Starting /dee2/code/volunteer_pipeline.sh SRR7865989 current disk space = 1523621380096 free memory = 1568607420 SRR7865989 SRAfilesize 0956afe0f806e3b2f3c02326f082890f SRR7865989.sra SRR7865989.sra file validated SRR7865989 is single end SRR7865989 is conventional basespace SRR7865989 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865989_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.95575 34.0 33.0 34.0 31.0 34.0 2 32.757 34.0 34.0 34.0 31.0 34.0 3 33.23875 34.0 34.0 34.0 31.0 34.0 4 36.5885 37.0 37.0 37.0 35.0 37.0 5 36.67875 37.0 37.0 37.0 35.0 37.0 6 36.7355 37.0 37.0 37.0 37.0 37.0 7 36.75225 37.0 37.0 37.0 37.0 37.0 8 36.72925 37.0 37.0 37.0 37.0 37.0 9 38.60175 39.0 39.0 39.0 38.0 39.0 10-14 38.8976 39.4 39.2 39.4 38.0 39.4 15-19 40.1776 41.0 40.0 41.0 38.6 41.0 20-24 39.92345 41.0 40.0 41.0 38.0 41.0 25-29 39.643350000000005 41.0 39.6 41.0 37.2 41.0 30-34 39.1905 40.8 38.8 41.0 35.4 41.0 35-39 38.8505 40.8 38.2 41.0 35.0 41.0 40-44 38.223499999999994 40.0 36.2 41.0 34.4 41.0 45-49 37.6053 39.6 35.0 41.0 33.4 41.0 50-54 36.772 38.2 35.0 40.6 32.8 41.0 55-59 36.09204999999999 36.6 35.0 40.2 32.0 41.0 60-64 35.70004999999999 35.2 35.0 39.6 32.0 41.0 65-69 35.182900000000004 35.0 35.0 38.4 31.6 40.8 70-74 34.39895 35.0 34.4 36.6 31.0 39.2 75-79 33.56419999999999 35.0 33.8 35.2 29.6 37.4 80-84 33.001549999999995 35.0 33.4 35.0 29.0 36.2 85-89 32.3618 35.0 33.0 35.0 27.4 35.4 90-94 31.894849999999998 35.0 33.0 35.0 25.6 35.0 95-99 31.485200000000003 35.0 32.4 35.0 24.4 35.0 100-104 31.00755 34.2 31.6 35.0 22.8 35.0 105-109 30.47365 34.0 31.0 35.0 20.0 35.0 110-114 29.596549999999997 34.0 29.4 35.0 15.8 35.0 115-119 29.114649999999994 34.0 29.0 35.0 10.2 35.0 120-124 28.0143 33.0 26.6 35.0 2.0 35.0 125-129 26.7385 32.4 24.4 35.0 2.0 35.0 130-134 25.744400000000002 31.8 21.8 34.6 2.0 35.0 135-139 24.31975 31.0 16.4 34.0 2.0 35.0 140-144 22.71075 29.8 3.6 34.0 2.0 35.0 145-149 20.406950000000002 28.6 2.0 34.0 2.0 35.0 150 13.8455 2.0 2.0 27.0 2.0 32.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 2.0 5 1.0 6 4.0 7 1.0 8 5.0 9 7.0 10 8.0 11 7.0 12 6.0 13 8.0 14 9.0 15 8.0 16 10.0 17 12.0 18 18.0 19 29.0 20 26.0 21 25.0 22 46.0 23 38.0 24 43.0 25 53.0 26 70.0 27 85.0 28 100.0 29 129.0 30 166.0 31 174.0 32 267.0 33 320.0 34 484.0 35 660.0 36 749.0 37 422.0 38 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.04437483685722 14.69590185330201 11.224223440354999 44.035499869485776 2 33.175 17.075000000000003 19.3 30.45 3 24.15 18.35 20.575 36.925000000000004 4 29.7 18.775 18.099999999999998 33.425 5 31.65 24.65 19.2 24.5 6 30.599999999999998 26.325 17.925 25.15 7 23.65 21.825 29.75 24.775 8 25.25 22.6 24.5 27.650000000000002 9 25.7 20.349999999999998 25.424999999999997 28.525 10-14 26.66133306665333 24.206210310515523 22.041102055102755 27.091354567728388 15-19 27.190876350540215 22.794117647058822 22.478991596638657 27.536014405762305 20-24 27.1 22.715 22.535 27.650000000000002 25-29 27.175 22.74 22.195 27.889999999999997 30-34 27.105 22.405 22.98 27.51 35-39 27.084999999999997 22.465 22.095000000000002 28.355000000000004 40-44 27.425 22.425 22.2 27.950000000000003 45-49 27.32 22.065 22.14 28.475 50-54 28.345 22.06 21.755 27.839999999999996 55-59 27.834999999999997 22.275 22.015 27.875 60-64 27.165 22.075 22.345000000000002 28.415000000000003 65-69 27.834999999999997 22.425 21.94 27.800000000000004 70-74 27.83 22.03 21.89 28.249999999999996 75-79 27.915 21.62 21.83 28.634999999999998 80-84 27.875 22.12 21.85 28.155 85-89 28.08 21.54 22.13 28.249999999999996 90-94 28.249999999999996 22.06 21.765 27.925 95-99 28.365000000000002 21.485000000000003 21.925 28.225 100-104 27.950000000000003 22.165000000000003 21.83 28.055000000000003 105-109 28.08 22.314999999999998 21.759999999999998 27.845 110-114 28.275 22.09 22.06 27.575 115-119 28.4 21.265 21.65 28.685 120-124 28.57 22.03 21.044999999999998 28.355000000000004 125-129 29.110000000000003 21.935 21.11 27.845 130-134 28.904999999999998 21.735 21.125 28.235 135-139 29.695 22.445 20.810000000000002 27.05 140-144 29.630000000000003 21.805 20.515 28.050000000000004 145-149 30.055 23.155 19.595000000000002 27.195000000000004 150 29.95 21.8 17.525 30.