Starting /dee2/code/volunteer_pipeline.sh SRR7865995 current disk space = 1523496099840 free memory = 1601838060 SRR7865995 SRAfilesize fa9a84359dd20ce693b3fb84292dbb40 SRR7865995.sra SRR7865995.sra file validated SRR7865995 is single end SRR7865995 is conventional basespace SRR7865995 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865995_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.6 32.0 32.0 32.0 32.0 32.0 2 24.5475 32.0 27.0 32.0 2.0 32.0 3 34.02125 37.0 32.0 37.0 32.0 37.0 4 36.04625 37.0 37.0 37.0 32.0 37.0 5 36.43625 37.0 37.0 37.0 37.0 37.0 6 39.563 41.0 41.0 41.0 37.0 41.0 7 39.53125 41.0 41.0 41.0 37.0 41.0 8 40.15925 41.0 41.0 41.0 37.0 41.0 9 39.849 41.0 41.0 41.0 37.0 41.0 10 40.162 41.0 41.0 41.0 37.0 41.0 11 40.373 41.0 41.0 41.0 41.0 41.0 12 40.2005 41.0 41.0 41.0 37.0 41.0 13 39.87775 41.0 41.0 41.0 37.0 41.0 14 39.78925 41.0 41.0 41.0 37.0 41.0 15 39.67025 41.0 41.0 41.0 37.0 41.0 16 39.743 41.0 41.0 41.0 37.0 41.0 17 40.07425 41.0 41.0 41.0 37.0 41.0 18 40.0265 41.0 41.0 41.0 37.0 41.0 19 40.01225 41.0 41.0 41.0 37.0 41.0 20 40.0535 41.0 41.0 41.0 37.0 41.0 21 39.98525 41.0 41.0 41.0 37.0 41.0 22 40.11675 41.0 41.0 41.0 37.0 41.0 23 39.9355 41.0 41.0 41.0 37.0 41.0 24 39.9285 41.0 41.0 41.0 37.0 41.0 25 39.667 41.0 41.0 41.0 37.0 41.0 26 39.67125 41.0 41.0 41.0 37.0 41.0 27 39.8955 41.0 41.0 41.0 37.0 41.0 28 39.68875 41.0 41.0 41.0 37.0 41.0 29 39.92675 41.0 41.0 41.0 37.0 41.0 30 39.90775 41.0 41.0 41.0 37.0 41.0 31 39.7055 41.0 41.0 41.0 37.0 41.0 32 39.983 41.0 41.0 41.0 37.0 41.0 33 39.775 41.0 41.0 41.0 37.0 41.0 34 39.82925 41.0 41.0 41.0 37.0 41.0 35 40.0015 41.0 41.0 41.0 37.0 41.0 36 40.04475 41.0 41.0 41.0 37.0 41.0 37 39.84775 41.0 41.0 41.0 37.0 41.0 38 39.68975 41.0 41.0 41.0 37.0 41.0 39 40.029 41.0 41.0 41.0 37.0 41.0 40 39.6975 41.0 41.0 41.0 37.0 41.0 41 39.5825 41.0 41.0 41.0 37.0 41.0 42 39.761 41.0 41.0 41.0 37.0 41.0 43 39.73075 41.0 41.0 41.0 37.0 41.0 44 39.91325 41.0 41.0 41.0 37.0 41.0 45 40.01125 41.0 41.0 41.0 37.0 41.0 46 39.8935 41.0 41.0 41.0 37.0 41.0 47 39.5135 41.0 41.0 41.0 37.0 41.0 48 39.55325 41.0 41.0 41.0 37.0 41.0 49 39.5055 41.0 41.0 41.0 37.0 41.0 50 39.89875 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 4.0 27 3.0 28 9.0 29 18.0 30 22.0 31 37.0 32 48.0 33 77.0 34 82.0 35 89.0 36 130.0 37 132.0 38 225.0 39 1112.0 40 2011.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.075 14.75 7.75 41.425 2 25.604970568999345 20.66710268149117 33.28973185088293 20.438194898626552 3 20.375 25.3 23.200000000000003 31.125000000000004 4 27.55 31.2 17.775 23.474999999999998 5 24.975 32.300000000000004 20.9 21.825 6 22.275 30.425 21.475 25.825 7 19.525000000000002 16.75 37.525 26.200000000000003 8 21.6 18.45 25.374999999999996 34.575 9 20.45 17.175 28.65 33.725 10 24.425 33.225 19.475 22.875 11 29.799999999999997 18.425 17.775 34.0 12 26.05 16.85 21.275 35.825 13 22.625 23.799999999999997 24.275 29.299999999999997 14 24.375 23.724999999999998 25.55 26.35 15 23.1 24.349999999999998 24.349999999999998 28.199999999999996 16 25.424999999999997 24.175 23.05 27.35 17 25.650000000000002 24.775 22.900000000000002 26.674999999999997 