Starting /dee2/code/volunteer_pipeline.sh SRR7865992 current disk space = 1523522797568 free memory = 1567988620 SRR7865992 SRAfilesize 39971864f47fab8ea49406edeb916664 SRR7865992.sra SRR7865992.sra file validated SRR7865992 is single end SRR7865992 is conventional basespace SRR7865992 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865992_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.91225 34.0 33.0 34.0 31.0 34.0 2 32.7145 34.0 34.0 34.0 31.0 34.0 3 33.2375 34.0 34.0 34.0 31.0 34.0 4 36.58875 37.0 37.0 37.0 35.0 37.0 5 36.6935 37.0 37.0 37.0 35.0 37.0 6 36.73175 37.0 37.0 37.0 37.0 37.0 7 36.73575 37.0 37.0 37.0 37.0 37.0 8 36.70375 37.0 37.0 37.0 37.0 37.0 9 38.6055 39.0 39.0 39.0 38.0 39.0 10-14 38.9076 39.4 39.2 39.4 38.0 39.4 15-19 40.177499999999995 41.0 40.0 41.0 38.6 41.0 20-24 40.0029 41.0 40.0 41.0 38.0 41.0 25-29 39.7307 41.0 40.0 41.0 37.6 41.0 30-34 39.3481 41.0 39.4 41.0 35.8 41.0 35-39 39.064350000000005 41.0 39.0 41.0 35.0 41.0 40-44 38.5787 40.4 37.4 41.0 35.0 41.0 45-49 38.0484 40.0 35.8 41.0 34.4 41.0 50-54 37.3407 39.2 35.0 41.0 33.2 41.0 55-59 36.7245 38.0 35.0 40.6 32.8 41.0 60-64 36.274649999999994 36.6 35.0 40.0 33.0 41.0 65-69 35.69005 35.4 35.0 39.0 33.0 41.0 70-74 34.828050000000005 35.0 35.0 37.2 31.8 39.4 75-79 33.9443 35.0 34.0 35.8 31.0 37.6 80-84 33.3409 35.0 34.0 35.0 30.0 36.4 85-89 32.81855 35.0 33.4 35.0 29.0 35.4 90-94 32.3387 35.0 33.0 35.0 27.4 35.0 95-99 32.0201 35.0 33.0 35.0 26.8 35.0 100-104 31.6241 35.0 32.4 35.0 25.6 35.0 105-109 31.15075 34.2 31.8 35.0 24.0 35.0 110-114 30.413 34.0 30.6 35.0 20.2 35.0 115-119 29.8944 34.0 30.0 35.0 18.0 35.0 120-124 29.034799999999997 33.8 29.0 35.0 9.2 35.0 125-129 28.062450000000002 33.0 27.0 35.0 2.0 35.0 130-134 27.1618 32.8 24.8 35.0 2.0 35.0 135-139 25.86115 32.0 22.6 34.2 2.0 35.0 140-144 24.63635 31.0 17.4 34.0 2.0 35.0 145-149 22.52505 30.6 2.0 34.0 2.0 35.0 150 15.35175 18.0 2.0 29.0 2.0 32.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 2.0 6 4.0 7 4.0 8 4.0 9 3.0 10 7.0 11 5.0 12 8.0 13 9.0 14 10.0 15 4.0 16 7.0 17 10.0 18 18.0 19 19.0 20 21.0 21 14.0 22 22.0 23 31.0 24 37.0 25 46.0 26 60.0 27 63.0 28 80.0 29 97.0 30 133.0 31 154.0 32 245.0 33 314.0 34 415.0 35 664.0 36 965.0 37 517.0 38 4.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.067920585161968 15.569487983281086 11.964472309299895 42.39811912225706 2 32.925 17.575 21.075 28.425 3 22.875 19.175 19.975 37.974999999999994 4 27.35 20.575 18.475 33.6 5 29.349999999999998 24.25 20.65 25.75 6 27.474999999999998 27.575 20.150000000000002 24.8 7 22.0 23.849999999999998 30.125 24.025 8 25.025 22.625 26.8 25.55 9 23.75 21.175 26.375 28.7 10-14 25.695 25.19 22.745 26.369999999999997 15-19 26.58063225290116 23.4343737494998 23.289315726290518 26.695678271308527 20-24 26.009999999999998 23.990000000000002 22.869999999999997 27.13 25-29 26.235000000000003 23.49 22.93 27.345000000000002 30-34 26.38 24.065 23.005 26.55 35-39 26.805 23.77 22.439999999999998 26.985 40-44 26.495 23.66 22.795 27.05 45-49 26.05 23.665 22.895 27.389999999999997 50-54 26.97 23.415 23.055 26.56 55-59 26.540000000000003 23.565 22.57 27.325 60-64 26.724999999999998 23.21 22.955000000000002 27.11 65-69 27.089999999999996 23.395 22.78 26.735 70-74 26.595000000000002 23.175 22.75 27.48 75-79 27.189999999999998 22.8 22.495 27.515 80-84 27.025 23.68 22.735 26.56 85-89 27.560000000000002 22.89 22.655 26.895000000000003 90-94 27.125 23.415 22.8 26.66 95-99 27.29 22.720000000000002 22.884999999999998 27.105 100-104 27.465 22.835 22.285 27.415 105-109 27.16 22.775000000000002 22.89 27.175 110-114 27.685 23.43 22.595000000000002 26.290000000000003 115-119 27.96 21.965 22.86 27.215 120-124 28.235 22.505 22.18 27.08 