Starting /dee2/code/volunteer_pipeline.sh SRR7865996 current disk space = 1523515600896 free memory = 1568251808 SRR7865996 SRAfilesize 68b86550a7af6dff0fadd1fde82225e2 SRR7865996.sra SRR7865996.sra file validated SRR7865996 is single end SRR7865996 is conventional basespace SRR7865996 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7865996_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52875 32.0 32.0 32.0 32.0 32.0 2 24.3625 32.0 12.0 32.0 2.0 32.0 3 34.15625 37.0 32.0 37.0 32.0 37.0 4 36.00125 37.0 37.0 37.0 32.0 37.0 5 36.395 37.0 37.0 37.0 37.0 37.0 6 39.683 41.0 41.0 41.0 37.0 41.0 7 39.43275 41.0 41.0 41.0 37.0 41.0 8 40.17575 41.0 41.0 41.0 37.0 41.0 9 39.841 41.0 41.0 41.0 37.0 41.0 10 40.144 41.0 41.0 41.0 37.0 41.0 11 40.42625 41.0 41.0 41.0 41.0 41.0 12 40.37375 41.0 41.0 41.0 41.0 41.0 13 39.84025 41.0 41.0 41.0 37.0 41.0 14 39.70425 41.0 41.0 41.0 37.0 41.0 15 39.773 41.0 41.0 41.0 37.0 41.0 16 39.78425 41.0 41.0 41.0 37.0 41.0 17 39.978 41.0 41.0 41.0 37.0 41.0 18 40.0905 41.0 41.0 41.0 37.0 41.0 19 40.03925 41.0 41.0 41.0 37.0 41.0 20 40.08725 41.0 41.0 41.0 37.0 41.0 21 40.08025 41.0 41.0 41.0 37.0 41.0 22 40.114 41.0 41.0 41.0 37.0 41.0 23 40.07625 41.0 41.0 41.0 37.0 41.0 24 39.97025 41.0 41.0 41.0 37.0 41.0 25 39.849 41.0 41.0 41.0 37.0 41.0 26 39.85375 41.0 41.0 41.0 37.0 41.0 27 40.08525 41.0 41.0 41.0 37.0 41.0 28 39.7605 41.0 41.0 41.0 37.0 41.0 29 39.991 41.0 41.0 41.0 37.0 41.0 30 39.946 41.0 41.0 41.0 37.0 41.0 31 39.63475 41.0 41.0 41.0 37.0 41.0 32 40.08025 41.0 41.0 41.0 37.0 41.0 33 39.9255 41.0 41.0 41.0 37.0 41.0 34 39.8525 41.0 41.0 41.0 37.0 41.0 35 40.0005 41.0 41.0 41.0 37.0 41.0 36 40.07725 41.0 41.0 41.0 41.0 41.0 37 40.01725 41.0 41.0 41.0 37.0 41.0 38 39.8585 41.0 41.0 41.0 37.0 41.0 39 40.15425 41.0 41.0 41.0 37.0 41.0 40 39.87775 41.0 41.0 41.0 37.0 41.0 41 39.73575 41.0 41.0 41.0 37.0 41.0 42 39.88925 41.0 41.0 41.0 37.0 41.0 43 39.84275 41.0 41.0 41.0 37.0 41.0 44 39.98525 41.0 41.0 41.0 37.0 41.0 45 40.0785 41.0 41.0 41.0 37.0 41.0 46 40.01125 41.0 41.0 41.0 37.0 41.0 47 39.731 41.0 41.0 41.0 37.0 41.0 48 39.64125 41.0 41.0 41.0 37.0 41.0 49 39.53375 41.0 41.0 41.0 37.0 41.0 50 39.94925 41.0 41.0 41.0 37.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 3.0 28 8.0 29 11.0 30 25.0 31 33.0 32 43.0 33 70.0 34 79.0 35 79.0 36 116.0 37 154.0 38 226.0 39 1125.0 40 2025.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.949999999999996 15.275 8.25 41.525 2 26.034143138542348 20.551543007222588 33.4865397242285 19.927774130006565 3 21.525 25.75 22.2 30.525000000000002 4 28.000000000000004 31.15 18.575 22.275 5 26.375 31.4 19.55 22.675 6 20.674999999999997 30.025000000000002 21.6 27.700000000000003 7 18.7 16.375 38.550000000000004 26.375 8 22.45 17.275 25.25 35.025 9 21.125 18.175 28.525 32.175 10 24.6 30.725 20.424999999999997 24.25 11 29.975 18.099999999999998 17.925 34.0 12 27.625 16.400000000000002 22.75 33.225 13 22.5 23.075000000000003 24.6 29.825000000000003 14 23.075000000000003 24.8 26.200000000000003 25.924999999999997 15 26.0 22.45 24.2 27.35 16 24.85 23.625 23.200000000000003 28.325 17 26.150000000000002 23.825 23.849999999999998 