hit GTTGTGTTTAGGGGTGAAAGGCCAATCAAGCCGGGAAATAGCTGGTTCTC 7 0.17500000000000002 No Hit CAAGGGTTTGGCTGTTCGCCAATTAAAGTGGTACGTGAGCTGGGTTCAGA 7 0.17500000000000002 No Hit CGCGGCATTGCTGGATCAGGCTTTCGCCCATTGTCCAATATTCCCCACTG 6 0.15 No Hit AAGATATCTTATCTTGAGGGAGGCTTCCCGCTTAGATGCTTTCAGCGGTT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 6 0.15 TruSeq Adapter, Index 10 (100% over 50bp) CCTGTTTATCGCTACTCATGTCTGCATTCGCACTTCCGATACCTCCACGG 5 0.125 No Hit CAACGTTTGACATCCCTAGTATGGATCGTGGAGACACTTTCCTTCAGTTC 5 0.125 No Hit CCCGGGTAAAAGAGCTTTACAACCCTAAGGCCTTCATCACTCACGCGGCA 5 0.125 No Hit CGCCGGGTTTCGGGTCTAATGCATCAAACTAAGTCGCCCTATTCAGACTC 5 0.125 No Hit CGGTCATGCACGAGTATTTAGGCTTGGAGGGTGGTCCCCCCATGTTCAGA 5 0.125 No Hit CATGGGGGGACCACCCTCCAAGCCTAAATACTCGTGCATGACCGATAGTG 5 0.125 No Hit CGCGTAAGGGCCATGAGGACTTGACGTCATCCCCACCTTCCTCCGGCTTA 5 0.125 No Hit CTCCTCTCAAATATCGACGCCCACGGCAGATAGGGACCAAACTGTCTCGC 5 0.125 No Hit CTCCGACGTTCAAGCGATGCAGTCTTAAAGGCTATTCCGGGGTTGAGCCC 5 0.125 No Hit CTTTCGGCGACAGGGCATCTCACCCTGTTTATCGCTACTCATGTCTGCAT 5 0.125 No Hit CTTCGAGAATGTAGACTAAGCCGGGGGTGTTGTGGTATCGAGGTAATAAA 5 0.125 No Hit CATGCCTAGATCGCCGGGTTTCGGGTCTAATGCATCAAACTAAGTCGCCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.075 0.0 0.0 0.0 0.0 2 0.075 0.0 0.0 0.0 0.0 3 0.075 0.0 0.0 0.0 0.0 4 0.075 0.0 0.0 0.0 0.0 5 0.075 0.0 0.0 0.0 0.0 6 0.125 0.0 0.0 0.0 0.0 7 0.125 0.0 0.0 0.0 0.0 8 0.125 0.0 0.0 0.0 0.0 9 0.125 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.15 0.0 0.0 0.0 0.0 16 0.15 0.0 0.0 0.0 0.0 17 0.15 0.0 0.0 0.0 0.0 18 0.15 0.0 0.0 0.0 0.0 19 0.15 0.0 0.0 0.0 0.0 20 0.15 0.0 0.0 0.0 0.0 21 0.15 0.0 0.0 0.0 0.0 22 0.175 0.0 0.0 0.0 0.0 23 0.2 0.0 0.0 0.0 0.0 24 0.2 0.0 0.0 0.0 0.0 25 0.225 0.0 0.0 0.0 0.0 26 0.225 0.0 0.0 0.0 0.0 27 0.275 0.0 0.0 0.0 0.0 28 0.275 0.0 0.0 0.0 0.0 29 0.275 0.0 0.0 0.0 0.0 30 0.275 0.0 0.0 0.0 0.0 31 0.275 0.0 0.0 0.0 0.0 32 0.275 0.0 0.0 0.0 0.0 33 0.275 0.0 0.0 0.0 0.0 34 0.275 0.0 0.0 0.0 0.0 35 0.275 0.0 0.0 0.0 0.0 36 0.275 0.0 0.0 0.0 0.0 37 0.275 0.0 0.0 0.0 0.0 38 0.325 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313651 spots for SRR7865985.sra Written 1313651 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra Read 1313635 spots for SRR7865985.sra Written 1313635 spots for SRR7865985.sra SRR ids: ['SRR7865985.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jaatpjyx SRR7865985.sra spots: 26272716 blocks: [[1, 1313635], [1313636, 2627270], [2627271, 3940905], [3940906, 5254540], [5254541, 6568175], [6568176, 7881810], [7881811, 9195445], [9195446, 10509080], [10509081, 11822715], [11822716, 13136350], [13136351, 14449985], [14449986, 15763620], [15763621, 17077255], [17077256, 18390890], [18390891, 19704525], [19704526, 21018160], [21018161, 22331795], [22331796, 23645430], [23645431, 24959065], [24959066, 26272716]] SRR7865985 file size 4556864 SRR7865985 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865985 SRR7865985_1.fastq Input file: SRR7865985_1.fastq trimmed: SRR7865985-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:09:23 2024 >> started Tue Dec 10 01:10:10 2024 >> done (47.627s) 26272716 reads processed; of these: 45556 ( 0.17%) short reads filtered out after trimming by size control 59503 ( 0.23%) empty reads filtered out after trimming by size control 26167657 (99.60%) reads available; of these: 1647119 ( 6.29%) trimmed reads available after processing 24520538 (93.