Starting /dee2/code/volunteer_pipeline.sh SRR7865986 current disk space = 1523603615744 free memory = 1601812440 SRR7865986 SRAfilesize 7062ceb3745800e4b8d2a4061201b2f3 SRR7865986.sra SRR7865986.sra file validated SRR7865986 is single end SRR7865986 is conventional basespace SRR7865986 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865986_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67025 34.0 31.0 34.0 31.0 34.0 2 31.3385 34.0 31.0 34.0 30.0 34.0 3 32.18175 34.0 31.0 34.0 30.0 34.0 4 36.17725 37.0 37.0 37.0 35.0 37.0 5 36.25325 37.0 37.0 37.0 35.0 37.0 6 36.141 37.0 37.0 37.0 35.0 37.0 7 36.07475 37.0 36.0 37.0 35.0 37.0 8 36.13375 37.0 37.0 37.0 35.0 37.0 9 37.87275 39.0 38.0 39.0 35.0 39.0 10 38.0745 39.0 39.0 39.0 35.0 39.0 11 38.11 39.0 39.0 39.0 35.0 39.0 12 38.14325 39.0 39.0 39.0 37.0 39.0 13 38.112 39.0 39.0 39.0 37.0 39.0 14 39.70675 41.0 40.0 41.0 37.0 41.0 15 39.53875 41.0 40.0 41.0 37.0 41.0 16 39.54125 41.0 40.0 41.0 37.0 41.0 17 39.45775 41.0 39.0 41.0 36.0 41.0 18 39.488 41.0 39.0 41.0 37.0 41.0 19 39.521 41.0 39.0 41.0 37.0 41.0 20 39.4285 41.0 39.0 41.0 37.0 41.0 21 39.30225 41.0 39.0 41.0 36.0 41.0 22 39.11425 40.0 39.0 41.0 36.0 41.0 23 39.10875 40.0 39.0 41.0 36.0 41.0 24 39.001 40.0 39.0 41.0 35.0 41.0 25 38.92575 40.0 39.0 41.0 35.0 41.0 26 38.812 40.0 38.0 41.0 35.0 41.0 27 38.666 40.0 38.0 41.0 35.0 41.0 28 38.31275 40.0 38.0 41.0 34.0 41.0 29 38.37475 40.0 38.0 41.0 34.0 41.0 30 37.8395 40.0 38.0 41.0 32.0 41.0 31 38.0585 40.0 38.0 41.0 33.0 41.0 32 37.326 40.0 37.0 41.0 31.0 41.0 33 37.6785 40.0 37.0 41.0 33.0 41.0 34 37.38475 40.0 37.0 41.0 31.0 41.0 35 37.83775 40.0 38.0 41.0 33.0 41.0 36 37.679 40.0 38.0 41.0 33.0 41.0 37 37.91225 40.0 38.0 41.0 33.0 41.0 38 37.9185 40.0 38.0 41.0 33.0 41.0 39 37.92375 40.0 38.0 41.0 33.0 41.0 40 37.87675 40.0 38.0 41.0 33.0 41.0 41 37.86825 40.0 37.0 41.0 33.0 41.0 42 37.82175 40.0 37.0 41.0 33.0 41.0 43 37.6815 40.0 37.0 41.0 33.0 41.0 44 37.3985 40.0 37.0 41.0 33.0 41.0 45 37.129 40.0 36.0 41.0 32.0 41.0 46 36.8985 40.0 36.0 41.0 31.0 41.0 47 36.87925 40.0 35.0 41.0 32.0 41.0 48 36.7045 40.0 35.0 41.0 31.0 41.0 49 36.69275 40.0 35.0 41.0 31.0 41.0 50 36.28375 39.0 35.0 41.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 1.0 16 4.0 17 1.0 18 10.0 19 4.0 20 3.0 21 9.0 22 6.0 23 10.0 24 6.0 25 11.0 26 20.0 27 27.0 28 14.0 29 28.0 30 42.0 31 63.0 32 63.0 33 94.0 34 112.0 35 167.0 36 250.0 37 377.0 38 755.0 39 1918.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.685857321652065 12.065081351689612 9.912390488110137 49.33667083854819 2 23.985239852398525 18.318397469688982 32.78861360042172 24.907749077490777 3 25.45 21.15 21.925 31.474999999999998 4 29.7 24.925 18.075 27.3 5 29.599999999999998 28.175 21.625 20.599999999999998 6 25.424999999999997 32.525 19.85 22.2 7 22.2 20.25 35.225 22.325 8 22.05 22.125 28.000000000000004 27.825 9 23.9 20.674999999999997 29.925 25.5 10 23.775 34.075 22.35 19.8 11 27.200000000000003 25.674999999999997 20.200000000000003 26.924999999999997 12 24.925 21.675 25.15 28.249999999999996 13 23.0 25.1 25.7 26.200000000000003 14 23.75 25.55 25.575 25.124999999999996 15 24.75 24.525 24.099999999999998 26.625 16 24.625 24.9 24.15 26.325 17 25.6 24.325 24.375 25.7 18 26.35 25.674999999999997 22.15 25.825 19 24.85 26.450000000000003 23.075000000000003 25.624999999999996 20 26.674999999999997 24.375 23.25 25.7 21 25.275 24.05 24.15 26.525 22 26.0 23.974999999999998 23.5 26.525 23 24.875 25.174999999999997 23.825 26.125 24 24.875 25.900000000000002 24.5 24.725 25 24.2 24.05 25.224999999999998 26.525 26 25.674999999999997 24.25 24.375 25.7 27 25.7 24.425 