Starting /dee2/code/volunteer_pipeline.sh SRR7865994 current disk space = 1523512176640 free memory = 1601824844 SRR7865994 SRAfilesize 5d75b32d60b7750686cd45820c15849f SRR7865994.sra SRR7865994.sra file validated SRR7865994 is single end SRR7865994 is conventional basespace SRR7865994 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865994_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 60 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.582 34.0 31.0 34.0 31.0 34.0 2 33.0675 34.0 33.0 34.0 31.0 34.0 3 32.8095 34.0 33.0 34.0 31.0 34.0 4 36.3805 37.0 37.0 37.0 35.0 37.0 5 36.37675 37.0 37.0 37.0 35.0 37.0 6 36.4245 37.0 37.0 37.0 35.0 37.0 7 36.378 37.0 37.0 37.0 35.0 37.0 8 36.33125 37.0 37.0 37.0 35.0 37.0 9 38.20325 39.0 39.0 39.0 37.0 39.0 10-14 38.5356 39.4 39.2 39.4 37.2 39.4 15-19 39.82469999999999 41.0 40.0 41.0 38.0 41.0 20-24 39.565850000000005 41.0 40.0 41.0 37.8 41.0 25-29 39.18515 41.0 39.4 41.0 35.8 41.0 30-34 38.804050000000004 40.8 38.8 41.0 35.0 41.0 35-39 38.1334 40.0 37.0 41.0 34.8 41.0 40-44 37.306 39.4 35.0 41.0 33.2 41.0 45-49 36.42835 37.6 35.0 40.4 33.0 41.0 50-54 35.6121 35.6 35.0 40.0 31.6 41.0 55-59 35.07895 35.0 35.0 39.2 31.0 41.0 60-64 34.4827 35.0 34.0 37.4 30.8 40.2 65-69 33.663850000000004 35.0 33.8 36.0 29.8 39.2 70-74 32.75825 35.0 33.0 35.0 27.8 37.2 75-79 32.11275 35.0 33.0 35.0 27.0 36.0 80-84 31.52725 34.6 32.4 35.0 24.4 35.0 85-89 30.879700000000003 34.0 31.2 35.0 23.6 35.0 90-94 30.1943 34.0 30.6 35.0 19.4 35.0 95-99 29.249850000000002 33.2 29.2 35.0 12.8 35.0 100-104 28.390450000000005 33.0 28.2 35.0 4.0 35.0 105-109 26.99935 32.2 25.0 34.0 2.0 35.0 110-114 25.794249999999998 31.2 22.2 34.0 2.0 35.0 115-119 24.357 30.2 18.8 34.0 2.0 35.0 120-124 23.064950000000003 29.2 12.0 33.4 2.0 35.0 125-129 21.061400000000003 27.0 2.6 32.4 2.0 34.0 130-134 19.182499999999997 24.6 2.0 31.8 2.0 34.0 135-139 17.177100000000003 20.6 2.0 31.0 2.0 34.0 140-144 14.959800000000001 8.4 2.0 30.0 2.0 33.8 145-149 11.02325 2.0 2.0 22.4 2.0 32.8 150 6.24525 2.0 2.0 2.0 2.0 24.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10-14 0.0 1101 15-19 0.0 1101 20-24 0.0 1101 25-29 0.0 1101 30-34 0.0 1101 35-39 0.0 1101 40-44 0.0 1101 45-49 0.0 1101 50-54 0.0 1101 55-59 0.0 1101 60-64 0.0 1101 65-69 0.0 1101 70-74 0.0 1101 75-79 0.0 1101 80-84 0.0 1101 85-89 0.0 1101 90-94 0.0 1101 95-99 0.0 1101 100-104 0.0 1101 105-109 0.0 1101 110-114 0.0 1101 115-119 0.0 1101 120-124 0.0 1101 125-129 0.0 1101 130-134 0.0 1101 135-139 0.0 1101 140-144 0.0 1101 145-149 0.0 1101 150 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 4.0 4 1.0 5 2.0 6 5.0 7 2.0 8 6.0 9 11.0 10 6.0 11 5.0 12 10.0 13 9.0 14 13.0 15 10.0 16 17.0 17 30.0 18 41.0 19 54.0 20 55.0 21 37.0 22 48.0 23 71.0 24 102.0 25 107.0 26 134.0 27 167.0 28 183.0 29 208.0 30 276.0 31 294.0 32 399.0 33 497.0 34 514.0 35 457.0 36 174.0 37 21.0 >>END_MODULE >>Per base sequence content pass #Base G A T C 1 35.29264632316158 11.155577788894448 12.281140570285142 41.27063531765883 2 32.574999999999996 14.875 18.55 34.0 3 28.382095523880967 16.62915728932233 18.95473868467117 36.03400850212553 4 32.300000000000004 17.625 16.45 33.625 5 33.95 20.75 17.424999999999997 27.875 6 32.525 23.75 17.375 26.35 7 25.275 21.475 26.375 26.875 8 27.958876629889666 