Starting /dee2/code/volunteer_pipeline.sh SRR7865987 current disk space = 1523584995328 free memory = 1568562712 SRR7865987 SRAfilesize 2de82a258a7be640ea3bf4f0643aaa8f SRR7865987.sra SRR7865987.sra file validated SRR7865987 is single end SRR7865987 is conventional basespace SRR7865987 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865987_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.675 34.0 31.0 34.0 31.0 34.0 2 31.10625 34.0 31.0 34.0 30.0 34.0 3 32.01275 34.0 31.0 34.0 30.0 34.0 4 36.11025 37.0 37.0 37.0 35.0 37.0 5 36.26975 37.0 37.0 37.0 35.0 37.0 6 36.177 37.0 37.0 37.0 35.0 37.0 7 36.0815 37.0 36.0 37.0 35.0 37.0 8 36.1315 37.0 36.0 37.0 35.0 37.0 9 37.85775 39.0 38.0 39.0 35.0 39.0 10 38.091 39.0 39.0 39.0 37.0 39.0 11 38.12375 39.0 39.0 39.0 35.0 39.0 12 38.091 39.0 39.0 39.0 37.0 39.0 13 37.984 39.0 38.0 39.0 35.0 39.0 14 39.576 41.0 40.0 41.0 37.0 41.0 15 39.4185 41.0 39.0 41.0 36.0 41.0 16 39.54425 41.0 40.0 41.0 37.0 41.0 17 39.44275 41.0 39.0 41.0 36.0 41.0 18 39.37425 41.0 39.0 41.0 36.0 41.0 19 39.41975 41.0 39.0 41.0 36.0 41.0 20 39.292 41.0 39.0 41.0 36.0 41.0 21 39.213 40.0 39.0 41.0 36.0 41.0 22 39.01225 40.0 39.0 41.0 35.0 41.0 23 38.9775 40.0 39.0 41.0 35.0 41.0 24 38.992 40.0 38.0 41.0 35.0 41.0 25 38.81925 40.0 38.0 41.0 35.0 41.0 26 38.7675 40.0 38.0 41.0 35.0 41.0 27 38.576 40.0 38.0 41.0 34.0 41.0 28 38.34625 40.0 38.0 41.0 34.0 41.0 29 38.28975 40.0 38.0 41.0 34.0 41.0 30 37.656 40.0 37.0 41.0 32.0 41.0 31 37.72625 40.0 37.0 41.0 33.0 41.0 32 37.07075 40.0 37.0 41.0 31.0 41.0 33 37.36975 40.0 37.0 41.0 31.0 41.0 34 37.14625 39.0 36.0 41.0 31.0 41.0 35 37.41375 40.0 37.0 41.0 32.0 41.0 36 37.3315 40.0 37.0 41.0 32.0 41.0 37 37.5735 40.0 37.0 41.0 32.0 41.0 38 37.633 40.0 37.0 41.0 33.0 41.0 39 37.567 40.0 37.0 41.0 33.0 41.0 40 37.3995 40.0 37.0 41.0 32.0 41.0 41 37.32075 40.0 37.0 41.0 32.0 41.0 42 37.18175 40.0 36.0 41.0 32.0 41.0 43 37.089 40.0 36.0 41.0 32.0 41.0 44 36.73025 40.0 35.0 41.0 31.0 41.0 45 36.594 39.0 35.0 41.0 31.0 41.0 46 36.22075 39.0 35.0 41.0 30.0 41.0 47 36.1665 39.0 35.0 41.0 30.0 41.0 48 36.0895 39.0 35.0 41.0 31.0 41.0 49 35.88275 39.0 35.0 41.0 30.0 41.0 50 35.4775 38.0 35.0 41.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 3.0 16 1.0 17 4.0 18 2.0 19 8.0 20 6.0 21 7.0 22 7.0 23 11.0 24 19.0 25 8.0 26 19.0 27 19.0 28 27.0 29 44.0 30 45.0 31 50.0 32 90.0 33 89.0 34 143.0 35 186.0 36 266.0 37 466.0 38 848.0 39 1629.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.046785088816613 11.408556417312985 8.531398548911683 51.01325994495872 2 26.22907254849854 17.592346532022322 28.673930374701033 27.5046505447781 3 27.275 19.15 20.325 33.25 4 31.724999999999998 24.3 15.85 28.125 5 32.7 26.3 17.224999999999998 23.775 6 27.425 31.3 19.1 22.175 7 23.025000000000002 20.75 32.925 23.3 8 22.1 22.325 26.900000000000002 28.675 9 25.3 20.549999999999997 27.275 26.875 10 23.825 31.75 22.25 22.175 11 29.75 