125-129 27.355 22.965 22.715 26.965 130-134 28.084999999999997 22.869999999999997 22.48 26.565 135-139 27.694999999999997 23.119999999999997 22.509999999999998 26.674999999999997 140-144 27.529999999999998 22.55 22.75 27.169999999999998 145-149 28.754999999999995 23.24 21.12 26.884999999999998 150 30.25 23.3 19.625 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.0 29 1.0 30 0.5 31 4.5 32 6.0 33 7.0 34 14.0 35 19.0 36 28.0 37 42.5 38 51.5 39 69.0 40 96.0 41 109.0 42 117.0 43 136.5 44 156.0 45 157.0 46 146.5 47 145.0 48 150.0 49 152.5 50 147.5 51 136.0 52 129.0 53 119.0 54 112.5 55 109.5 56 98.5 57 89.0 58 86.5 59 80.0 60 78.0 61 80.5 62 81.0 63 78.5 64 75.0 65 75.0 66 76.5 67 81.0 68 76.0 69 74.5 70 67.5 71 56.0 72 55.0 73 53.0 74 47.5 75 40.0 76 35.5 77 34.5 78 28.5 79 22.5 80 19.0 81 14.0 82 9.5 83 6.0 84 3.5 85 3.0 86 4.0 87 2.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.04 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.05 0.0 0.0 0.0 0.0 112-113 0.05 0.0 0.0 0.0 0.0 114-115 0.05 0.0 0.0 0.0 0.0 116-117 0.05 0.0 0.0 0.0 0.0 118-119 0.05 0.0 0.0 0.0 0.0 120-121 0.05 0.0 0.0 0.0 0.0 122-123 0.15 0.0 0.0 0.0 0.0 124-125 0.25 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.375 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.7250000000000001 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.625 0.0 0.0 0.0 0.0 138 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTGTG 10 0.006973645 144.0 4 >>END_MODULE Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413823 spots for SRR7865992.sra Written 2413823 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra Read 2413813 spots for SRR7865992.sra Written 2413813 spots for SRR7865992.sra SRR ids: ['SRR7865992.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hqtovsqn SRR7865992.sra spots: 48276270 blocks: [[1, 2413813], [2413814, 4827626], [4827627, 7241439], [7241440, 9655252], [9655253, 12069065], [12069066, 14482878], [14482879, 16896691], [16896692, 19310504], [19310505, 21724317], [21724318, 24138130], [24138131, 26551943], [26551944, 28965756], [28965757, 31379569], [31379570, 33793382], [33793383, 36207195], [36207196, 38621008], [38621009, 41034821], [41034822, 43448634], [43448635, 45862447], [45862448, 48276270]] SRR7865992 file size 17764363 SRR7865992 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865992 SRR7865992_1.fastq Input file: SRR7865992_1.fastq trimmed: SRR7865992-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:26:08 2024 >> started Tue Dec 10 01:26:37 2024 >> done (29.357s) 48276270 reads processed; of these: 48594 ( 0.10%) short reads filtered out after trimming by size control 37760 ( 0.08%) empty reads filtered out after trimming by size control 48189916 (99.82%) reads available; of these: 26615852 (55.23%) trimmed reads available after processing 21574064 (44.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5749 0.01% 19 6127 0.01% 20 6871 0.01% 21 7629 0.02% 22 7111 0.01% 23 8072 0.02% 24 8528 0.02% 25 9120 0.02% 26 10693 0.02% 27 10416 0.02% 28 10806 0.02% 29 11430 0.02% 30 11595 0.02% 31 11583 0.02% 32 11882 0.02% 33 11986 0.02% 34 11688 0.02% 35 12213 0.03% 36 12596 0.03% 37 13312 0.03% 38 13776 0.03% 39 14861 0.03% 40 14588 0.03% 41 15245 0.03% 42 16409 0.03% 43 16272 0.03% 44 16421 0.03% 45 16995 0.04% 46 17110 0.04% 47 18598 0.04% 48 18679 0.04% 49 18351 0.04% 50 18770 0.04% 51 15343 0.03% 52 16060 0.03% 53 16753 0.03% 54 17094 0.04% 55 17207 0.04% 56 17487 0.04% 57 17432 0.04% 58 17621 0.04% 59 17542 0.04% 60 18230 0.04% 61 19055 0.04% 62 19579 0.04% 63 20221 0.04% 64 22208 0.05% 65 26150 0.05% 66 24895 0.05% 67 24774 0.05% 68 25073 0.05% 69 24917 0.05% 70 25095 0.05% 71 27093 0.06% 72 28407 0.06% 73 29496 