20.110330992978938 22.141424272818455 29.789368104312942 9 28.475 18.2 23.775 29.549999999999997 10-14 29.015 21.825 20.200000000000003 28.96 15-19 29.48 20.8 20.09 29.630000000000003 20-24 29.965000000000003 20.79 20.39 28.854999999999997 25-29 29.465000000000003 20.810000000000002 20.01 29.715000000000003 30-34 30.154999999999998 20.165 19.744999999999997 29.935000000000002 35-39 29.465000000000003 20.25 20.150000000000002 30.135 40-44 29.685 19.935 19.715 30.665 45-49 30.29302930293029 19.866986698669866 20.122012201220123 29.717971797179715 50-54 29.49647482374119 19.795989799489973 19.94599729986499 30.761538076903843 55-59 29.5979597959796 19.831983198319833 20.412041204120413 30.158015801580156 60-64 29.755 20.285 19.81 30.15 65-69 30.014999999999997 20.93 19.415 29.64 70-74 30.325000000000003 20.155 19.84 29.68 75-79 30.235 19.925 19.580000000000002 30.259999999999998 80-84 30.555 19.82 19.53 30.095 85-89 30.044999999999998 20.155 19.384999999999998 30.415 90-94 30.665 19.595000000000002 19.665 30.075000000000003 95-99 31.165 19.545 19.5 29.79 100-104 30.805023265122326 19.857907639965976 18.562065342472607 30.775003752439083 105-109 30.5422168867547 19.732893157262904 19.372749099639854 30.352140856342537 110-114 30.619592938940844 19.917987698154725 18.71780767115067 30.744611691753764 115-119 30.521526076303818 19.60598029901495 19.065953297664883 30.80654032701635 120-124 30.654999999999998 19.61 18.8 30.935000000000002 125-129 31.264999999999997 19.89 17.95 30.895 130-134 30.871543577178862 19.425971298564928 18.865943297164858 30.836541827091356 135-139 31.311565578278916 19.75598779938997 18.270913545677285 30.661533076653836 140-144 31.2 19.41 18.57 30.819999999999997 145-149 31.7 19.665 18.185000000000002 30.45 150 33.39169584792396 19.009504752376188 13.281640820410203 34.31715857928965 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 0.5 29 0.0 30 0.5 31 0.5 32 0.0 33 0.0 34 0.5 35 1.5 36 4.0 37 7.5 38 10.0 39 17.5 40 28.5 41 35.5 42 41.5 43 51.0 44 67.0 45 81.0 46 92.5 47 96.5 48 96.5 49 102.0 50 117.0 51 116.0 52 105.0 53 117.0 54 111.0 55 108.0 56 111.5 57 112.0 58 107.5 59 98.5 60 107.5 61 107.0 62 105.0 63 116.5 64 115.0 65 117.5 66 137.0 67 133.0 68 123.5 69 116.0 70 108.5 71 119.0 72 117.5 73 109.5 74 112.0 75 89.5 76 68.0 77 56.0 78 38.5 79 36.5 80 38.0 81 27.5 82 18.0 83 13.5 84 9.0 85 7.0 86 4.0 87 2.5 88 1.0 89 0.5 90 1.0 91 1.0 92 1.0 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.3 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.005 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.04 110-114 0.015 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.0 145-149 0.0 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.56777493606138 96.35000000000001 2 1.2531969309462916 2.45 3 0.10230179028132991 0.3 4 0.025575447570332477 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025575447570332477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025575447570332477 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGC 25 0.625 TruSeq Adapter, Index 4 (100% over 50bp) GCGGCGATGGTGGGTGCATGCTTGCAGTGCAGTTGTCCTAGATCCTGGAT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.0625 0.0 0.0 0.0 0.0 110-111 0.0875 0.0 0.0 0.0 0.0 112-113 0.1 0.0 0.0 0.0 0.0 114-115 0.1125 0.0 