22.400000000000002 19.025 28.825 12 27.150000000000002 20.0 22.725 30.125 13 25.424999999999997 24.875 24.9 24.8 14 26.650000000000002 23.375 23.075000000000003 26.900000000000002 15 25.525 22.925 23.799999999999997 27.750000000000004 16 26.700000000000003 24.675 21.7 26.924999999999997 17 27.400000000000002 23.549999999999997 21.975 27.075 18 25.624999999999996 22.925 24.55 26.900000000000002 19 28.050000000000004 22.3 22.825 26.825 20 25.8 23.724999999999998 22.45 28.025 21 28.15 24.075 22.225 25.55 22 27.675 23.275000000000002 21.95 27.1 23 26.75 23.549999999999997 21.2 28.499999999999996 24 27.325 23.075000000000003 22.325 27.275 25 25.900000000000002 23.849999999999998 22.975 27.275 26 26.075 22.775000000000002 21.9 29.25 27 26.325 22.75 23.425 27.500000000000004 28 27.150000000000002 24.025 21.425 27.400000000000002 29 27.55 22.650000000000002 21.7 28.1 30 27.200000000000003 22.625 22.725 27.450000000000003 31 26.674999999999997 23.474999999999998 22.425 27.425 32 26.75 23.525 21.75 27.975 33 27.325 23.5 22.35 26.825 34 26.400000000000002 23.9 21.65 28.050000000000004 35 26.6 23.375 22.05 27.975 36 27.0 24.349999999999998 21.525 27.125 37 27.125 22.400000000000002 22.0 28.475 38 27.075 23.525 22.175 27.224999999999998 39 27.450000000000003 22.0 22.900000000000002 27.650000000000002 40 26.900000000000002 23.225 22.375 27.500000000000004 41 28.499999999999996 21.7 21.675 28.125 42 26.700000000000003 23.125 22.05 28.125 43 26.900000000000002 23.724999999999998 22.650000000000002 26.724999999999998 44 27.506876719179797 23.280820205051263 22.13053263315829 27.081770442610654 45 27.474999999999998 23.225 21.775 27.525 46 28.075 22.35 23.175 26.400000000000002 47 27.700000000000003 22.825 22.225 27.250000000000004 48 27.68192048012003 22.405601400350086 23.20580145036259 26.70667666916729 49 27.05 22.5 22.925 27.525 50 26.85 24.275 22.05 26.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 2.0 19 1.0 20 0.0 21 0.5 22 1.0 23 3.0 24 5.0 25 5.5 26 6.0 27 7.0 28 8.0 29 11.5 30 15.0 31 18.5 32 22.0 33 31.5 34 41.0 35 59.5 36 78.0 37 75.0 38 72.0 39 103.0 40 134.0 41 157.0 42 180.0 43 190.0 44 200.0 45 215.5 46 231.0 47 248.5 48 266.0 49 265.5 50 265.0 51 282.0 52 299.0 53 308.0 54 317.0 55 285.0 56 253.0 57 266.5 58 280.0 59 258.0 60 236.0 61 230.0 62 224.0 63 187.5 64 151.0 65 154.0 66 157.0 67 142.0 68 127.0 69 132.0 70 137.0 71 107.0 72 77.0 73 73.5 74 70.0 75 59.5 76 49.0 77 41.0 78 33.0 79 34.0 80 35.0 81 25.0 82 15.0 83 9.5 84 4.0 85 4.0 86 4.0 87 4.0 88 4.0 89 2.