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5260 0.02% 19 4752 0.02% 20 5900 0.02% 21 6903 0.03% 22 8646 0.03% 23 11573 0.04% 24 14622 0.06% 25 19428 0.07% 26 19221 0.07% 27 19628 0.08% 28 22431 0.09% 29 32229 0.12% 30 38580 0.15% 31 35889 0.14% 32 33768 0.13% 33 33199 0.13% 34 33108 0.13% 35 36577 0.14% 36 33840 0.13% 37 37001 0.14% 38 44929 0.17% 39 57313 0.22% 40 78179 0.30% 41 115926 0.44% 42 280900 1.07% 43 47083 0.18% 44 89382 0.34% 45 61974 0.24% 46 80865 0.31% 47 99382 0.38% 48 139629 0.53% 49 99002 0.38% 50 24520538 93.71% 26167657 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=19 prefix-density=0.59 prefix-fanout=2.3 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=49.87 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=3.1 sequence=AGCAGCAGGAGAGCCGGCGGCCGTACGTGTTCGGGCCACGGAGCTTCCAGTCCATCGTCCAGAACGAGCAGGGCTTCATCAAGTCCCTGCCCCCGTTCAGCGAGGCCTCCAGGCTCCTCCGCGGCATCAAGAACTACCGCGTCGCCGTCCTCGAGGCCAACCCGCGCTCCTTCGTCGTGCCGGGCTTCGCCGACGCCGACGGCATCGGCTACGTCGCTCAAGGCGAGGGAGTGCTGACGTTGATCCAGAACGGCGAGAGGCAGTCCTACACCGTCCGGGAAGGCGACGTCATCGTGGCGCCGGCGGGGACGCTCATGTATCTGGCCAACACCGACGGCCGGAGGAAGCTGGTCGTTGTCAAGATCCTCCACACCATCTCCGTGCCCGGCGAGTTCCAGTATTTCCGTGCCGATTCGCTCGTGTCAAGCCTGAGCAAACCCATCCAGAGAGCTGCCTTCAAGGCTTCGGATGAGCAGCTGGAGAAGGTGTTCGGGAGGCAGCGGCAGCAGC Started job on | Dec 10 01:10:47 Started mapping on | Dec 10 01:10:47 Finished on | Dec 10 01:12:41 Mapping speed, Million of reads per hour | 826.35 Number of input reads | 26167657 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 11388951 Uniquely mapped reads % | 43.52% Average mapped length | 48.75 Number of splices: Total | 1010562 Number of splices: Annotated (sjdb) | 896767 Number of splices: GT/AG | 989804 Number of splices: GC/AG | 9833 Number of splices: AT/AC | 433 Number of splices: Non-canonical | 10492 Mismatch rate per base, % | 0.95% Deletion rate per base | 0.00% Deletion average length | 1.70 Insertion rate per base | 0.01% Insertion average length | 1.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 3377296 % of reads mapped to multiple loci | 12.91% Number of reads mapped to too many loci | 2412094 % of reads mapped to too many loci | 9.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 34.18% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 11401410 11401410 11401410 N_multimapping 3377296 3377296 3377296 N_noFeature 1236537 6203937 6336199 N_ambiguous 95745 4839 5966 UnstrandedReadsAssigned:10056669 PositiveStrandReadsAssigned:5180175 NegativeStrandReadsAssigned:5046786 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR7865985 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865985-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,167,657 reads, 11,522,243 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR7865985.ke.tsv 35125 SRR7865985.se.tsv 88098 total ==> SRR7865985.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 20.61 2.68512 PNS24249 1928 1829 128.683 8.66213 PNS24246 1044 945 20.61 2.68512 PNS24248 1044 945 20.61 2.68512 PNS24244 1471 1372 20.4871 1.83842 PNS24243 293 194 1 0.634624 KQK14069 1603 1504 349.683 28.6249 KQK14071 474 375 148.131 48.6331 ==> SRR7865985.se.tsv <== BRADI_1g14170v3 620 BRADI_1g53295v3 444 BRADI_1g59795v3 114 BRADI_1g07683v3 0 BRADI_1g00485v3 15 BRADI_1g20270v3 87 BRADI_1g74790v3 0 BRADI_1g09890v3 1 BRADI_1g77505v3 86 BRADI_1g48960v3 3 SRR7865985 completed mapping pipeline successfully