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 0.5 28 2.0 29 4.0 30 4.0 31 5.5 32 8.5 33 10.5 34 14.0 35 25.0 36 32.0 37 32.5 38 46.5 39 62.5 40 71.5 41 92.5 42 104.0 43 112.0 44 129.0 45 124.5 46 127.5 47 130.5 48 122.5 49 123.0 50 124.0 51 113.0 52 98.5 53 99.5 54 100.0 55 89.0 56 77.0 57 76.0 58 86.5 59 95.0 60 94.0 61 90.0 62 89.5 63 94.5 64 101.0 65 108.5 66 94.5 67 94.0 68 101.0 69 97.0 70 103.0 71 95.0 72 78.5 73 67.5 74 63.5 75 60.5 76 49.5 77 39.0 78 34.0 79 24.5 80 15.5 81 14.5 82 18.0 83 12.0 84 5.0 85 2.5 86 0.5 87 1.5 88 1.0 89 0.0 90 0.5 91 1.0 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.2250000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.04 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.425 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 1.125 0.0 0.0 0.0 0.0 134-135 1.475 0.0 0.0 0.0 0.0 136-137 2.1625 0.0 0.0 0.0 0.0 138 2.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334784 spots for SRR7865989.sra Written 2334784 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra Read 2334782 spots for SRR7865989.sra Written 2334782 spots for SRR7865989.sra SRR ids: ['SRR7865989.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ipa4goao SRR7865989.sra spots: 46695642 blocks: [[1, 2334782], [2334783, 4669564], [4669565, 7004346], [7004347, 9339128], [9339129, 11673910], [11673911, 14008692], [14008693, 16343474], [16343475, 18678256], [18678257, 21013038], [21013039, 23347820], [23347821, 25682602], [25682603, 28017384], [28017385, 30352166], [30352167, 32686948], [32686949, 35021730], [35021731, 37356512], [37356513, 39691294], [39691295, 42026076], [42026077, 44360858], [44360859, 46695642]] SRR7865989 file size 17182368 SRR7865989 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865989 SRR7865989_1.fastq Input file: SRR7865989_1.fastq trimmed: SRR7865989-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:24:34 2024 >> started Tue Dec 10 01:25:05 2024 >> done (30.851s) 46695642 reads processed; of these: 49635 ( 0.11%) short reads filtered out after trimming by size control 32411 ( 0.07%) empty reads filtered out after trimming by size control 46613596 (99.82%) reads available; of these: 27633852 (59.28%) trimmed reads available after processing 18979744 (40.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6126 0.01% 19 6417 0.01% 20 6954 0.01% 21 7820 0.02% 22 7775 0.02% 23 8574 0.02% 24 9253 0.02% 25 9871 0.02% 26 11206 0.02% 27 11175 0.02% 28 11720 0.03% 29 12586 0.03% 30 11959 0.03% 31 12342 0.03% 32 12741 0.03% 33 12829 0.03% 34 13067 0.03% 35 13637 0.03% 36 13733 0.03% 37 14411 0.03% 38 14877 0.03% 39 15607 0.03% 40 15852 0.03% 41 16066 0.03% 42 17287 0.04% 43 17541 0.04% 44 17599 0.04% 45 17663 0.04% 46 18623 0.04% 47 20024 0.04% 48 19818 0.04% 49 19845 0.04% 50 19831 0.04% 51 17203 0.04% 52 17059 0.04% 53 18362 0.04% 54 18411 0.04% 55 18705 0.04% 56 19081 0.04% 57 19056 0.04% 58 19254 0.04% 59 18803 0.04% 60 19282 0.04% 61 20137 0.04% 62 21440 0.05% 63 21722 0.05% 64 23804 0.05% 65 28200 0.06% 66 27985 0.06% 67 26895 0.06% 68 27352 0.06% 69 27339 0.06% 70 27918 0.06% 71 30083 0.06% 72 32098 0.07% 73 32722 0.07% 74 33475 0.07% 75 33256 0.07% 76 30316 0.07% 