18 24.2 23.45 24.575 27.775 19 26.8 25.4 21.4 26.400000000000002 20 25.374999999999996 23.674999999999997 24.3 26.650000000000002 21 24.65 24.175 24.5 26.674999999999997 22 26.3 23.95 23.775 25.974999999999998 23 24.575 24.95 24.45 26.025 24 24.5 23.375 25.25 26.875 25 25.124999999999996 24.4 23.9 26.575 26 25.074999999999996 24.224999999999998 24.474999999999998 26.224999999999998 27 24.325 23.400000000000002 24.525 27.750000000000004 28 24.825 24.125 23.95 27.1 29 25.1 23.9 24.9 26.1 30 24.25 24.875 24.15 26.724999999999998 31 27.224999999999998 22.7 22.225 27.85 32 25.650000000000002 25.2 23.5 25.650000000000002 33 24.75 25.15 22.875 27.224999999999998 34 26.424999999999997 23.05 22.775000000000002 27.750000000000004 35 25.2 25.6 24.425 24.775 36 25.025 21.925 25.1 27.950000000000003 37 26.0 24.075 22.725 27.200000000000003 38 25.624999999999996 24.349999999999998 24.6 25.424999999999997 39 25.424999999999997 22.95 24.7 26.924999999999997 40 25.894420815611706 23.317488116087066 22.641981486114584 28.14610958218664 41 25.75 24.65 23.200000000000003 26.400000000000002 42 24.44333249937453 23.567675756817614 24.893670252689517 27.09532149111834 43 26.125 23.400000000000002 23.474999999999998 27.0 44 26.0 24.175 23.75 26.075 45 24.2 24.725 24.7 26.375 46 26.8 22.45 23.1 27.650000000000002 47 25.924999999999997 25.324999999999996 24.05 24.7 48 25.575 24.224999999999998 23.5 26.700000000000003 49 26.375 23.9 22.375 27.35 50 25.474999999999998 24.8 24.025 25.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 2.0 20 4.0 21 3.5 22 3.0 23 2.0 24 1.0 25 2.5 26 4.0 27 9.0 28 14.0 29 22.0 30 30.0 31 36.0 32 42.0 33 56.0 34 70.0 35 91.5 36 113.0 37 131.0 38 149.0 39 168.0 40 187.0 41 214.0 42 241.0 43 265.5 44 290.0 45 288.0 46 286.0 47 276.5 48 267.0 49 280.5 50 294.0 51 273.0 52 252.0 53 240.0 54 228.0 55 224.5 56 221.0 57 211.5 58 202.0 59 193.5 60 185.0 61 176.5 62 168.0 63 154.0 64 140.0 65 139.5 66 139.0 67 126.0 68 113.0 69 104.0 70 95.0 71 82.5 72 70.0 73 65.5 74 61.0 75 55.0 76 49.0 77 38.0 78 27.0 79 28.0 80 29.0 81 20.0 82 11.0 83 10.0 84 9.0 85 5.5 86 2.0 87 2.5 88 3.0 89 2.0 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 23.549999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.075 41 0.0 42 0.075 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.87940725600409 95.775 2 2.0439448134900355 4.0 3 0.07664793050587634 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297574 READS because READLEN < 1 Read 6297574 spots for SRR7865995.sra Written 6297574 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra Rejected 6297568 READS because READLEN < 1 Read 6297568 spots for SRR7865995.sra Written 6297568 spots for SRR7865995.sra SRR ids: ['SRR7865995.