0.06% 74 29741 0.06% 75 30315 0.06% 76 26888 0.06% 77 28224 0.06% 78 31221 0.06% 79 32223 0.07% 80 34475 0.07% 81 37759 0.08% 82 38772 0.08% 83 40499 0.08% 84 41646 0.09% 85 43393 0.09% 86 44978 0.09% 87 47340 0.10% 88 48626 0.10% 89 51382 0.11% 90 53997 0.11% 91 56177 0.12% 92 58675 0.12% 93 60362 0.13% 94 62985 0.13% 95 66405 0.14% 96 69613 0.14% 97 72333 0.15% 98 76035 0.16% 99 80276 0.17% 100 83164 0.17% 101 88021 0.18% 102 92686 0.19% 103 96752 0.20% 104 102352 0.21% 105 107289 0.22% 106 111684 0.23% 107 119282 0.25% 108 123624 0.26% 109 129935 0.27% 110 138638 0.29% 111 145421 0.30% 112 154108 0.32% 113 167173 0.35% 114 176097 0.37% 115 192440 0.40% 116 209913 0.44% 117 212175 0.44% 118 213429 0.44% 119 218531 0.45% 120 220461 0.46% 121 229960 0.48% 122 241497 0.50% 123 247520 0.51% 124 260509 0.54% 125 271732 0.56% 126 284635 0.59% 127 296844 0.62% 128 313201 0.65% 129 328023 0.68% 130 344267 0.71% 131 367246 0.76% 132 383279 0.80% 133 406522 0.84% 134 430856 0.89% 135 437237 0.91% 136 458283 0.95% 137 491060 1.02% 138 525814 1.09% 139 563233 1.17% 140 622197 1.29% 141 675851 1.40% 142 752615 1.56% 143 853726 1.77% 144 973886 2.02% 145 1137882 2.36% 146 1373231 2.85% 147 1625320 3.37% 148 2066087 4.29% 149 4382610 9.09% 150 21574064 44.77% 48189916 reads passed initial QC criterion=sequence-density sequence-density=1.12 sequence-density-rank=1 fanout-score=78.24 fanout-score-rank=15 prefix-density=1.82 prefix-fanout=48.1 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=445.76 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=24.1 sequence=CGCCGCCGCCACC Started job on | Dec 10 01:26:59 Started mapping on | Dec 10 01:26:59 Finished on | Dec 10 01:28:03 Mapping speed, Million of reads per hour | 2710.68 Number of input reads | 48189916 Average input read length | 140 UNIQUE READS: Uniquely mapped reads number | 45918508 Uniquely mapped reads % | 95.29% Average mapped length | 139.64 Number of splices: Total | 20225106 Number of splices: Annotated (sjdb) | 19091405 Number of splices: GT/AG | 19921050 Number of splices: GC/AG | 243795 Number of splices: AT/AC | 17939 Number of splices: Non-canonical | 42322 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.02% Deletion average length | 2.29 Insertion rate per base | 0.01% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1023080 % of reads mapped to multiple loci | 2.12% Number of reads mapped to too many loci | 793605 % of reads mapped to too many loci | 1.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1248328 1248328 1248328 N_multimapping 1023080 1023080 1023080 N_noFeature 1186296 23290104 23208176 N_ambiguous 710810 56661 59117 UnstrandedReadsAssigned:44021402 PositiveStrandReadsAssigned:22571743 NegativeStrandReadsAssigned:22651215 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7865992 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865992-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 48,189,916 reads, 45,434,170 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,221 rounds 52973 SRR7865992.ke.tsv 35125 SRR7865992.se.tsv 88098 total ==> SRR7865992.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 233.789 9.24037 PNS24247 1044 945 57.8694 2.02586 PNS24249 1928 1829 1041.9 18.8453 PNS24246 1044 945 57.8694 2.02586 PNS24248 1044 945 57.8694 2.02586 PNS24244 1471 1372 61.7024 1.48778 PNS24243 293 194 24 4.09262 KQK14069 1603 1504 128.004 2.81557 KQK14071 474 375 25.1363 2.21749 ==> SRR7865992.se.tsv <== BRADI_1g14170v3 160 BRADI_1g53295v3 40 BRADI_1g59795v3 798 BRADI_1g07683v3 0 BRADI_1g00485v3 95 BRADI_1g20270v3 3544 BRADI_1g74790v3 16 BRADI_1g09890v3 0 BRADI_1g77505v3 1047 BRADI_1g48960v3 0 SRR7865992 completed mapping pipeline successfully