24.025 25.85 28 25.45 24.7 23.525 26.325 29 25.2 24.775 25.025 25.0 30 24.525 23.95 25.45 26.075 31 25.05 25.224999999999998 23.375 26.35 32 26.525 25.75 23.45 24.275 33 25.15 23.549999999999997 22.35 28.95 34 24.95 24.3 23.525 27.224999999999998 35 25.624999999999996 24.7 23.125 26.55 36 26.224999999999998 24.025 24.3 25.45 37 26.174999999999997 24.625 24.4 24.8 38 25.124999999999996 25.674999999999997 24.349999999999998 24.85 39 26.25 24.675 23.674999999999997 25.4 40 25.55 24.675 24.099999999999998 25.674999999999997 41 25.7 24.45 24.075 25.775 42 25.575 24.175 24.575 25.674999999999997 43 28.1 23.400000000000002 23.0 25.5 44 25.775 22.900000000000002 24.474999999999998 26.85 45 25.4 25.25 24.474999999999998 24.875 46 25.6 24.5 23.45 26.450000000000003 47 26.5 24.3 24.099999999999998 25.1 48 26.6 23.25 23.724999999999998 26.424999999999997 49 25.775 24.65 23.275000000000002 26.3 50 24.675 25.35 23.425 26.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 2.0 21 2.5 22 3.0 23 3.0 24 3.0 25 5.5 26 8.0 27 8.5 28 9.0 29 13.5 30 18.0 31 24.5 32 31.0 33 46.5 34 62.0 35 84.5 36 107.0 37 137.0 38 167.0 39 192.5 40 218.0 41 246.5 42 275.0 43 281.5 44 288.0 45 306.0 46 324.0 47 307.0 48 290.0 49 298.0 50 306.0 51 284.0 52 262.0 53 248.5 54 235.0 55 234.0 56 233.0 57 194.5 58 156.0 59 169.5 60 183.0 61 183.0 62 183.0 63 152.5 64 122.0 65 110.5 66 99.0 67 94.5 68 90.0 69 84.5 70 79.0 71 77.5 72 76.0 73 74.0 74 72.0 75 59.0 76 46.0 77 40.5 78 35.0 79 21.5 80 8.0 81 6.0 82 4.0 83 2.0 84 0.0 85 1.5 86 3.0 87 2.5 88 2.0 89 1.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.125 2 5.1499999999999995 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 94.57863660762212 88.1 2 4.052603327965647 7.55 3 0.9393451422436929 2.625 4 0.322061191626409 1.2 5 0.08051529790660225 0.375 6 0.026838432635534086 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTAATAGTTATCATACTAACTCATTCACTCCTGTGCCTTAGGGGTCGAAG 6 0.15 No Hit GAATTTCCCGATCCTTAACCTCGTGCAAATGAGTGCTACGAGGGTAAATC 5 0.125 No Hit GTGAAGGATACCAGTATATCGCTTTCAAGACCAACGCAAACTCCATGGTT 5 0.125 No Hit TGTTAATCATACCACAAAACTATGTCGTTTTAAAGAAGGCGGAGAGTGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10 0.1 0.0 0.0 0.0 0.0 11 0.1 0.0 0.0 0.0 0.0 12 0.125 0.0 0.0 0.0 0.0 13 0.125 0.0 0.0 0.0 0.0 14 0.125 0.0 0.0 0.0 0.0 15 0.125 0.0 0.0 0.0 0.0 16 0.125 0.0 0.0 0.0 0.0 17 0.125 0.0 0.0 0.0 0.0 18 0.125 0.0 0.0 0.0 0.0 19 0.125 0.0 0.0 0.0 0.0 20 0.125 0.0 0.0 0.0 0.0 21 0.125 0.0 0.0 0.0 0.0 22 0.125 0.0 0.0 0.0 0.0 23 0.125 0.0 0.0 0.0 0.0 24 0.125 0.0 0.0 0.0 0.0 25 0.125 0.0 0.0 0.0 0.0 26 0.125 0.0 0.0 0.0 0.0 27 0.125 0.0 0.0 0.0 0.0 28 0.175 0.0 0.0 0.0 0.0 29 0.175 0.0 0.0 0.0 0.0 30 0.175 0.0 0.0 0.0 0.0 31 0.2 0.0 0.0 0.0 0.0 32 0.225 0.0 0.0 0.0 0.0 33 0.25 0.0 0.0 0.0 0.0 34 0.25 0.0 0.0 0.0 0.0 35 0.25 0.0 0.0 0.0 0.0 36 0.25 0.0 0.0 0.0 0.0 37 0.25 0.0 0.0 0.0 0.0 38 0.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464515 spots for SRR7865986.sra Written 3464515 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra Read 3464499 spots for SRR7865986.sra Written 3464499 spots for SRR7865986.sra SRR ids: ['SRR7865986.