Starting /dee2/code/volunteer_pipeline.sh SRR7865993 current disk space = 1523525513216 free memory = 1568471388 SRR7865993 SRAfilesize 3fd1768aa5472a3a7bfb35b545b8053c SRR7865993.sra SRR7865993.sra file validated SRR7865993 is single end SRR7865993 is conventional basespace SRR7865993 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865993_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.56325 34.0 33.0 34.0 31.0 34.0 2 32.5335 34.0 34.0 34.0 31.0 34.0 3 33.0905 34.0 34.0 34.0 31.0 34.0 4 36.561 37.0 37.0 37.0 35.0 37.0 5 36.6545 37.0 37.0 37.0 35.0 37.0 6 36.6505 37.0 37.0 37.0 35.0 37.0 7 36.62 37.0 37.0 37.0 36.0 37.0 8 36.6575 37.0 37.0 37.0 36.0 37.0 9 38.646 39.0 39.0 39.0 38.0 39.0 10-14 38.91695 39.4 39.2 39.4 38.2 39.4 15-19 40.04845 41.0 40.0 41.0 38.2 41.0 20-24 39.954100000000004 41.0 40.0 41.0 38.0 41.0 25-29 39.589099999999995 41.0 39.8 41.0 37.0 41.0 30-34 39.1863 40.8 38.8 41.0 35.2 41.0 35-39 38.96055 41.0 38.6 41.0 35.0 41.0 40-44 38.49665 40.4 37.2 41.0 35.0 41.0 45-49 37.86485 40.0 35.4 41.0 33.8 41.0 50-54 37.1247 39.2 35.0 40.8 33.0 41.0 55-59 36.67605 38.0 35.0 41.0 32.6 41.0 60-64 36.22375 36.6 35.0 40.4 32.8 41.0 65-69 35.516949999999994 35.2 35.0 39.0 32.4 41.0 70-74 34.8783 35.0 35.0 37.4 32.4 39.6 75-79 33.939550000000004 35.0 34.2 35.8 30.6 37.8 80-84 33.47455 35.0 34.0 35.0 30.4 36.6 85-89 33.0703 35.0 34.0 35.0 29.6 35.8 90-94 32.59925 35.0 33.2 35.0 28.8 35.0 95-99 32.29145 35.0 33.0 35.0 27.8 35.0 100-104 31.817699999999995 35.0 33.0 35.0 25.4 35.0 105-109 31.410899999999998 35.0 32.8 35.0 24.2 35.0 110-114 30.70105 34.8 31.4 35.0 20.2 35.0 115-119 30.2024 34.0 31.0 35.0 18.6 35.0 120-124 29.523149999999998 34.0 30.2 35.0 9.0 35.0 125-129 28.90095 34.0 29.0 35.0 2.6 35.0 130-134 28.182850000000002 33.8 28.2 35.0 2.0 35.0 135-139 27.065949999999997 33.0 24.8 35.0 2.0 35.0 140-144 26.231650000000002 33.0 23.6 35.0 2.0 35.0 145-149 24.427249999999997 32.0 11.0 34.6 2.0 35.0 150 18.082 23.0 2.0 30.0 2.0 34.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 1.0 6 3.0 7 3.0 8 8.0 9 5.0 10 4.0 11 8.0 12 5.0 13 4.0 14 11.0 15 5.0 16 8.0 17 15.0 18 15.0 19 22.0 20 17.0 21 35.0 22 31.0 23 34.0 24 33.0 25 42.0 26 54.0 27 56.0 28 77.0 29 77.0 30 93.0 31 138.0 32 165.0 33 253.0 34 367.0 35 622.0 36 1049.0 37 727.0 38 9.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.950489806724914 14.111728885358751 12.443738416732856 42.49404289118348 2 32.89144572286143 17.958979489744873 20.460230115057527 28.68934467233617 3 23.825 19.7 19.25 37.225 4 29.049999999999997 21.0 18.099999999999998 31.85 5 30.425 24.224999999999998 20.7 24.65 6 29.2 26.325 19.025 25.45 7 22.025 22.45 31.125000000000004 24.4 8 24.099999999999998 22.1 25.7 28.1 9 24.925 20.375 26.25 28.449999999999996 10-14 25.779999999999998 24.77 22.415 27.034999999999997 15-19 26.085 23.52 23.59 26.805 20-24 26.866343317165857 23.53117655882794 22.95114755737787 26.651332566628334 25-29 26.595000000000002 23.335 23.02 27.05 30-34 26.715 23.515 22.925 26.845000000000002 35-39 26.195 23.419999999999998 23.025000000000002 27.36 40-44 26.979999999999997 23.32 22.45 27.250000000000004 45-49 26.540000000000003 23.400000000000002 22.535 27.525 50-54 26.665 23.06 22.755 27.52 55-59 27.18 23.105 22.945 26.77 60-64 27.284999999999997 22.965 22.84 26.91 65-69 26.995 22.68 23.145 27.18 70-74 27.63 22.470000000000002 22.75 27.150000000000002 75-79 26.93 22.81 22.825 27.435 80-84 27.045 22.955000000000002 22.64 27.36 85-89 27.500000000000004 22.74 22.335 27.425 90-94 27.015 23.015 22.45 27.52 95-99 27.21 22.86 22.39 27.54 100-104 27.54 22.720000000000002 22.62 27.12 105-109 27.665 23.52 22.145 26.669999999999998 110-114 27.395000000000003 22.855 22.67 27.08 115-119 28.055000000000003 22.830000000000002 22.61 26.505000000000003 120-124 27.43 22.415 22.86 27.295 125-129 27.96 22.88 22.040000000000003 27.12 130-134 27.771388569428474 22.281114055702787 22.696134806740336 27.251362568128407 135-139 27.665 22.63 22.555 27.150000000000002 140-144 28.16 22.869999999999997 21.815 27.155 145-149 28.845 22.355 21.63 27.169999999999998 150 28.625 22.7 18.375 30.