Starting /dee2/code/volunteer_pipeline.sh SRR7865990 current disk space = 1523536916480 free memory = 1411144468 SRR7865990 SRAfilesize 47e20c2e72c9738b8f11a35f0752578c SRR7865990.sra SRR7865990.sra file validated SRR7865990 is single end SRR7865990 is conventional basespace SRR7865990 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865990_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8105 34.0 33.0 34.0 31.0 34.0 2 32.6675 34.0 33.0 34.0 31.0 34.0 3 33.259 34.0 34.0 34.0 31.0 34.0 4 36.65275 37.0 37.0 37.0 35.0 37.0 5 36.6675 37.0 37.0 37.0 35.0 37.0 6 36.734 37.0 37.0 37.0 37.0 37.0 7 36.72475 37.0 37.0 37.0 37.0 37.0 8 36.749 37.0 37.0 37.0 37.0 37.0 9 38.67125 39.0 39.0 39.0 39.0 39.0 10-14 38.942099999999996 39.4 39.2 39.4 38.4 39.4 15-19 40.200149999999994 41.0 40.0 41.0 38.6 41.0 20-24 39.9665 41.0 40.0 41.0 38.0 41.0 25-29 39.57045 41.0 39.8 41.0 37.2 41.0 30-34 39.3009 41.0 39.2 41.0 35.8 41.0 35-39 39.0454 41.0 38.8 41.0 35.0 41.0 40-44 38.37025 40.2 36.8 41.0 34.6 41.0 45-49 37.7154 39.8 35.2 41.0 33.6 41.0 50-54 36.828500000000005 38.4 35.0 40.6 32.8 41.0 55-59 36.3679 37.2 35.0 40.4 32.6 41.0 60-64 35.6743 35.4 35.0 39.6 31.8 41.0 65-69 35.23639999999999 35.0 35.0 38.4 32.4 40.8 70-74 34.51425 35.0 35.0 36.6 31.4 39.2 75-79 33.744749999999996 35.0 33.8 35.2 30.8 37.4 80-84 33.2462 35.0 34.0 35.0 30.0 36.2 85-89 32.82655 35.0 33.6 35.0 29.2 35.4 90-94 32.33575 35.0 33.0 35.0 28.0 35.0 95-99 31.9125 35.0 33.0 35.0 26.6 35.0 100-104 31.465250000000005 35.0 32.6 35.0 24.2 35.0 105-109 31.103299999999997 34.6 32.0 35.0 23.4 35.0 110-114 30.530549999999998 34.0 31.0 35.0 20.4 35.0 115-119 29.932850000000002 34.0 30.2 35.0 17.2 35.0 120-124 28.868450000000003 33.6 28.6 35.0 7.0 35.0 125-129 28.1606 33.0 27.0 35.0 2.0 35.0 130-134 27.020999999999997 33.0 25.0 35.0 2.0 35.0 135-139 25.7769 31.8 23.4 34.2 2.0 35.0 140-144 24.466250000000002 31.0 16.2 34.0 2.0 35.0 145-149 22.26605 30.4 2.0 34.0 2.0 35.0 150 15.29325 18.0 2.0 29.0 2.0 32.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 4.0 6 2.0 7 6.0 8 6.0 9 4.0 10 7.0 11 5.0 12 9.0 13 9.0 14 12.0 15 10.0 16 12.0 17 10.0 18 11.0 19 17.0 20 27.0 21 20.0 22 33.0 23 39.0 24 39.0 25 41.0 26 51.0 27 62.0 28 81.0 29 105.0 30 136.0 31 135.0 32 226.0 33 288.0 34 455.0 35 710.0 36 967.0 37 457.0 38 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.117955439056352 14.967234600262122 12.241153342070774 42.67365661861074 2 33.300000000000004 17.299999999999997 20.3 29.099999999999998 3 24.75 19.575 17.424999999999997 38.25 4 30.425 19.475 18.25 31.85 5 30.95 24.4 19.875 24.775 6 29.225 25.874999999999996 19.225 25.674999999999997 7 23.425 22.400000000000002 29.7 24.474999999999998 8 25.775 22.725 23.799999999999997 27.700000000000003 9 24.474999999999998 20.25 27.224999999999998 28.050000000000004 10-14 26.950000000000003 23.945 22.02 27.084999999999997 15-19 26.568598018613027 23.88171720204143 22.290603422395677 27.259081356949867 20-24 27.145000000000003 23.200000000000003 22.275 27.38 25-29 27.21 23.13 21.89 27.77 30-34 27.125 23.01 22.13 27.735 35-39 27.185 22.675 22.255 27.884999999999998 40-44 28.24 22.770000000000003 21.375 27.615000000000002 45-49 27.57 23.04 21.755 27.634999999999998 50-54 27.279999999999998 22.615 21.595 28.51 55-59 27.99 22.345000000000002 22.285 27.38 60-64 27.24 22.68 21.57 28.51 65-69 27.35 22.425 22.325 27.900000000000002 70-74 27.61 21.884999999999998 22.435 28.07 75-79 27.450000000000003 22.23 21.935 28.384999999999998 80-84 27.665 22.03 21.98 28.325 85-89 27.54 22.39 21.915000000000003 28.155 90-94 27.735 22.145 22.105 28.015 95-99 28.23 22.45 21.965 27.355 100-104 28.095 21.654999999999998 22.115000000000002 28.134999999999998 105-109 28.01 22.035 22.07 27.884999999999998 110-114 28.060000000000002 22.335 21.625 27.98 115-119 28.199999999999996 21.84 21.57 28.389999999999997 120-124 28.345 22.245 21.75 27.66 125-129 28.87 21.645 21.785 27.700000000000003 130-134 28.77 21.84 21.86 27.529999999999998 135-139 28.939999999999998 22.375 21.015 27.67 140-144 29.409999999999997 21.529999999999998 21.11 27.950000000000003 145-149 29.585 21.240000000000002 21.14 28.035 150 29.549999999999997 22.05 17.2 31.