26.174999999999997 18 26.400000000000002 23.400000000000002 23.724999999999998 26.474999999999998 19 25.224999999999998 25.25 22.650000000000002 26.875 20 25.1 23.875 24.099999999999998 26.924999999999997 21 25.3 23.474999999999998 23.549999999999997 27.675 22 24.925 24.4 25.2 25.474999999999998 23 25.124999999999996 23.674999999999997 24.775 26.424999999999997 24 24.75 23.0 25.224999999999998 27.025 25 25.4 23.425 24.025 27.150000000000002 26 23.525 24.85 24.2 27.425 27 24.5 23.474999999999998 25.05 26.974999999999998 28 24.9 23.775 24.2 27.125 29 25.05 25.0 22.975 26.974999999999998 30 25.3 23.575 24.85 26.275 31 25.074999999999996 23.05 24.099999999999998 27.775 32 26.224999999999998 24.275 23.599999999999998 25.900000000000002 33 24.725 24.75 23.225 27.3 34 25.575 23.65 22.225 28.549999999999997 35 27.075 22.400000000000002 24.349999999999998 26.174999999999997 36 24.85 24.3 23.75 27.1 37 25.324999999999996 24.025 22.75 27.900000000000002 38 26.025 24.875 23.7 25.4 39 24.95 23.1 25.900000000000002 26.05 40 25.6 23.7 23.674999999999997 27.025 41 26.30657664416104 23.53088272068017 23.680920230057513 26.481620405101275 42 24.75 23.400000000000002 23.925 27.925 43 25.05 24.125 24.575 26.25 44 26.1 23.400000000000002 26.375 24.125 45 24.85 23.150000000000002 25.775 26.224999999999998 46 26.525 22.05 24.3 27.125 47 25.3 24.125 23.95 26.625 48 24.125 23.225 24.474999999999998 28.175 49 25.775 22.625 23.9 27.700000000000003 50 26.924999999999997 23.075000000000003 24.075 25.924999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 1.5 24 3.0 25 5.5 26 8.0 27 8.0 28 8.0 29 12.0 30 16.0 31 33.5 32 51.0 33 60.0 34 69.0 35 90.5 36 112.0 37 129.5 38 147.0 39 172.0 40 197.0 41 224.0 42 251.0 43 258.5 44 266.0 45 279.5 46 293.0 47 289.5 48 286.0 49 287.0 50 288.0 51 288.0 52 288.0 53 262.0 54 236.0 55 217.0 56 198.0 57 189.0 58 180.0 59 179.0 60 178.0 61 165.0 62 152.0 63 143.5 64 135.0 65 134.0 66 133.0 67 126.0 68 119.0 69 106.0 70 93.0 71 87.5 72 82.0 73 79.0 74 76.0 75 63.0 76 50.0 77 42.0 78 34.0 79 31.0 80 28.0 81 20.0 82 12.0 83 8.5 84 5.0 85 3.0 86 1.0 87 2.5 88 4.0 89 2.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.0 2 23.849999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.025 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34731756928554 96.7 2 1.6018306636155606 3.15 3 0.05085176709890668 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882715 READS because READLEN < 1 Read 5882715 spots for SRR7865996.sra Written 5882715 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra Rejected 5882705 READS because READLEN < 1 Read 5882705 spots for SRR7865996.sra Written 5882705 spots for SRR7865996.sra SRR ids: ['SRR7865996.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0tbsel35 SRR7865996.sra spots: 117654110 blocks: [[1, 5882705], [5882706, 11765410], [11765411, 17648115], [17648116, 23530820], [23530821, 29413525], [29413526, 35296230], [35296231, 41178935], [41178936, 47061640], [47061641, 52944345], [52944346, 58827050], [58827051, 64709755], [64709756, 70592460], [70592461, 76475165], [76475166, 82357870], [82357871, 88240575], [88240576, 94123280], [94123281, 100005985], [100005986, 