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 0.5 27 0.0 28 0.0 29 1.0 30 3.5 31 4.0 32 3.5 33 8.0 34 16.0 35 24.5 36 33.5 37 40.5 38 51.0 39 67.5 40 88.0 41 101.0 42 110.0 43 121.0 44 135.5 45 158.0 46 155.5 47 146.0 48 155.5 49 151.5 50 139.0 51 127.5 52 117.5 53 117.0 54 110.0 55 102.0 56 104.0 57 101.5 58 85.0 59 71.5 60 74.0 61 74.0 62 78.0 63 84.5 64 83.5 65 77.0 66 71.0 67 76.0 68 81.5 69 80.5 70 74.0 71 72.5 72 64.5 73 60.5 74 48.5 75 41.0 76 48.0 77 37.0 78 28.0 79 28.0 80 21.5 81 11.5 82 7.5 83 5.5 84 6.5 85 3.5 86 0.0 87 0.0 88 0.0 89 0.5 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.575 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.175 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.30000000000000004 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.44999999999999996 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.625 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.9750000000000001 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.55 0.0 0.0 0.0 0.0 136-137 1.9125 0.0 0.0 0.0 0.0 138 2.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723247 spots for SRR7865993.sra Written 2723247 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra Read 2723237 spots for SRR7865993.sra Written 2723237 spots for SRR7865993.sra SRR ids: ['SRR7865993.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u00ixy42 SRR7865993.sra spots: 54464750 blocks: [[1, 2723237], [2723238, 5446474], [5446475, 8169711], [8169712, 10892948], [10892949, 13616185], [13616186, 16339422], [16339423, 19062659], [19062660, 21785896], [21785897, 24509133], [24509134, 27232370], [27232371, 29955607], [29955608, 32678844], [32678845, 35402081], [35402082, 38125318], [38125319, 40848555], [40848556, 43571792], [43571793, 46295029], [46295030, 49018266], [49018267, 51741503], [51741504, 54464750]] SRR7865993 file size 20042715 SRR7865993 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865993 SRR7865993_1.fastq Input file: SRR7865993_1.fastq trimmed: SRR7865993-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:33:10 2024 >> started Tue Dec 10 01:35:17 2024 >> done (127.268s) 54464750 reads processed; of these: 66097 ( 0.12%) short reads filtered out after trimming by size control 52069 ( 0.10%) empty reads filtered out after trimming by size control 54346584 (99.78%) reads available; of these: 28180671 (51.85%) trimmed reads available after processing 26165913 (48.15%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7528 0.01% 19 8167 0.02% 20 9509 0.02% 21 9766 0.02% 22 9488 0.02% 23 10820 0.02% 24 11158 0.02% 25 12321 0.02% 26 14585 0.03% 27 13824 0.03% 28 14449 0.03% 29 15346 0.03% 30 15475 0.03% 31 15865 0.03% 32 16138 0.03% 33 16732 0.03% 34 16718 0.03% 35 17131 0.03% 36 17248 0.03% 37 17938 0.03% 38 17937 0.03% 39 19600 0.04% 40 19432 0.04% 41 20515 0.04% 42 21499 0.04% 43 21976 0.04% 44 22083 0.04% 45 22076 0.04% 46 23471 0.04% 47 24917 0.05% 48 24923 0.05% 49 24601 0.05% 50 25041 0.05% 51 20710 0.04% 52 21127 0.04% 53 22627 0.04% 54 22561 0.04% 55 23231 0.04% 56 23687 0.04% 57 24108 0.04% 58 24002 0.04% 59 23875 0.04% 60 24802 0.05% 61 26563 0.05% 62 27033 0.05% 63 28318 0.05% 64 30137 0.06% 65 34080 0.06% 66 33777 0.06% 67 34759 0.06% 68 35777 0.07% 69 36053 0.07% 70 36292 0.07% 71 39676 0.07% 72 41863 0.08% 73 42860 0.08% 74 