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 0.5 28 1.5 29 2.0 30 2.0 31 3.0 32 6.0 33 11.0 34 13.5 35 16.0 36 28.0 37 40.0 38 46.5 39 61.5 40 77.5 41 84.5 42 101.0 43 118.5 44 123.5 45 123.5 46 128.5 47 132.5 48 132.5 49 136.5 50 123.0 51 105.0 52 117.5 53 121.0 54 105.5 55 103.5 56 104.5 57 97.5 58 97.5 59 95.5 60 92.5 61 95.0 62 91.0 63 88.0 64 90.5 65 82.5 66 86.0 67 98.0 68 98.0 69 94.5 70 84.0 71 77.0 72 74.0 73 73.0 74 61.0 75 52.5 76 49.0 77 38.5 78 26.0 79 15.0 80 11.5 81 11.0 82 9.5 83 9.5 84 7.5 85 5.5 86 3.0 87 2.0 88 2.0 89 1.5 90 2.5 91 2.0 92 0.5 93 0.5 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.06999999999999999 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.30000000000000004 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 1.15 0.0 0.0 0.0 0.0 132-133 1.5375 0.0 0.0 0.0 0.0 134-135 1.875 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138 2.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAAGC 10 0.0064622764 147.66667 1 CCATCGT 10 0.0069772652 143.975 7 >>END_MODULE Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643973 spots for SRR7865990.sra Written 2643973 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra Read 2643971 spots for SRR7865990.sra Written 2643971 spots for SRR7865990.sra SRR ids: ['SRR7865990.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2tq5f4ze SRR7865990.sra spots: 52879422 blocks: [[1, 2643971], [2643972, 5287942], [5287943, 7931913], [7931914, 10575884], [10575885, 13219855], [13219856, 15863826], [15863827, 18507797], [18507798, 21151768], [21151769, 23795739], [23795740, 26439710], [26439711, 29083681], [29083682, 31727652], [31727653, 34371623], [34371624, 37015594], [37015595, 39659565], [39659566, 42303536], [42303537, 44947507], [44947508, 47591478], [47591479, 50235449], [50235450, 52879422]] SRR7865990 file size 19459049 SRR7865990 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865990 SRR7865990_1.fastq Input file: SRR7865990_1.fastq trimmed: SRR7865990-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:29:45 2024 >> started Tue Dec 10 01:30:29 2024 >> done (43.832s) 52879422 reads processed; of these: 59314 ( 0.11%) short reads filtered out after trimming by size control 34920 ( 0.07%) empty reads filtered out after trimming by size control 52785188 (99.82%) reads available; of these: 28377344 (53.76%) trimmed reads available after processing 24407844 (46.24%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7206 0.01% 19 7012 0.01% 20 8011 0.02% 21 8156 0.02% 22 8748 0.02% 23 9880 0.02% 24 10188 0.02% 25 11505 0.02% 26 12025 0.02% 27 11958 0.02% 28 12447 0.02% 29 12792 0.02% 30 13552 0.03% 31 13648 0.03% 32 13736 0.03% 33 14324 0.03% 34 14407 0.03% 35 15437 0.03% 36 15469 0.03% 37 15958 0.03% 38 16879 0.03% 39 17010 0.03% 40 17735 0.03% 41 17805 0.03% 42 18370 0.03% 43 19012 0.04% 44 19652 0.04% 45 19211 0.04% 46 20493 0.04% 47 21182 0.04% 48 20995 0.04% 49 20724 0.04% 50 21036 0.04% 51 17183 0.03% 52 17938 0.03% 53 18884 0.04% 54 19176 0.04% 55 19435 0.04% 56 19577 0.04% 57 19414 0.04% 58 19361 0.04% 59 19208 0.04% 60 19809 0.04% 61 20594 0.04% 62 21208 0.04% 63 21256 0.04% 64 23349 0.04% 65 26203 0.05% 66 25768 0.05% 67 26720 0.05% 68 