105888690], [105888691, 111771395], [111771396, 117654110]] SRR7865996 file size 16557889 SRR7865996 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7865996 SRR7865996_1.fastq Input file: SRR7865996_1.fastq trimmed: SRR7865996-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Dec 10 01:27:40 2024 >> started Tue Dec 10 01:28:56 2024 >> done (76.513s) 117654110 reads processed; of these: 9657 ( 0.01%) short reads filtered out after trimming by size control 14297 ( 0.01%) empty reads filtered out after trimming by size control 117630156 (99.98%) reads available; of these: 304 ( 0.00%) trimmed reads available after processing 117629852 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 284 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 20 0.00% 50 117629852 100.00% 117630156 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=8.25 fanout-score-rank=11 prefix-density=0.22 prefix-fanout=4.9 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=12 fanout-score=166.81 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=20.5 sequence=GCGGCGGCGGCG Started job on | Dec 10 01:29:11 Started mapping on | Dec 10 01:29:11 Finished on | Dec 10 01:30:28 Mapping speed, Million of reads per hour | 5499.59 Number of input reads | 117630156 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 110346301 Uniquely mapped reads % | 93.81% Average mapped length | 49.93 Number of splices: Total | 17262376 Number of splices: Annotated (sjdb) | 16733526 Number of splices: GT/AG | 17037616 Number of splices: GC/AG | 200839 Number of splices: AT/AC | 9136 Number of splices: Non-canonical | 14785 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 4436184 % of reads mapped to multiple loci | 3.77% Number of reads mapped to too many loci | 2177938 % of reads mapped to too many loci | 1.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.53% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2847671 2847671 2847671 N_multimapping 4436184 4436184 4436184 N_noFeature 3222482 108401651 3879460 N_ambiguous 1392406 9274 102614 UnstrandedReadsAssigned:105731413 PositiveStrandReadsAssigned:1935376 NegativeStrandReadsAssigned:106364227 Dataset is classified negative stranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR7865996 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR7865996-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 117,630,156 reads, 106,686,998 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,483 rounds 52973 SRR7865996.ke.tsv 35125 SRR7865996.se.tsv 88098 total ==> SRR7865996.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 583.243 10.3473 PNS24247 1044 945 121.762 1.91331 PNS24249 1928 1829 931.494 7.5626 PNS24246 1044 945 121.762 1.91331 PNS24248 1044 945 121.762 1.91331 PNS24244 1471 1372 253.975 2.74879 PNS24243 293 194 1 0.0765426 KQK14069 1603 1504 437.825 4.32273 KQK14071 474 375 150.469 5.95827 ==> SRR7865996.se.tsv <== BRADI_1g14170v3 624 BRADI_1g53295v3 25 BRADI_1g59795v3 1413 BRADI_1g07683v3 0 BRADI_1g00485v3 426 BRADI_1g20270v3 34372 BRADI_1g74790v3 359 BRADI_1g09890v3 6 BRADI_1g77505v3 1688 BRADI_1g48960v3 7 SRR7865996 completed mapping pipeline successfully