0.0 0.0 0.0 116-117 0.175 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.2 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.3 0.0 0.0 0.0 0.0 126-127 0.3625 0.0 0.0 0.0 0.0 128-129 0.525 0.0 0.0 0.0 0.0 130-131 0.575 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.35 0.0 0.0 0.0 0.0 138 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGGG 10 0.006973645 144.0 7 GGAAAGG 10 0.006973645 144.0 6 TAAAAAA 25 5.183459E-4 28.8 55-59 TTAAAAA 25 5.183459E-4 28.8 55-59 GGGGGGC 30 0.0015031899 24.0 3 AAAAAAA 160 0.0 19.8 60-64 GGGGGGG 105 0.0012671922 10.971428 10-14 >>END_MODULE Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra Read 2604107 spots for SRR7865994.sra Written 2604107 spots for SRR7865994.sra SRR ids: ['SRR7865994.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bwkf38k1 SRR7865994.sra spots: 52082140 blocks: [[1, 2604107], [2604108, 5208214], [5208215, 7812321], [7812322, 10416428], [10416429, 13020535], [13020536, 15624642], [15624643, 18228749], [18228750, 20832856], [20832857, 23436963], [23436964, 26041070], [26041071, 28645177], [28645178, 31249284], [31249285, 33853391], [33853392, 36457498], [36457499, 39061605], [39061606, 41665712], [41665713, 44269819], [44269820, 46873926], [46873927, 49478033], [49478034, 52082140]] SRR7865994 file size 19165926 SRR7865994 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865994 SRR7865994_1.fastq Input file: SRR7865994_1.fastq trimmed: SRR7865994-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:30:22 2024 >> started Tue Dec 10 01:31:00 2024 >> done (37.217s) 52082140 reads processed; of these: 103333 ( 0.20%) short reads filtered out after trimming by size control 443913 ( 0.85%) empty reads filtered out after trimming by size control 51534894 (98.95%) reads available; of these: 45687851 (88.65%) trimmed reads available after processing 5847043 (11.35%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8675 0.02% 19 9060 0.02% 20 10226 0.02% 21 10922 0.02% 22 11630 0.02% 23 16457 0.03% 24 14324 0.03% 25 15677 0.03% 26 27215 0.05% 27 20045 0.04% 28 17413 0.03% 29 21480 0.04% 30 17391 0.03% 31 20929 0.04% 32 20059 0.04% 33 22065 0.04% 34 21438 0.04% 35 22047 0.04% 36 22119 0.04% 37 23664 0.05% 38 23559 0.05% 39 26989 0.05% 40 26206 0.05% 41 29850 0.06% 42 28214 0.05% 43 28536 0.06% 44 32855 0.06% 45 29861 0.06% 46 31265 0.06% 47 30965 0.06% 48 30572 0.06% 49 31872 0.06% 50 30303 0.06% 51 27849 0.05% 52 30581 0.06% 53 33163 0.06% 54 34953 0.07% 55 35532 0.07% 56 40113 0.08% 57 42433 0.08% 58 43244 0.08% 59 47481 0.09% 60 51944 0.10% 61 59437 0.12% 62 65968 0.13% 63 77494 0.15% 64 92930 0.18% 65 141056 0.27% 66 133203 0.26% 67 145468 0.28% 68 94935 0.18% 69 99380 0.19% 70 95616 0.19% 71 106363 0.21% 72 112065 0.22% 73 114552 0.22% 74 120303 0.23% 75 116690 0.23% 76 118927 0.23% 77 127100 0.25% 78 134975 0.26% 79 148956 0.29% 80 155047 0.30% 81 167976 0.33% 82 172598 0.33% 83 184528 0.36% 84 191560 0.37% 85 205841 0.40% 86 211110 0.41% 87 230295 0.45% 88 226665 0.44% 89 235127 0.46% 90 240732 0.47% 91 249402 0.48% 92 265520 0.52% 93 274346 0.53% 94 290997 0.56% 95 306597 0.59% 96 324867 0.63% 97 350761 0.68% 98 381300 0.74% 99 413167 0.80% 100 401916 0.78% 101 392065 0.76% 102 383972 0.75% 103 393710 0.76% 104 408409 0.79% 105 420096 