27934 0.05% 69 26786 0.05% 70 27674 0.05% 71 29305 0.06% 72 30003 0.06% 73 31373 0.06% 74 31945 0.06% 75 31717 0.06% 76 28573 0.05% 77 30224 0.06% 78 32549 0.06% 79 33996 0.06% 80 35825 0.07% 81 38541 0.07% 82 40096 0.08% 83 41292 0.08% 84 42454 0.08% 85 44153 0.08% 86 45938 0.09% 87 47660 0.09% 88 49070 0.09% 89 51050 0.10% 90 53430 0.10% 91 54438 0.10% 92 55664 0.11% 93 57685 0.11% 94 59841 0.11% 95 62190 0.12% 96 65475 0.12% 97 67635 0.13% 98 71080 0.13% 99 73636 0.14% 100 77736 0.15% 101 81997 0.16% 102 85012 0.16% 103 89744 0.17% 104 94576 0.18% 105 97367 0.18% 106 101648 0.19% 107 106794 0.20% 108 111247 0.21% 109 119131 0.23% 110 127662 0.24% 111 131617 0.25% 112 139270 0.26% 113 149310 0.28% 114 159257 0.30% 115 176434 0.33% 116 191753 0.36% 117 197169 0.37% 118 197289 0.37% 119 194399 0.37% 120 200814 0.38% 121 208667 0.40% 122 220689 0.42% 123 231019 0.44% 124 242022 0.46% 125 255112 0.48% 126 266497 0.50% 127 281404 0.53% 128 299236 0.57% 129 313681 0.59% 130 334406 0.63% 131 354211 0.67% 132 370367 0.70% 133 397924 0.75% 134 422350 0.80% 135 441736 0.84% 136 470184 0.89% 137 507649 0.96% 138 539471 1.02% 139 586596 1.11% 140 662682 1.26% 141 727180 1.38% 142 817264 1.55% 143 951136 1.80% 144 1113805 2.11% 145 1324692 2.51% 146 1607188 3.04% 147 1913684 3.63% 148 2422629 4.59% 149 5002759 9.48% 150 24407844 46.24% 52785188 reads passed initial QC criterion=sequence-density sequence-density=1.73 sequence-density-rank=1 fanout-score=68.51 fanout-score-rank=11 prefix-density=2.53 prefix-fanout=46.7 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=329.94 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=26.8 sequence=CGGCGGCGGCGA Started job on | Dec 10 01:31:03 Started mapping on | Dec 10 01:31:03 Finished on | Dec 10 01:32:14 Mapping speed, Million of reads per hour | 2676.43 Number of input reads | 52785188 Average input read length | 141 UNIQUE READS: Uniquely mapped reads number | 50439365 Uniquely mapped reads % | 95.56% Average mapped length | 140.25 Number of splices: Total | 19701616 Number of splices: Annotated (sjdb) | 18648112 Number of splices: GT/AG | 19439451 Number of splices: GC/AG | 203063 Number of splices: AT/AC | 16242 Number of splices: Non-canonical | 42860 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 817413 % of reads mapped to multiple loci | 1.55% Number of reads mapped to too many loci | 970250 % of reads mapped to too many loci | 1.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.84% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1528410 1528410 1528410 N_multimapping 817413 817413 817413 N_noFeature 1055178 25459066 25362778 N_ambiguous 776009 57012 57034 UnstrandedReadsAssigned:48608178 PositiveStrandReadsAssigned:24923287 NegativeStrandReadsAssigned:25019553 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7865990 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865990-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,785,188 reads, 49,856,253 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR7865990.ke.tsv 35125 SRR7865990.se.tsv 88098 total ==> SRR7865990.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 62.0232 2.36135 PNS24247 1044 945 30.8198 1.03927 PNS24249 1928 1829 452.518 7.88412 PNS24246 1044 945 30.8198 1.03927 PNS24248 1044 945 30.8198 1.03927 PNS24244 1471 1372 0 0 PNS24243 293 194 9 1.47833 KQK14069 1603 1504 63.9433 1.35481 KQK14071 474 375 4.05669 0.344724 ==> SRR7865990.se.tsv <== BRADI_1g14170v3 68 BRADI_1g53295v3 26 BRADI_1g59795v3 443 BRADI_1g07683v3 0 BRADI_1g00485v3 772 BRADI_1g20270v3 13066 BRADI_1g74790v3 61 BRADI_1g09890v3 41 BRADI_1g77505v3 265 BRADI_1g48960v3 0 SRR7865990 completed mapping pipeline successfully