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1mois7f_ SRR7865986.sra spots: 69289996 blocks: [[1, 3464499], [3464500, 6928998], [6928999, 10393497], [10393498, 13857996], [13857997, 17322495], [17322496, 20786994], [20786995, 24251493], [24251494, 27715992], [27715993, 31180491], [31180492, 34644990], [34644991, 38109489], [38109490, 41573988], [41573989, 45038487], [45038488, 48502986], [48502987, 51967485], [51967486, 55431984], [55431985, 58896483], [58896484, 62360982], [62360983, 65825481], [65825482, 69289996]] SRR7865986 file size 12035811 SRR7865986 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865986 SRR7865986_1.fastq Input file: SRR7865986_1.fastq trimmed: SRR7865986-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:20:08 2024 >> started Tue Dec 10 01:20:52 2024 >> done (44.072s) 69289996 reads processed; of these: 126667 ( 0.18%) short reads filtered out after trimming by size control 167291 ( 0.24%) empty reads filtered out after trimming by size control 68996038 (99.58%) reads available; of these: 3943980 ( 5.72%) trimmed reads available after processing 65052058 (94.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16251 0.02% 19 13465 0.02% 20 15612 0.02% 21 19449 0.03% 22 22898 0.03% 23 32516 0.05% 24 40343 0.06% 25 52943 0.08% 26 48862 0.07% 27 50906 0.07% 28 59069 0.09% 29 82195 0.12% 30 96215 0.14% 31 79575 0.12% 32 78192 0.11% 33 76287 0.11% 34 79622 0.12% 35 83626 0.12% 36 82843 0.12% 37 89350 0.13% 38 105962 0.15% 39 137547 0.20% 40 179864 0.26% 41 264627 0.38% 42 647934 0.94% 43 111283 0.16% 44 212474 0.31% 45 146174 0.21% 46 191455 0.28% 47 239115 0.35% 48 339479 0.49% 49 247847 0.36% 50 65052058 94.28% 68996038 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=13 prefix-density=0.53 prefix-fanout=2.5 sequence=CCTCGCAGCCGCAGGGACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=32.20 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=2.1 sequence=ACAAACATCAAGTGCTGCACACTTGCGATTTATTTATTTTACTCTACAGTTCTCATATATATTAGTTCATTCGCTCTGATGCCTTGCGACTTGAAGCCGATTCCTCAAAACTCTGGTAGCTCAATGGAGGGAATTTAGTAGTGAAGGCGCCAAACTCTTCTCCCC Started job on | Dec 10 01:21:08 Started mapping on | Dec 10 01:21:09 Finished on | Dec 10 01:22:24 Mapping speed, Million of reads per hour | 3311.81 Number of input reads | 68996038 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 42020155 Uniquely mapped reads % | 60.90% Average mapped length | 49.16 Number of splices: Total | 3798899 Number of splices: Annotated (sjdb) | 3560472 Number of splices: GT/AG | 3705744 Number of splices: GC/AG | 45848 Number of splices: AT/AC | 1882 Number of splices: Non-canonical | 45425 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.01% Insertion average length | 1.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 11918954 % of reads mapped to multiple loci | 17.27% Number of reads mapped to too many loci | 12829782 % of reads mapped to too many loci | 18.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 15056929 15056929 15056929 N_multimapping 11918954 11918954 11918954 N_noFeature 2277753 21702769 22082837 N_ambiguous 559302 22718 26219 UnstrandedReadsAssigned:39183100 PositiveStrandReadsAssigned:20294668 NegativeStrandReadsAssigned:19911099 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR7865986 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865986-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 68,996,038 reads, 49,361,899 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR7865986.ke.tsv 35125 SRR7865986.se.tsv 88098 total ==> SRR7865986.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 78.0753 2.33928 PNS24249 1928 1829 340.975 5.27849 PNS24246 1044 945 78.0753 2.33928 PNS24248 1044 945 78.0753 2.33928 PNS24244 1471 1372 307.799 6.35206 PNS24243 293 194 5 0.729742 KQK14069 1603 1504 2870.58 54.0409 KQK14071 474 375 922.316 69.6385 ==> SRR7865986.se.tsv <== BRADI_1g14170v3 4712 BRADI_1g53295v3 4874 BRADI_1g59795v3 507 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 321 BRADI_1g74790v3 1 BRADI_1g09890v3 0 BRADI_1g77505v3 540 BRADI_1g48960v3 13 SRR7865986 completed mapping pipeline successfully