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 5.925 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.107868681605 93.175 2 2.214695153725899 4.25 3 0.39082855653986454 1.125 4 0.10422094841063052 0.4 5 0.10422094841063052 0.5 6 0.05211047420531526 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02605523710265763 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAAACATCTCAGTAGCTGGAGGAAAAGACATCAACCGAGATTCCGTAA 10 0.25 No Hit GTTTGATTCTGGCTCAGAACGAACGCTGGCGGCATGCCTAACACATGCAA 6 0.15 No Hit AAGATATCTTATCTTGAGGGAGGCTTCCCGCTTAGATGCTTTCAGCGGTT 6 0.15 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 5 0.125 TruSeq Adapter, Index 6 (100% over 50bp) CGGTCATGCACGAGTATTTAGGCTTGGAGGGTGGTCCCCCCATGTTCAGA 5 0.125 No Hit CTGTGTTTTTGCTAAACAGTCGCTACCCCCTGGCCTGTGCCCCCCACAAC 5 0.125 No Hit CCGTCACACACCACCAGGCCCACGAATATTAACGTGGTTCCCATCGACTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.075 0.0 0.0 0.0 0.0 10 0.125 0.0 0.0 0.0 0.0 11 0.125 0.0 0.0 0.0 0.0 12 0.175 0.0 0.0 0.0 0.0 13 0.2 0.0 0.0 0.0 0.0 14 0.2 0.0 0.0 0.0 0.0 15 0.2 0.0 0.0 0.0 0.0 16 0.2 0.0 0.0 0.0 0.0 17 0.2 0.0 0.0 0.0 0.0 18 0.225 0.0 0.0 0.0 0.0 19 0.225 0.0 0.0 0.0 0.0 20 0.225 0.0 0.0 0.0 0.0 21 0.225 0.0 0.0 0.0 0.0 22 0.25 0.0 0.0 0.0 0.0 23 0.25 0.0 0.0 0.0 0.0 24 0.25 0.0 0.0 0.0 0.0 25 0.25 0.0 0.0 0.0 0.0 26 0.25 0.0 0.0 0.0 0.0 27 0.25 0.0 0.0 0.0 0.0 28 0.25 0.0 0.0 0.0 0.0 29 0.275 0.0 0.0 0.0 0.0 30 0.275 0.0 0.0 0.0 0.0 31 0.275 0.0 0.0 0.0 0.0 32 0.3 0.0 0.0 0.0 0.0 33 0.3 0.0 0.0 0.0 0.0 34 0.3 0.0 0.0 0.0 0.0 35 0.3 0.0 0.0 0.0 0.0 36 0.325 0.0 0.0 0.0 0.0 37 0.325 0.0 0.0 0.0 0.0 38 0.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064984 spots for SRR7865987.sra Written 3064984 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra Read 3064982 spots for SRR7865987.sra Written 3064982 spots for SRR7865987.sra SRR ids: ['SRR7865987.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yt75d1ow SRR7865987.sra spots: 61299642 blocks: [[1, 3064982], [3064983, 6129964], [6129965, 9194946], [9194947, 12259928], [12259929, 15324910], [15324911, 18389892], [18389893, 21454874], [21454875, 24519856], [24519857, 27584838], [27584839, 30649820], [30649821, 33714802], [33714803, 36779784], [36779785, 39844766], [39844767, 42909748], [42909749, 45974730], [45974731, 49039712], [49039713, 52104694], [52104695, 55169676], [55169677, 58234658], [58234659, 61299642]] SRR7865987 file size 10646570 SRR7865987 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865987 SRR7865987_1.fastq Input file: SRR7865987_1.fastq trimmed: SRR7865987-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:19:01 2024 >> started Tue Dec 10 01:19:42 2024 >> done (40.271s) 61299642 reads processed; of these: 104839 ( 0.17%) short reads filtered out after trimming by size control 68091 ( 0.11%) empty reads filtered out after trimming by size control 61126712 (99.72%) reads available; of these: 4066461 ( 6.65%) trimmed reads available after processing 57060251 (93.