77 31878 0.07% 78 35515 0.08% 79 37082 0.08% 80 39559 0.08% 81 43385 0.09% 82 44286 0.10% 83 46291 0.10% 84 48348 0.10% 85 50900 0.11% 86 52776 0.11% 87 54724 0.12% 88 56146 0.12% 89 58921 0.13% 90 62253 0.13% 91 64809 0.14% 92 68161 0.15% 93 70315 0.15% 94 73911 0.16% 95 78005 0.17% 96 81300 0.17% 97 85877 0.18% 98 90526 0.19% 99 94721 0.20% 100 99435 0.21% 101 104917 0.23% 102 109222 0.23% 103 111830 0.24% 104 119030 0.26% 105 125230 0.27% 106 130901 0.28% 107 138055 0.30% 108 145638 0.31% 109 150892 0.32% 110 162304 0.35% 111 167418 0.36% 112 175854 0.38% 113 188672 0.40% 114 203788 0.44% 115 223654 0.48% 116 243744 0.52% 117 249336 0.53% 118 245547 0.53% 119 249062 0.53% 120 252276 0.54% 121 260510 0.56% 122 274815 0.59% 123 281997 0.60% 124 294048 0.63% 125 307344 0.66% 126 320915 0.69% 127 331720 0.71% 128 353947 0.76% 129 369162 0.79% 130 383727 0.82% 131 408403 0.88% 132 423006 0.91% 133 451583 0.97% 134 475166 1.02% 135 480888 1.03% 136 499313 1.07% 137 529032 1.13% 138 561028 1.20% 139 599277 1.29% 140 655240 1.41% 141 705033 1.51% 142 776446 1.67% 143 878784 1.89% 144 988991 2.12% 145 1141639 2.45% 146 1355208 2.91% 147 1578771 3.39% 148 1944150 4.17% 149 3962428 8.50% 150 18979744 40.72% 46613596 reads passed initial QC criterion=sequence-density sequence-density=1.57 sequence-density-rank=1 fanout-score=70.46 fanout-score-rank=9 prefix-density=2.36 prefix-fanout=46.9 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=269.53 fanout-score-rank=1 prefix-density=1.31 prefix-fanout=24.2 sequence=GCGGCGGCGGCC Started job on | Dec 10 01:25:28 Started mapping on | Dec 10 01:25:29 Finished on | Dec 10 01:26:31 Mapping speed, Million of reads per hour | 2706.60 Number of input reads | 46613596 Average input read length | 138 UNIQUE READS: Uniquely mapped reads number | 44482890 Uniquely mapped reads % | 95.43% Average mapped length | 138.02 Number of splices: Total | 16744987 Number of splices: Annotated (sjdb) | 15760716 Number of splices: GT/AG | 16506672 Number of splices: GC/AG | 189852 Number of splices: AT/AC | 8632 Number of splices: Non-canonical | 39831 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 2.63 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 888416 % of reads mapped to multiple loci | 1.91% Number of reads mapped to too many loci | 847077 % of reads mapped to too many loci | 1.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.64% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1242290 1242290 1242290 N_multimapping 888416 888416 888416 N_noFeature 1165295 22547347 22453387 N_ambiguous 749380 56439 53549 UnstrandedReadsAssigned:42568215 PositiveStrandReadsAssigned:21879104 NegativeStrandReadsAssigned:21975954 Dataset is classified unstranded MeadianReadLen=149 20thPercentileLength=136 echo kmer=131 SRR7865989 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865989-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 46,613,596 reads, 43,781,541 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,309 rounds 52973 SRR7865989.ke.tsv 35125 SRR7865989.se.tsv 88098 total ==> SRR7865989.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 0 0 PNS24247 1044 945 45.9377 1.69017 PNS24249 1928 1829 597.51 11.3586 PNS24246 1044 945 45.9377 1.69017 PNS24248 1044 945 45.9377 1.69017 PNS24244 1471 1372 83.6766 2.12052 PNS24243 293 194 16 2.86755 KQK14069 1603 1504 6828.33 157.855 KQK14071 474 375 1332.43 123.539 ==> SRR7865989.se.tsv <== BRADI_1g14170v3 8324 BRADI_1g53295v3 211 BRADI_1g59795v3 638 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 757 BRADI_1g74790v3 795 BRADI_1g09890v3 0 BRADI_1g77505v3 552 BRADI_1g48960v3 6 SRR7865989 completed mapping pipeline successfully