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kz_sd3im SRR7865995.sra spots: 125951366 blocks: [[1, 6297568], [6297569, 12595136], [12595137, 18892704], [18892705, 25190272], [25190273, 31487840], [31487841, 37785408], [37785409, 44082976], [44082977, 50380544], [50380545, 56678112], [56678113, 62975680], [62975681, 69273248], [69273249, 75570816], [75570817, 81868384], [81868385, 88165952], [88165953, 94463520], [94463521, 100761088], [100761089, 107058656], [107058657, 113356224], [113356225, 119653792], [119653793, 125951366]] SRR7865995 file size 17740896 SRR7865995 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865995 SRR7865995_1.fastq Input file: SRR7865995_1.fastq trimmed: SRR7865995-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:27:02 2024 >> started Tue Dec 10 01:28:27 2024 >> done (84.707s) 125951366 reads processed; of these: 11155 ( 0.01%) short reads filtered out after trimming by size control 17611 ( 0.01%) empty reads filtered out after trimming by size control 125922600 (99.98%) reads available; of these: 386 ( 0.00%) trimmed reads available after processing 125922214 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 376 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 10 0.00% 50 125922214 100.00% 125922600 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=7.05 fanout-score-rank=12 prefix-density=0.22 prefix-fanout=4.4 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=150.94 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=19.9 sequence=GCGGCGGCGGCG Started job on | Dec 10 01:28:42 Started mapping on | Dec 10 01:28:42 Finished on | Dec 10 01:30:05 Mapping speed, Million of reads per hour | 5461.70 Number of input reads | 125922600 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 118381338 Uniquely mapped reads % | 94.01% Average mapped length | 49.93 Number of splices: Total | 18440270 Number of splices: Annotated (sjdb) | 17871218 Number of splices: GT/AG | 18201175 Number of splices: GC/AG | 213665 Number of splices: AT/AC | 9608 Number of splices: Non-canonical | 15822 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4673485 % of reads mapped to multiple loci | 3.71% Number of reads mapped to too many loci | 2027683 % of reads mapped to too many loci | 1.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.63% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2867777 2867777 2867777 N_multimapping 4673485 4673485 4673485 N_noFeature 3469734 116269900 4190623 N_ambiguous 1505612 10203 112835 UnstrandedReadsAssigned:113405992 PositiveStrandReadsAssigned:2101235 NegativeStrandReadsAssigned:114077880 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR7865995 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865995-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 125,922,600 reads, 114,354,057 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,498 rounds 52973 SRR7865995.ke.tsv 35125 SRR7865995.se.tsv 88098 total ==> SRR7865995.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 739.504 12.2507 PNS24247 1044 945 77.372 1.13527 PNS24249 1928 1829 850.648 6.44887 PNS24246 1044 945 77.372 1.13527 PNS24248 1044 945 77.372 1.13527 PNS24244 1471 1372 197.732 1.99834 PNS24243 293 194 0 0 KQK14069 1603 1504 389.512 3.59104 KQK14071 474 375 128.72 4.75951 ==> SRR7865995.se.tsv <== BRADI_1g14170v3 577 BRADI_1g53295v3 25 BRADI_1g59795v3 1522 BRADI_1g07683v3 0 BRADI_1g00485v3 487 BRADI_1g20270v3 43557 BRADI_1g74790v3 372 BRADI_1g09890v3 26 BRADI_1g77505v3 1740 BRADI_1g48960v3 9 SRR7865995 completed mapping pipeline successfully