0.82% 106 430889 0.84% 107 458177 0.89% 108 482504 0.94% 109 506172 0.98% 110 516448 1.00% 111 502687 0.98% 112 504047 0.98% 113 506208 0.98% 114 507167 0.98% 115 516365 1.00% 116 532630 1.03% 117 547973 1.06% 118 560308 1.09% 119 570378 1.11% 120 582953 1.13% 121 599198 1.16% 122 613687 1.19% 123 613881 1.19% 124 635495 1.23% 125 646705 1.25% 126 659015 1.28% 127 675359 1.31% 128 687371 1.33% 129 699345 1.36% 130 707758 1.37% 131 733417 1.42% 132 751137 1.46% 133 766097 1.49% 134 788896 1.53% 135 801647 1.56% 136 830180 1.61% 137 852234 1.65% 138 880756 1.71% 139 920353 1.79% 140 976722 1.90% 141 1008544 1.96% 142 1079984 2.10% 143 1147861 2.23% 144 1219883 2.37% 145 1321129 2.56% 146 1442217 2.80% 147 1553549 3.01% 148 2095265 4.07% 149 1550062 3.01% 150 5847043 11.35% 51534894 reads passed initial QC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=18 prefix-density=0.90 prefix-fanout=3.4 sequence=TGCCGCACTTGCAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=24 fanout-score=342.69 fanout-score-rank=1 prefix-density=1.89 prefix-fanout=28.0 sequence=CGGCGGCGGCGC Started job on | Dec 10 01:31:22 Started mapping on | Dec 10 01:31:22 Finished on | Dec 10 01:32:54 Mapping speed, Million of reads per hour | 2016.58 Number of input reads | 51534894 Average input read length | 124 UNIQUE READS: Uniquely mapped reads number | 47589720 Uniquely mapped reads % | 92.34% Average mapped length | 124.33 Number of splices: Total | 15329591 Number of splices: Annotated (sjdb) | 14389829 Number of splices: GT/AG | 15120579 Number of splices: GC/AG | 173069 Number of splices: AT/AC | 9324 Number of splices: Non-canonical | 26619 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.01% Deletion average length | 2.98 Insertion rate per base | 0.01% Insertion average length | 2.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 609806 % of reads mapped to multiple loci | 1.18% Number of reads mapped to too many loci | 1679123 % of reads mapped to too many loci | 3.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3335368 3335368 3335368 N_multimapping 609806 609806 609806 N_noFeature 826167 23928792 23884455 N_ambiguous 682813 43273 43495 UnstrandedReadsAssigned:46080740 PositiveStrandReadsAssigned:23617655 NegativeStrandReadsAssigned:23661770 Dataset is classified unstranded MeadianReadLen=140 20thPercentileLength=118 echo kmer=113 SRR7865994 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865994-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 51,534,894 reads, 47,115,931 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,292 rounds 52973 SRR7865994.ke.tsv 35125 SRR7865994.se.tsv 88098 total ==> SRR7865994.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 30.3043 1.08829 PNS24247 1044 945 15.4954 0.492872 PNS24249 1928 1829 1037.96 17.0581 PNS24246 1044 945 15.4954 0.492872 PNS24248 1044 945 15.4954 0.492872 PNS24244 1471 1372 17.2524 0.377973 PNS24243 293 194 16 2.47904 KQK14069 1603 1504 9400.08 187.866 KQK14071 474 375 3875.18 310.617 ==> SRR7865994.se.tsv <== BRADI_1g14170v3 13561 BRADI_1g53295v3 146 BRADI_1g59795v3 311 BRADI_1g07683v3 0 BRADI_1g00485v3 41 BRADI_1g20270v3 2463 BRADI_1g74790v3 275 BRADI_1g09890v3 2 BRADI_1g77505v3 419 BRADI_1g48960v3 4 SRR7865994 completed mapping pipeline successfully