44484 0.08% 75 44666 0.08% 76 39286 0.07% 77 41546 0.08% 78 45400 0.08% 79 49005 0.09% 80 51938 0.10% 81 55254 0.10% 82 57488 0.11% 83 59581 0.11% 84 61959 0.11% 85 65815 0.12% 86 67909 0.12% 87 71313 0.13% 88 72538 0.13% 89 74529 0.14% 90 78369 0.14% 91 80316 0.15% 92 83254 0.15% 93 87565 0.16% 94 92800 0.17% 95 96776 0.18% 96 101772 0.19% 97 105997 0.20% 98 109311 0.20% 99 114439 0.21% 100 118488 0.22% 101 124540 0.23% 102 127743 0.24% 103 132228 0.24% 104 137846 0.25% 105 144497 0.27% 106 148481 0.27% 107 154964 0.29% 108 158119 0.29% 109 165275 0.30% 110 175889 0.32% 111 184161 0.34% 112 193194 0.36% 113 201586 0.37% 114 216426 0.40% 115 232167 0.43% 116 246851 0.45% 117 247678 0.46% 118 246408 0.45% 119 247155 0.45% 120 253719 0.47% 121 258886 0.48% 122 269009 0.49% 123 273963 0.50% 124 283333 0.52% 125 294172 0.54% 126 300790 0.55% 127 311255 0.57% 128 329503 0.61% 129 346799 0.64% 130 359205 0.66% 131 379621 0.70% 132 396658 0.73% 133 416652 0.77% 134 440003 0.81% 135 448919 0.83% 136 469334 0.86% 137 489008 0.90% 138 518256 0.95% 139 553506 1.02% 140 605713 1.11% 141 658158 1.21% 142 729047 1.34% 143 819479 1.51% 144 926308 1.70% 145 1081891 1.99% 146 1305050 2.40% 147 1568623 2.89% 148 2014430 3.71% 149 4386180 8.07% 150 26165913 48.15% 54346584 reads passed initial QC criterion=sequence-density sequence-density=1.64 sequence-density-rank=1 fanout-score=71.02 fanout-score-rank=7 prefix-density=2.43 prefix-fanout=48.1 sequence=AGATCGGAAGAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=257.68 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=24.1 sequence=CGGCGGCGGCGA Started job on | Dec 10 01:35:48 Started mapping on | Dec 10 01:35:49 Finished on | Dec 10 01:37:16 Mapping speed, Million of reads per hour | 2248.82 Number of input reads | 54346584 Average input read length | 139 UNIQUE READS: Uniquely mapped reads number | 51946306 Uniquely mapped reads % | 95.58% Average mapped length | 138.76 Number of splices: Total | 21618561 Number of splices: Annotated (sjdb) | 20252933 Number of splices: GT/AG | 21289499 Number of splices: GC/AG | 261240 Number of splices: AT/AC | 18973 Number of splices: Non-canonical | 48849 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.36 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 967370 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 896428 % of reads mapped to too many loci | 1.65% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.77% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1432908 1432908 1432908 N_multimapping 967370 967370 967370 N_noFeature 1641894 26487118 26396856 N_ambiguous 818692 61670 63877 UnstrandedReadsAssigned:49485720 PositiveStrandReadsAssigned:25397518 NegativeStrandReadsAssigned:25485573 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=144 echo kmer=139 SRR7865993 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865993-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,346,584 reads, 50,903,716 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,301 rounds 52973 SRR7865993.ke.tsv 35125 SRR7865993.se.tsv 88098 total ==> SRR7865993.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 227.873 8.35846 PNS24247 1044 945 41.9927 1.36427 PNS24249 1928 1829 1471.39 24.6986 PNS24246 1044 945 41.9927 1.36427 PNS24248 1044 945 41.9927 1.36427 PNS24244 1471 1372 93.7592 2.09806 PNS24243 293 194 37 5.85543 KQK14069 1603 1504 2218.65 45.2897 KQK14071 474 375 478.838 39.2027 ==> SRR7865993.se.tsv <== BRADI_1g14170v3 2804 BRADI_1g53295v3 181 BRADI_1g59795v3 1131 BRADI_1g07683v3 0 BRADI_1g00485v3 270 BRADI_1g20270v3 3497 BRADI_1g74790v3 37 BRADI_1g09890v3 0 BRADI_1g77505v3 886 BRADI_1g48960v3 0 SRR7865993 completed mapping pipeline successfully