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14946 0.02% 19 12012 0.02% 20 16063 0.03% 21 18873 0.03% 22 25223 0.04% 23 31487 0.05% 24 38053 0.06% 25 50445 0.08% 26 50042 0.08% 27 51775 0.08% 28 61005 0.10% 29 87949 0.14% 30 102079 0.17% 31 90087 0.15% 32 84797 0.14% 33 85114 0.14% 34 83992 0.14% 35 89792 0.15% 36 86639 0.14% 37 95636 0.16% 38 114588 0.19% 39 148550 0.24% 40 196364 0.32% 41 287363 0.47% 42 677228 1.11% 43 116682 0.19% 44 214068 0.35% 45 147841 0.24% 46 193459 0.32% 47 236544 0.39% 48 321728 0.53% 49 236037 0.39% 50 57060251 93.35% 61126712 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.00 fanout-score-rank=28 prefix-density=0.04 prefix-fanout=1.0 sequence=GTTTGATTCTGGCTCAGAACGAACGCTGGCGGCATGCCTAACACATGCAAGTCGAACGAAGGCTTCGGCCTTAGTGGCGCACGGGTGCGTAACGCGTGGGAATCTGCCCTTGGGTACGGAATAACTCACCGAAAGGTGTGCTAATACCGTATGATGACGTAAGTCCAAAGATTTATCGCCTGAGGATGAGCCCGCGTTGGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCTCTTTTACCCGGGAAGATAATGACTGTACCGGGAGAATAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=6 fanout-score=76.52 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=15.7 sequence=CCGCCGCCGCCA Started job on | Dec 10 01:20:01 Started mapping on | Dec 10 01:20:01 Finished on | Dec 10 01:22:30 Mapping speed, Million of reads per hour | 1476.89 Number of input reads | 61126712 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 38171175 Uniquely mapped reads % | 62.45% Average mapped length | 48.91 Number of splices: Total | 4557195 Number of splices: Annotated (sjdb) | 4292142 Number of splices: GT/AG | 4485733 Number of splices: GC/AG | 52013 Number of splices: AT/AC | 2566 Number of splices: Non-canonical | 16883 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.00% Deletion average length | 1.69 Insertion rate per base | 0.01% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4731577 % of reads mapped to multiple loci | 7.74% Number of reads mapped to too many loci | 5229049 % of reads mapped to too many loci | 8.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.10% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 18223960 18223960 18223960 N_multimapping 4731577 4731577 4731577 N_noFeature 1540673 19356758 19569425 N_ambiguous 852641 39338 33945 UnstrandedReadsAssigned:35777861 PositiveStrandReadsAssigned:18775079 NegativeStrandReadsAssigned:18567805 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR7865987 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865987-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 61,126,712 reads, 37,424,995 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,227 rounds 52973 SRR7865987.ke.tsv 35125 SRR7865987.se.tsv 88098 total ==> SRR7865987.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 43.5559 1.91899 PNS24247 1044 945 18.462 0.720441 PNS24249 1928 1829 276.679 5.57844 PNS24246 1044 945 18.462 0.720441 PNS24248 1044 945 18.462 0.720441 PNS24244 1471 1372 14.379 0.386478 PNS24243 293 194 3 0.570256 KQK14069 1603 1504 13376.3 327.973 KQK14071 474 375 5105.33 502.045 ==> SRR7865987.se.tsv <== BRADI_1g14170v3 19555 BRADI_1g53295v3 547 BRADI_1g59795v3 223 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 576 BRADI_1g74790v3 257 BRADI_1g09890v3 32 BRADI_1g77505v3 509 BRADI_1g48960v3 0 SRR7865987 completed mapping pipeline successfully